ID: 1129570775

View in Genome Browser
Species Human (GRCh38)
Location 15:76681892-76681914
Sequence TAAAATCTCCTAGAGGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 2, 1: 4, 2: 31, 3: 39, 4: 211}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129570775_1129570780 8 Left 1129570775 15:76681892-76681914 CCATGCTCCTCTAGGAGATTTTA 0: 2
1: 4
2: 31
3: 39
4: 211
Right 1129570780 15:76681923-76681945 GTGATTGTCAGACCTGGACAGGG 0: 1
1: 0
2: 0
3: 11
4: 145
1129570775_1129570778 2 Left 1129570775 15:76681892-76681914 CCATGCTCCTCTAGGAGATTTTA 0: 2
1: 4
2: 31
3: 39
4: 211
Right 1129570778 15:76681917-76681939 CTTAGAGTGATTGTCAGACCTGG 0: 1
1: 0
2: 2
3: 12
4: 102
1129570775_1129570779 7 Left 1129570775 15:76681892-76681914 CCATGCTCCTCTAGGAGATTTTA 0: 2
1: 4
2: 31
3: 39
4: 211
Right 1129570779 15:76681922-76681944 AGTGATTGTCAGACCTGGACAGG 0: 1
1: 0
2: 1
3: 11
4: 133
1129570775_1129570781 16 Left 1129570775 15:76681892-76681914 CCATGCTCCTCTAGGAGATTTTA 0: 2
1: 4
2: 31
3: 39
4: 211
Right 1129570781 15:76681931-76681953 CAGACCTGGACAGGGCAAAGTGG 0: 1
1: 2
2: 3
3: 32
4: 374

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129570775 Original CRISPR TAAAATCTCCTAGAGGAGCA TGG (reversed) Intronic
903125009 1:21241832-21241854 GAAAATCTCCAAAAGGAGCGAGG + Intronic
903252508 1:22066207-22066229 TAAAATCTATTAGAGGGGCTGGG + Intronic
903971956 1:27124760-27124782 TAAAATGTCCAAGTGGAGGATGG - Intronic
906658153 1:47563737-47563759 TAAATCCTCCTACAGGGGCAGGG + Intergenic
907629982 1:56070883-56070905 TAAAATCATCTGGAGGAGAATGG + Intergenic
907659175 1:56376191-56376213 AAAATTCTCCCAGAGCAGCAGGG - Intergenic
909707069 1:78598079-78598101 TAAAATCTCCTAGAGTGTAAAGG + Intergenic
910820301 1:91338304-91338326 CAAAACCACTTAGAGGAGCATGG - Intronic
911766448 1:101681292-101681314 TTAAATGTCCTAGAGAAGCCAGG - Intergenic
915817671 1:158986713-158986735 TAAAGCCACCTAGAGGAGTATGG + Intergenic
916368467 1:164061407-164061429 TAAAGTCTCCTAAAGGAGCATGG - Intergenic
917011731 1:170481827-170481849 CAAAGCCTCCTAGAGGAACATGG + Intergenic
917895611 1:179484340-179484362 TAATGTCTCCTAAAGGAGCAAGG - Intronic
918860927 1:189825702-189825724 TAAAGCCACCTAGAGGAGCATGG - Intergenic
919800403 1:201350654-201350676 AAAAATCAGCTGGAGGAGCAGGG - Intergenic
921584708 1:216933395-216933417 TAAAATTTACCAGATGAGCATGG - Intronic
923289359 1:232529510-232529532 TAAAACACCCTTGAGGAGCATGG + Intronic
1063845702 10:10124780-10124802 TAAATTATCCCAGTGGAGCAGGG - Intergenic
1065266253 10:23979360-23979382 TAAATTCTCCTAGAGCAGGAAGG - Intronic
1065600564 10:27363661-27363683 TGAAATGTCCTACAGGGGCATGG + Intergenic
1066353827 10:34663109-34663131 TAATATTTCCTAGCAGAGCAGGG + Intronic
1066579709 10:36866976-36866998 TGAAATGTCCTACAGGGGCATGG - Intergenic
1068440812 10:57053177-57053199 TAAATTCTCCTAAAGGAGTATGG - Intergenic
1069054014 10:63825769-63825791 TAATATTTTTTAGAGGAGCATGG + Intergenic
1069357002 10:67598122-67598144 CAAAACCACCTAGAGGAGTATGG + Intronic
1073311582 10:102546618-102546640 TAAAGTCTCCTGGAGGGGCCTGG - Intronic
1073860472 10:107732553-107732575 TAAAATCTCCTAGAGGAGCATGG + Intergenic
1076116181 10:127902972-127902994 TAAAATCAACTAGAGGAAAAGGG + Intergenic
1077841701 11:5982626-5982648 CAAAGCCACCTAGAGGAGCATGG + Intergenic
1079747409 11:24150676-24150698 TAAAGTTTCCTAGAGGAGTATGG + Intergenic
1080272926 11:30469842-30469864 TAAATTTCCCTAAAGGAGCATGG + Intronic
1081379265 11:42394828-42394850 TTAAGGCTCCTAGGGGAGCATGG - Intergenic
1082691367 11:56308469-56308491 TGAAGCCTCCTAGAGGAGCTTGG + Intergenic
1083966089 11:66044827-66044849 TGAAGTCTCCGAGAGGTGCAGGG + Intronic
1084777995 11:71389756-71389778 TAAATTCTCCTGGAGGAGAGTGG - Intergenic
1084925903 11:72511067-72511089 TAAAGTCTCCTGAAGGAGCATGG + Intergenic
1087917841 11:103831209-103831231 TAAAGTCTCCTAGAGGAATCTGG - Intergenic
1087942119 11:104110804-104110826 TATAATCTCCTTGAGAAGGAGGG - Intronic
1090217723 11:124984494-124984516 TAATGTCTCCTAGGGGAGCAAGG + Intronic
1092720380 12:11435121-11435143 TCAAATCTTCTAGAGGAGGTAGG - Intronic
1093231294 12:16546218-16546240 TAAACTCTTCTCCAGGAGCAGGG + Intronic
1093490637 12:19700668-19700690 TAAAGTGTCCTAGAGGAGCATGG - Intronic
1093542060 12:20299026-20299048 TAAAGACACCTAGAGAAGCATGG + Intergenic
1095916473 12:47485110-47485132 TTGAATCTCCTATAGGAGAATGG + Intergenic
1096008691 12:48194309-48194331 TAAAATCTCATAAAGAAACATGG + Intergenic
1096110057 12:49023219-49023241 GAAAACTTCCCAGAGGAGCATGG - Intronic
1097512855 12:60565356-60565378 TAAAGTATCCTAGGGGAGCATGG + Intergenic
1098672401 12:73247955-73247977 GAATATCTGCTAGAGCAGCATGG - Intergenic
1098704011 12:73664789-73664811 TAAAGTCTCCTAAGGGAACAAGG - Intergenic
1099635593 12:85206905-85206927 TACCATCTCCTAGCGGAGCATGG + Intronic
1100926918 12:99558794-99558816 TAAAGCCTCCTGGAGGAGCATGG + Intronic
1101275685 12:103198479-103198501 CAAAGCCACCTAGAGGAGCATGG + Intergenic
1101470282 12:104990227-104990249 TATACTCTCCTAGAGTACCACGG + Intronic
1101471318 12:104999565-104999587 TGAAGTCTCTTAGGGGAGCAAGG + Intronic
1105320904 13:19320847-19320869 TAAAATATCCTAGAGTTGAATGG - Intergenic
1106948412 13:34854819-34854841 TAAAATCTTCAAGTGCAGCAAGG - Intergenic
1107626317 13:42289274-42289296 TAATATCTCCTATAGAGGCAGGG + Intronic
1107831342 13:44376058-44376080 TAAAAACTCTTATAGGTGCAAGG - Intronic
1108839307 13:54592990-54593012 TAAAGTCTCCTAGGAGAGCATGG - Intergenic
1109955701 13:69562883-69562905 TAAAGTCTCCTAGAGGAACATGG - Intergenic
1113170533 13:107497002-107497024 TAAAATATTCTACTGGAGCATGG + Intronic
1115634342 14:35276995-35277017 AGAAATCTGCTAGAGGACCAAGG - Intronic
1115869000 14:37778907-37778929 TAAAGTCTCCAAGGGGAGCATGG + Intronic
1116282726 14:42929087-42929109 TAAAACTTCCTAGAGGAGCATGG + Intergenic
1116782348 14:49250531-49250553 TGAAATCTCCTAAAAGAGTAAGG - Intergenic
1118254560 14:64194026-64194048 TAAAAGCTCCCAGAGCAACAAGG - Intronic
1118646621 14:67846801-67846823 TAAAGTCTCCTAGGAGAGCATGG + Intronic
1119627563 14:76193017-76193039 CAATATCGCCTAGAGGAGCAGGG + Intronic
1119990772 14:79194777-79194799 TCAGATCTCCTAGATGAGCTGGG + Intronic
1120509791 14:85399350-85399372 GCAAGTCTCCTAGAGCAGCAGGG + Intergenic
1122444341 14:101758347-101758369 AAAAGTGTCCCAGAGGAGCAGGG + Intergenic
1123126990 14:105953882-105953904 TAAAATCTCCTAGAGGAGGTTGG - Intergenic
1123407452 15:20029702-20029724 TAAAATCTCCTAGAGGAGGTTGG - Intergenic
1123516779 15:21036358-21036380 TAAAATCTCCTAGAGGAGGTTGG - Intergenic
1123721260 15:23063840-23063862 TAAAATCTCCCAGAGGAGCATGG - Intergenic
1123875764 15:24622251-24622273 TGAAGTCTCCTAGGGGAGCACGG + Intergenic
1123893886 15:24809257-24809279 TAAAGTTTCCTAGAGCTGCATGG - Intergenic
1125504913 15:40262102-40262124 TGAAATCTTCTGGAGGTGCAGGG - Intronic
1126517944 15:49556752-49556774 GAAAGTCTCCTAGGGTAGCATGG + Intronic
1126531255 15:49713427-49713449 TAAAATACCCTAGAGGAGTGTGG - Intergenic
1127462386 15:59211444-59211466 TGAAATCACCTAGAGAAGGAGGG - Intronic
1128245535 15:66130148-66130170 TTGAATCTCCCAGAGGAGAATGG - Intronic
1129066088 15:72905144-72905166 TAAAATCTCCAACAGGAACCTGG - Intergenic
1129502159 15:76049714-76049736 GAAAATCTCATGTAGGAGCAAGG - Intronic
1129570775 15:76681892-76681914 TAAAATCTCCTAGAGGAGCATGG - Intronic
1130023035 15:80247163-80247185 GATATTCTCCTAGGGGAGCATGG - Intergenic
1130175030 15:81559500-81559522 GAAAACCACATAGAGGAGCATGG + Intergenic
1131816542 15:96226922-96226944 TATAATCTCCTTGAAGGGCAGGG - Intergenic
1133942844 16:10324811-10324833 TAAAATCTCCTGGCTAAGCATGG - Intergenic
1135344702 16:21679213-21679235 TAAAATGCCCTAGAGGAGAGGGG + Intronic
1136651248 16:31673484-31673506 TAAAGTCACCTGGAAGAGCATGG + Intergenic
1139057815 16:63207529-63207551 TAAAAACTTCTAGAGGACCCAGG + Intergenic
1139099068 16:63743947-63743969 TAAAGTCTTCTAGAGGAGGATGG - Intergenic
1139616128 16:68094009-68094031 TAAAATTTCCTAGAGCAGGCAGG - Intronic
1140859232 16:79004849-79004871 TAAAATCTCACATAGGTGCACGG - Intronic
1145928162 17:28663380-28663402 TAAAACCTCCTAGAGTTGCAAGG - Intronic
1149047742 17:52267286-52267308 TAAAATCTCTTGTAGGAGTAAGG - Intergenic
1149123008 17:53192561-53192583 TAAAGTCTCTTAGAGAAGTAAGG - Intergenic
1149127538 17:53254260-53254282 TAGAGTCTTCTAGAGGAGTATGG - Intergenic
1149363109 17:55914343-55914365 TAAAGTCTCCTAGAGGAACATGG + Intergenic
1150046891 17:61922688-61922710 GGAAATCTCCCAGAGGAGAAAGG + Intronic
1150533840 17:66014450-66014472 TAAAGTCTCCTAGAGGAACATGG + Intronic
1151122472 17:71808302-71808324 TAAACCCACCTAGAGGAGTATGG - Intergenic
1151885164 17:76919219-76919241 TAAAATATCAAAGAGGAGGATGG - Intronic
1153144851 18:2019741-2019763 TAGACTCTCTCAGAGGAGCAAGG - Intergenic
1153399359 18:4666615-4666637 TAAAGTCTCCTAAGAGAGCAAGG - Intergenic
1154400776 18:14034722-14034744 TAAAATCTCCTAGGTGAGCATGG - Intergenic
1157573871 18:48730895-48730917 GAAAACGTCCTAGAGCAGCATGG - Intronic
1157726375 18:49967450-49967472 TAAAATCTCCTAGCTCAGCCTGG + Intronic
1158121801 18:54056629-54056651 CAAAACCTCTTAGAGGACCACGG + Intergenic
1159274173 18:66193926-66193948 CAAAGGCACCTAGAGGAGCATGG + Intergenic
1159459878 18:68711676-68711698 TAAAATGTTCTAGAAGGGCAAGG - Intronic
1159805679 18:72956066-72956088 GAAAATCTCCTAGAGGAGCCTGG + Intergenic
1162227651 19:9237274-9237296 TAAAAAAACCTAGAGGAACAAGG - Intergenic
1164702718 19:30297096-30297118 GAAAATCTCTTGGAGGAGGAGGG - Intronic
1165709586 19:38000643-38000665 CAAAATCTCCTAGGAAAGCAGGG + Intronic
1166909156 19:46138861-46138883 CAAAGCCACCTAGAGGAGCAAGG + Intergenic
1168595432 19:57671754-57671776 TAAAATCTCCTAGGAGACAATGG - Intronic
926279833 2:11436760-11436782 TAACTGCTCCTTGAGGAGCAGGG + Intergenic
926493226 2:13551546-13551568 TACAATGTACTAGAGTAGCATGG + Intergenic
927001119 2:18794804-18794826 TAAAATGTCCTAGTTCAGCATGG + Intergenic
928680750 2:33700008-33700030 CAAAGTGTCCTAGAGAAGCATGG - Intergenic
930943018 2:57036167-57036189 TAAAGTCACCTAGAGGATCATGG + Intergenic
930956340 2:57207205-57207227 AAATATTGCCTAGAGGAGCATGG + Intergenic
931557172 2:63518618-63518640 TAAAGTCTCCTAGGGGTGCCTGG - Intronic
932069818 2:68608222-68608244 TAATATCTTTTACAGGAGCATGG - Intronic
932312068 2:70750922-70750944 TAAAATATGGTAGAGGAGCTAGG - Intronic
934099629 2:88640815-88640837 TAACGTCTCCTATGGGAGCAAGG - Intergenic
935871544 2:107455923-107455945 CAAAGCCACCTAGAGGAGCATGG - Intergenic
936692818 2:114912944-114912966 TAAAGCCACCTAGAGGAGCATGG - Intronic
936796020 2:116204681-116204703 TAAAGTCTCTTAGAGGAGCATGG + Intergenic
936811967 2:116413371-116413393 TAAAGTCTCCTAAAGGATCATGG - Intergenic
937081536 2:119143595-119143617 TAAAATATCTTGGAGGAGCATGG + Intergenic
937846746 2:126586618-126586640 GAAGATTTCCCAGAGGAGCACGG - Intergenic
938015391 2:127862954-127862976 AAAAATCGGCTTGAGGAGCATGG + Exonic
939505270 2:143038355-143038377 AAAATTCTCCCAGAGGAGCAGGG - Intronic
939522596 2:143249133-143249155 CAAAATCTCTTTAAGGAGCATGG + Intronic
940531818 2:154887090-154887112 TAAAGTCTCCTAGAGGAGTATGG + Intergenic
940806510 2:158193504-158193526 TAAACGTTTCTAGAGGAGCAAGG - Intronic
941084912 2:161106000-161106022 TAAAATGTCCTAAATAAGCAAGG - Intergenic
941560683 2:167040629-167040651 TAAAAACCCCTAGAGAAGCATGG - Intronic
942721702 2:178960193-178960215 GAAAATTTCCTAGAGGAAAAAGG + Intronic
943830330 2:192452757-192452779 TAAAGTCTCCTAGAGGAGCTCGG - Intergenic
944364046 2:198895477-198895499 TAAATTCTACTAGAGGTACAAGG + Intergenic
944450587 2:199838343-199838365 TAAAATCGCCAAGAGAAGTAGGG + Intronic
944621734 2:201522789-201522811 CAAAATCACCTAGAGGAATATGG - Intronic
947263641 2:228252346-228252368 TGGAGTCTCCTAGAGGAACATGG + Intergenic
1173390415 20:42627091-42627113 TAGAATCTCCTAGATGTGCCCGG - Intronic
1174632127 20:51967256-51967278 AAAAATCTCCAAGAGAAGTAAGG - Intergenic
1174723513 20:52838234-52838256 GAAAAACTCCTGGAAGAGCAGGG + Intergenic
1174936963 20:54881560-54881582 CAAAATCTCCAGGAGTAGCAGGG + Intergenic
1177907819 21:26993542-26993564 TACAATTTCATAGAGAAGCATGG + Intergenic
1178222284 21:30673821-30673843 TAAAATTTTCTAGAGGAGATTGG + Intergenic
1183718954 22:39551054-39551076 AAAAATCACCTTGAGGTGCAGGG - Intergenic
949537791 3:5009249-5009271 TCTAATTTCCTAGAGGAGAAAGG - Intergenic
951258766 3:20482090-20482112 TAAAGTCTCCTAAGGGAGCAAGG - Intergenic
953571849 3:44077465-44077487 GAACATCTCCTGGAGAAGCAGGG - Intergenic
955410439 3:58652171-58652193 TAATATCTCCAAGAGGAACTTGG + Intronic
955967530 3:64404136-64404158 AAAAAACTCCTAAAGGAGAAAGG + Intronic
956378849 3:68644817-68644839 CAAAGCCACCTAGAGGAGCATGG + Intergenic
957878788 3:86183599-86183621 CAAAGACACCTAGAGGAGCATGG - Intergenic
958064775 3:88529093-88529115 CAAAGCCACCTAGAGGAGCATGG + Intergenic
958616003 3:96494123-96494145 TAAAACCTTTTGGAGGAGCATGG + Intergenic
959440030 3:106362796-106362818 TAAAGTCTCCTATGGGAGTATGG + Intergenic
962001778 3:131305522-131305544 TAAAGTCTCCTAAAGGAGCATGG + Intronic
962655796 3:137542830-137542852 TAAGGTCTCCTAGGGGAACAAGG + Intergenic
962993853 3:140605516-140605538 CAAAGCCTCCTAGAGGAACATGG - Intergenic
963008182 3:140745743-140745765 TGACAACTCTTAGAGGAGCATGG - Intergenic
964296580 3:155240234-155240256 TAAAGTATCCTAGGGAAGCAAGG + Intergenic
964486099 3:157186481-157186503 TAAACTCTCCTAGGGGAGCATGG - Intergenic
965473066 3:169119340-169119362 TAAAATCTGCCAGAGAACCATGG - Intronic
965690750 3:171354389-171354411 TGAAATTTCCTTGAGGAACACGG - Intronic
966249264 3:177844490-177844512 TAAGATCTGCTAGAGGGTCAAGG - Intergenic
966574523 3:181484707-181484729 TAAAATCTACTTGAGGAGTCAGG + Intergenic
970703496 4:18771197-18771219 TAAAGCCACCTAGAGGAGTATGG - Intergenic
971729680 4:30361337-30361359 TAAAGCTTCCTAGAGGAGCAAGG + Intergenic
972234065 4:37109593-37109615 CAAAATCACCTGGAGGAGAATGG - Intergenic
973034664 4:45390954-45390976 TAAAGCTACCTAGAGGAGCATGG + Intergenic
974543847 4:63275156-63275178 TAAAGTCACCTATAGGAGCTTGG - Intergenic
974650551 4:64748750-64748772 TAAAGTCTCCTATGGGAGCGAGG + Intergenic
974785233 4:66610455-66610477 TAAAATCTAGTAAAGGAGAACGG - Intergenic
975897206 4:79107013-79107035 TAGATTCTCCTAGGAGAGCAAGG + Intergenic
975909174 4:79247991-79248013 TAAAGTCTCCTAGGGGAGCAAGG - Intronic
976771622 4:88659251-88659273 TATACTCTCTTGGAGGAGCAAGG + Intronic
980532262 4:134070932-134070954 TAAAGTCTCCTAGAGGAGCATGG + Intergenic
980576439 4:134688259-134688281 TACAGTCTCCTAGAGGAGCGTGG + Intergenic
980756179 4:137165206-137165228 TATAATCTCCTAAAGCAGAAAGG - Intergenic
981474470 4:145174984-145175006 AAAAATGTCCTAAAGGAGAAAGG - Intronic
982878846 4:160685690-160685712 TAAAATCTCCTAGGGAATTATGG - Intergenic
983413277 4:167424608-167424630 TAAAGTCTTCCAGAGGACCATGG - Intergenic
986467525 5:8041148-8041170 TAAAGTCTCCTAAGGGAGCAAGG + Intergenic
987444678 5:18003078-18003100 GAAAATTTTCTGGAGGAGCAAGG - Intergenic
988323893 5:29737519-29737541 TAAAGTCTCTTAGGAGAGCATGG - Intergenic
989216223 5:38907469-38907491 CAAAGTCTCCTAGAGGAGCAAGG - Intronic
989733852 5:44679316-44679338 TAATGTCTCCTAGAGGAGCATGG - Intergenic
989779552 5:45247561-45247583 CAAAGCCACCTAGAGGAGCATGG + Intergenic
990168202 5:53018197-53018219 TAAAGTCTCCTATAGGAGCACGG + Intronic
993289816 5:86052735-86052757 TAAAATCTCCTGAAGAAGTAAGG - Intergenic
994212566 5:97102548-97102570 TAAATTCTCCTAAAGGAGTCTGG - Intronic
994318406 5:98360852-98360874 CAAAACCACCTGGAGGAGCATGG + Intergenic
994613670 5:102077655-102077677 TAAAATCTCCTAGGGAAGCAAGG - Intergenic
995577761 5:113559133-113559155 AGAAATCTCTTAGAGGAGCCTGG + Intronic
997187890 5:131900597-131900619 TAAAATCTCCTAGAGGAGGAAGG - Intronic
999352404 5:150886653-150886675 TAAAATATCCTAGAAGAGATGGG - Intronic
1003376537 6:5583471-5583493 TAAAATCTTCCAGAGAAACATGG + Intronic
1004585047 6:16991130-16991152 TAAAATCTCAGAGACCAGCAGGG + Intergenic
1004806834 6:19211600-19211622 CAAAGTCTCCTGGAGGAACATGG + Intergenic
1004837912 6:19548864-19548886 TTAAACCTCCAAAAGGAGCATGG - Intergenic
1004862993 6:19824697-19824719 TAAAAACCCCAAGATGAGCAGGG - Intergenic
1005771931 6:29082449-29082471 TGAGACCACCTAGAGGAGCATGG + Intergenic
1007225291 6:40309418-40309440 TTACATCTCCCAGACGAGCATGG - Intergenic
1007353661 6:41294330-41294352 TAAAATCTCCTAGGAGATCATGG - Intergenic
1007687542 6:43675841-43675863 AAAAATCTCATAGAGAAGCTGGG - Intronic
1008020791 6:46575296-46575318 TAAAGTCACCTAAAGGAGTATGG - Intronic
1009621695 6:66085522-66085544 TAAGGTCTCCTAGAGGAGCAAGG + Intergenic
1009674113 6:66794819-66794841 TAAAATCTCCCAAAGGGACAAGG - Intergenic
1010967906 6:82233837-82233859 TAAGATTGCCTAGAGGAGCTAGG + Intronic
1012832691 6:104225575-104225597 TTAAATACCTTAGAGGAGCAAGG + Intergenic
1012839121 6:104307130-104307152 TAAAAACTCCTGCAAGAGCAAGG + Intergenic
1014758105 6:125324321-125324343 TAAATGCTCCTAAAGTAGCATGG - Intergenic
1014893369 6:126870003-126870025 TAAAAACACTGAGAGGAGCAAGG - Intergenic
1015822410 6:137278756-137278778 AAAAATATTCTAGAGGGGCAAGG - Intergenic
1016075399 6:139789182-139789204 TAAAGTCTCCTAGAAGAGCATGG + Intergenic
1016237506 6:141886577-141886599 TAAAGTCTCCCAGGGGAGCATGG - Intergenic
1016663795 6:146611341-146611363 CAAAACCACCTAGAGGAGCATGG + Intronic
1019114042 6:169742412-169742434 TAAAATCTCCTTGAGAATCATGG + Intronic
1022733794 7:33057127-33057149 TAACTGCTCCTTGAGGAGCAGGG + Intronic
1026629474 7:72025927-72025949 TAAAATTTCCTAAAGGATTAGGG + Intronic
1027053208 7:75032518-75032540 GAAAATCTCAGAGAGGAGAAGGG - Intronic
1027567589 7:79816312-79816334 TAAAATGTCATAGAGAAACATGG + Intergenic
1028177512 7:87674880-87674902 TAAAGGCTCCCACAGGAGCATGG + Intronic
1028282042 7:88942801-88942823 TAAAATCACTTAAAGGAGAATGG - Intronic
1029617359 7:101667470-101667492 TAGAAGCTCCAAGAGGATCAGGG - Intergenic
1030401701 7:109059452-109059474 TAAAGTCTCCTAGGGGAGCAAGG + Intergenic
1031547555 7:123068670-123068692 AAGTCTCTCCTAGAGGAGCATGG + Intergenic
1032999921 7:137492721-137492743 TAAAGTTTCCTAGGGGAGCATGG - Intronic
1035488563 7:159252170-159252192 TAAGTTCTGGTAGAGGAGCAGGG - Intergenic
1037237249 8:16735307-16735329 GAAAATTTCCATGAGGAGCAAGG + Intergenic
1040962706 8:53051852-53051874 TAAAGTCTCTTAGGAGAGCATGG + Intergenic
1043131942 8:76472973-76472995 AAAAATCTCCTAGGGGAGCATGG + Intergenic
1043641254 8:82452671-82452693 CAAAGTCTCCTAGAGGAGCATGG + Intergenic
1043754528 8:83986147-83986169 TAACTGCTCCTTGAGGAGCAGGG - Intergenic
1043965214 8:86466596-86466618 TAACATCTCCAAGAGGAAAATGG - Intronic
1043967509 8:86495491-86495513 TAAGACCACCTAGAGGAGTATGG - Intronic
1044224141 8:89700852-89700874 CAAAGTCACCTAGAGGAGCATGG + Intergenic
1046597073 8:116273247-116273269 TTAAATCTCCTAGAGGAGCATGG + Intergenic
1047077118 8:121416285-121416307 TAACTTCTCCTAAAGCAGCAAGG + Intergenic
1051096999 9:13477555-13477577 TAAAGTCTCCTAGAGCAGCATGG + Intergenic
1051754103 9:20376617-20376639 TAAAATGGCCTCGGGGAGCAGGG + Intronic
1054770704 9:69080657-69080679 TAAAAAATCCTAGAAGAGCCAGG + Intronic
1057244253 9:93440825-93440847 TAAAAACTCCAAGAAGAGCTCGG + Intergenic
1059262034 9:112986609-112986631 TAAAATCTCATTGAGGACAAGGG + Intergenic
1059510352 9:114839493-114839515 TAAAGCCACCTAGAGGAGTATGG - Intergenic
1060742326 9:126107437-126107459 TAGAACCTCCTGGAGGGGCATGG + Intergenic
1061113373 9:128591567-128591589 GAGAATCTCCTGGAGGAGCAAGG + Exonic
1061782545 9:133004443-133004465 ATAAACCTCCTAGAGCAGCATGG + Intergenic
1186202753 X:7170802-7170824 TAAAATGTCCTAGAGTCGCTGGG + Intergenic
1187269255 X:17765046-17765068 AAAACTCCCCTGGAGGAGCAGGG + Intergenic
1187607863 X:20905907-20905929 TGAAGTCTCCTAGAGGAGCATGG + Intergenic
1187801383 X:23067515-23067537 TAAAGTCACCTAGAGGAGTATGG - Intergenic
1188147388 X:26630455-26630477 TAAAGTCACCTATAGGAGTATGG + Intergenic
1188322421 X:28756172-28756194 GAAAGTCTCCTGGAGAAGCAAGG - Intronic
1188757089 X:33975344-33975366 CAAAGCCACCTAGAGGAGCAAGG + Intergenic
1189678257 X:43486624-43486646 TTACATCTTTTAGAGGAGCACGG - Intergenic
1189891841 X:45610839-45610861 CAAATTCTCCTAAAGGAGCATGG + Intergenic
1190515079 X:51215527-51215549 TAAAATCCCCTAGTGGATCCTGG - Intergenic
1190973751 X:55379298-55379320 CAAAGCCCCCTAGAGGAGCATGG - Intergenic
1191816701 X:65253532-65253554 TAAAGTGTCCTAGGGGAGCATGG - Intergenic
1192883299 X:75310898-75310920 TAAAAAGACCTAGAGAAGCAAGG - Intergenic
1192983344 X:76370290-76370312 TAAAGTCTCCTAAAAAAGCAAGG + Intergenic
1193036657 X:76958293-76958315 TAAAGTCTCCTAGGGGAGCATGG + Intergenic
1193276191 X:79590567-79590589 TAAAGTTTCTTAGGGGAGCAAGG + Intergenic
1193514998 X:82452095-82452117 TAGAGTCTCCCAGGGGAGCAAGG - Intergenic
1193575795 X:83194062-83194084 TAAAGCCACCTAGAGAAGCATGG + Intergenic
1193578373 X:83231685-83231707 CAAAGTCTCTTAGGGGAGCATGG + Intergenic
1193799146 X:85914252-85914274 TAAAACCACCTAGAGGAGCATGG - Intronic
1194519622 X:94902206-94902228 TAAAGTTTCCTACGGGAGCAAGG + Intergenic
1194572447 X:95569603-95569625 TAAAATTTGCTAGCGGAACAGGG + Intergenic
1195144463 X:101999623-101999645 TAAAGTCTCCTAGAGGGGCATGG - Intergenic
1195567243 X:106356127-106356149 CAAAATCTCAAACAGGAGCATGG - Intergenic
1196686531 X:118514989-118515011 TAAAATCTCCTGAAGGAGTGAGG - Intronic
1196898756 X:120362706-120362728 TAGAATCCCCAATAGGAGCAGGG + Intronic
1197283921 X:124572398-124572420 TAGAATCTCCTAGAAAAACATGG + Intronic
1197551474 X:127897837-127897859 TAAAGTCTTCTAGGGGAGCATGG - Intergenic
1197582319 X:128298964-128298986 TAAATTCTCCTAAAGATGCATGG - Intergenic
1199640691 X:149858356-149858378 TAAAGTCTTCTAGAGGAAAATGG - Intergenic
1201931751 Y:19357730-19357752 TAAAACTACCTAGAGGAGCATGG - Intergenic