ID: 1129573851

View in Genome Browser
Species Human (GRCh38)
Location 15:76719473-76719495
Sequence ATGTACAACAGGAGGGCTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 1, 2: 14, 3: 53, 4: 133}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129573851 Original CRISPR ATGTACAACAGGAGGGCTAT AGG Intronic
901277446 1:8003234-8003256 ATGTGTAGCAGGAGGGCTATGGG + Intergenic
902670476 1:17969821-17969843 ATATACAACAGCAGAGCTTTGGG + Intergenic
902910064 1:19589332-19589354 ATGTAAGTCAGGAGGGCGATAGG - Intergenic
904922076 1:34015620-34015642 TGGTACAACAGGAGGGCCACAGG + Intronic
906488852 1:46252021-46252043 GTGCACAACAGGAGACCTATGGG + Intronic
908966780 1:69774458-69774480 ATGTACAGCATGAGGACTATAGG + Intronic
909903621 1:81169585-81169607 ATGTACAATATGAGGACTATAGG - Intergenic
910896758 1:92078004-92078026 ATGTACAGCATGAGAACTATAGG - Intergenic
911047924 1:93643711-93643733 ATGGACAACATGAGGACTATAGG + Intronic
911122352 1:94309055-94309077 GTGTACAACAGGGGAGCCATTGG + Intergenic
912320982 1:108712922-108712944 ATGTCCAACAGGATGGCTGGTGG + Exonic
913461802 1:119094749-119094771 AAATACAACATGAGGACTATAGG - Intronic
916820208 1:168390870-168390892 CTATACAACATGAGGACTATAGG + Intergenic
916906174 1:169286683-169286705 TTGTACAACAGGAGTGCTATTGG + Intronic
920449439 1:206048087-206048109 ATGTACAAAGAAAGGGCTATTGG - Intronic
922823076 1:228497624-228497646 ATGTACAACAGGAGGAATGTAGG + Intergenic
1063371271 10:5524531-5524553 ATATAGAACAGGAGGGTTTTTGG - Exonic
1064798869 10:19045982-19046004 ATGTACAGCATGAGTACTATAGG - Intergenic
1065639167 10:27764126-27764148 ATGTACAAGATGAGGATTATAGG + Intergenic
1066698841 10:38104888-38104910 ATGGAAAACAGAAAGGCTATGGG - Intronic
1066993811 10:42543341-42543363 ATGGAAAACAGAAAGGCTATGGG + Intergenic
1067703568 10:48590531-48590553 ATGAGCACAAGGAGGGCTATGGG - Intronic
1068163540 10:53299094-53299116 ATGTACAGCATGAGGACTATAGG - Intergenic
1070336032 10:75455871-75455893 CTGTACAACATCAGGGCTTTGGG + Intronic
1070845794 10:79521946-79521968 CTGTACAACTGGAGTGCTAATGG + Intergenic
1070927999 10:80238372-80238394 CTGTACAACTGGAGTGCTAATGG - Intergenic
1071362237 10:84860298-84860320 ATGTACTGCATGAGGACTATGGG - Intergenic
1075964695 10:126601270-126601292 ATGTACAACATGAGGACTCTAGG + Intronic
1077509003 11:2945886-2945908 ATGTTCAGCAGGAGGGTTTTGGG + Intronic
1082710477 11:56548480-56548502 ATGAACAACATGAGGACTAGGGG - Intergenic
1082926856 11:58557627-58557649 ATGTACAACATAAGAACTATCGG + Intronic
1083131400 11:60626498-60626520 ATGTACAGCATGAGGACTATAGG + Intergenic
1084267337 11:68011810-68011832 ATGTACCAGAGGAGGGCTCAGGG - Intronic
1086276809 11:85139695-85139717 ATGTACACCATGAGGACTGTAGG - Intronic
1087648317 11:100833812-100833834 ATATTCAACAGGAGGGAAATTGG + Intronic
1087867637 11:103251600-103251622 ATGTACAACATGAGGACTGTAGG - Intronic
1088275070 11:108076350-108076372 ATGTACAGCATGAGAACTATAGG - Intronic
1089257993 11:117204104-117204126 AAGTGCAACAGGAAGGCAATGGG + Intronic
1090121369 11:124031789-124031811 AAGTAAGACAGGAGGGCTATAGG + Intergenic
1091005566 11:131950174-131950196 ATGAAAAACAGGAGGCCTCTAGG - Intronic
1092321445 12:7480606-7480628 ATGTACAACATGAGGATTATAGG + Intronic
1095047052 12:37518491-37518513 ATATACAACATGAGGACTATAGG + Intergenic
1098795545 12:74884011-74884033 ATGTACAACATGAGGACTATTGG + Intergenic
1099793855 12:87371122-87371144 ATGTACAACATGAGGATTAAAGG - Intergenic
1100048824 12:90418675-90418697 ATGTACGACATGAGGACTATAGG + Intergenic
1100727670 12:97426021-97426043 AAGGACCACAGCAGGGCTATTGG + Intergenic
1101133304 12:101711606-101711628 ATGTACAACCTGAGGGGTATAGG + Intronic
1101784410 12:107870429-107870451 ATGCACAACAGGAGTACTACAGG + Intergenic
1102202732 12:111068766-111068788 CTGTCCAACAGGAGGGCCATGGG - Intronic
1102857999 12:116311632-116311654 AGGTAGAACAGGAGGGCCAAGGG + Intergenic
1103025292 12:117568965-117568987 TTGTACAACAGGCAGGATATTGG - Intronic
1106778399 13:33030653-33030675 AGGTACAACAGAAGGGCAAGGGG + Intronic
1106966369 13:35074876-35074898 ATGTACAACATGAGGACTGTAGG - Intronic
1110260711 13:73482078-73482100 ATTTCCAACAAGAAGGCTATTGG - Intergenic
1110369570 13:74725043-74725065 AGGTAGAACAGGAGGGCAACAGG + Intergenic
1112601568 13:100860637-100860659 ATGTACAACACGAGTACTGTAGG - Intergenic
1112924057 13:104651288-104651310 GTATCCACCAGGAGGGCTATGGG - Intergenic
1116167555 14:41352450-41352472 TTGTCCAACATGAGGCCTATGGG + Intergenic
1119564981 14:75621024-75621046 ATGTGCAGCAGAAGGGCTTTTGG + Intronic
1119569891 14:75661041-75661063 AGGTCCAACAGGAGGGCTTACGG - Exonic
1121581783 14:95037311-95037333 CTGGGCAAAAGGAGGGCTATTGG + Intergenic
1121726806 14:96158319-96158341 CTGTCCAGCAGGAGGGCCATAGG + Intergenic
1121903704 14:97720015-97720037 ATGTACAACATAAGGACTACAGG - Intergenic
1124168126 15:27347486-27347508 AAGTGGAACAGGAGGGCTAGAGG + Intronic
1125647758 15:41286891-41286913 ATGTACAACATGACAACTATAGG - Intergenic
1129573851 15:76719473-76719495 ATGTACAACAGGAGGGCTATAGG + Intronic
1130824901 15:87533744-87533766 ATTTACAAAAGGAGGTTTATTGG + Intergenic
1133847634 16:9470487-9470509 ATGTACAACATGAAGACTATAGG - Intergenic
1138806290 16:60093718-60093740 TTGCACAACAGGATGGCTACAGG - Intergenic
1139494310 16:67305013-67305035 ATGTAAAAATGTAGGGCTATAGG + Intronic
1146118772 17:30170382-30170404 ATGTACCACATGAGGACAATAGG - Intronic
1153571810 18:6480954-6480976 ATGTGTAACATGAGGACTATAGG + Intergenic
1155591412 18:27431645-27431667 ATGTACAACATGAGAAATATAGG + Intergenic
1155837330 18:30602429-30602451 ATGTACAACATGAAGACTAGAGG - Intergenic
1158007424 18:52688559-52688581 ATGCACAACATGAGGACTATAGG + Intronic
1159306220 18:66646505-66646527 GTGTACAACATGAGGACTATAGG - Intergenic
927373799 2:22389321-22389343 ATACATATCAGGAGGGCTATGGG + Intergenic
928614215 2:33020281-33020303 CTATACAACATGAGGTCTATAGG + Intronic
930120150 2:47754007-47754029 AGGAACCACAGCAGGGCTATTGG + Intronic
932687393 2:73883622-73883644 ATGTACACCCTGAGGACTATAGG + Intergenic
932824736 2:74928910-74928932 ATGTTCAAGAGGAGGGGAATTGG + Intergenic
933378903 2:81517708-81517730 AGGTACAACATGAGGGCTATAGG + Intergenic
935017439 2:99197329-99197351 ATCTACGACAGGATGGATATTGG - Exonic
935037302 2:99390971-99390993 TTGAACAACATGAGGGCTAGGGG + Intronic
935440046 2:103082412-103082434 ATGTGCAACAGGATGGCTGGAGG - Intergenic
936828309 2:116608528-116608550 ATGGAGGAGAGGAGGGCTATAGG + Intergenic
938180187 2:129175552-129175574 ATGTACAACAGGGTGGCTTTAGG + Intergenic
939503302 2:143012766-143012788 ATGTACAGCATGAGGACTATGGG - Intronic
941160810 2:162032047-162032069 AAGTACATCAGGAAGGCTGTGGG - Intronic
941435565 2:165466882-165466904 ATGTACAACATGAGGACTACAGG - Intergenic
941964534 2:171287839-171287861 ATGTACAACAGCACAGCTTTGGG + Intergenic
943512794 2:188846962-188846984 ATGTACAACATGAGGACTACAGG + Intergenic
943687149 2:190830451-190830473 ATGTATAGCATGAGGACTATAGG - Intergenic
944359545 2:198836889-198836911 ATGTACACCATGAAGACTATAGG + Intergenic
945159929 2:206879184-206879206 ATGTACAACGTGAGGACTATAGG - Intergenic
947478200 2:230471227-230471249 ATGTATAGCAGCAGGGCAATGGG + Intronic
1170724225 20:18911810-18911832 ATGTATAACACGAGGACTACAGG - Intergenic
1171541621 20:25962137-25962159 ATATACAACATGAGGACTATAGG + Intergenic
1171799444 20:29598212-29598234 ATATACAACATGAGGACTATAGG - Intergenic
1171844606 20:30258276-30258298 ATATACAACATGAGGACTATAGG + Intergenic
1175447607 20:59034603-59034625 GTGTACAGCAGCAGGGCAATGGG + Exonic
1176636598 21:9249572-9249594 ATGTACAACATGAGGACTGTAGG - Intergenic
1180068325 21:45423901-45423923 ATGCCCAACAGGAGGGCCCTGGG - Intronic
1184421318 22:44384431-44384453 ATGGACAACAGCTGGGCTAGAGG + Intergenic
957104165 3:75865692-75865714 ATGCACAACATGAGGACTGTAGG + Intergenic
957566857 3:81895140-81895162 CTGTACACCAGCAGGGCTACTGG + Intergenic
959089859 3:101890212-101890234 TTGTACAACAGGTGGATTATTGG + Intergenic
959676994 3:109047168-109047190 ATGTACAATATGAGGACTGTAGG - Intronic
960359065 3:116688763-116688785 ATGTAAAAAAGGATGGCTTTGGG + Intronic
965968133 3:174521632-174521654 ATATAGAACTGGAGGCCTATAGG + Intronic
966319394 3:178684420-178684442 ATGTAAAACATGAGCACTATAGG + Intronic
966557948 3:181284833-181284855 ATGTACAAAAGGTGGGCAATAGG + Intergenic
968906226 4:3452564-3452586 ATGTACAGTAGGAGGGCGATGGG + Intergenic
970307994 4:14752772-14752794 GTATACAGCAGGAGGGCTCTGGG + Intergenic
971103102 4:23491193-23491215 ATGTACAACATGAGGGCTACAGG + Intergenic
971619961 4:28843784-28843806 ATGTACAACACGAGGACTGAAGG - Intergenic
973024042 4:45244298-45244320 ATGTACAACATGAGATCTCTAGG - Intergenic
974220601 4:58965005-58965027 ATGTACAACAGGAGGACTATAGG + Intergenic
974264543 4:59567522-59567544 ATGTACAACATGAGGACTACAGG + Intergenic
974909665 4:68101901-68101923 ATGTACAACATGAGGACTATAGG - Intronic
975276162 4:72504443-72504465 ATGTACAAAAGGAACTCTATTGG - Intronic
975448300 4:74493912-74493934 ATGAACAACATGAGGACTATAGG - Intergenic
976499422 4:85770389-85770411 GTGAACAATAGGAGGACTATTGG - Intronic
976554351 4:86433053-86433075 ATCTACAAGAGGAGGGTTAGTGG - Intronic
977675318 4:99740793-99740815 ATGTAGAAGTGGAGAGCTATGGG + Intergenic
979430910 4:120629248-120629270 ATGTAAAACATGAGGACTATAGG + Intergenic
981085702 4:140681207-140681229 ATGTAGAATGGGAGGGCCATAGG - Intronic
981558133 4:146017360-146017382 AGTTACAACAGGAGAGCTGTTGG + Intergenic
983103012 4:163649396-163649418 TTGTACAAAAGAAAGGCTATTGG + Intronic
984216710 4:176922278-176922300 AGGTACAACATGAGGACTATAGG - Intergenic
984510420 4:180672087-180672109 ATGTACATCAGGGAGGCCATGGG - Intergenic
984745366 4:183210368-183210390 ATGTACAACATGAGGACTATAGG + Intronic
1202751486 4_GL000008v2_random:8011-8033 ATGTACAACATGAGGACTGTAGG - Intergenic
990229715 5:53699565-53699587 ATGTACAACATGAGAACTACAGG + Intergenic
993210325 5:84941349-84941371 ATGTACAACATGAGGAATATAGG - Intergenic
994381115 5:99072754-99072776 AGGTACAACATGAGGACTATAGG - Intergenic
996321844 5:122226405-122226427 ATGTACAGCAAGAGGACTATAGG + Intergenic
997065272 5:130552425-130552447 ATGTACAACATGAAGACTATAGG + Intergenic
1001127449 5:169033015-169033037 ATGTACAACCGGAAGACTATGGG - Intronic
1003778391 6:9395167-9395189 ATTTACTACAGAAAGGCTATAGG + Intergenic
1004595741 6:17097843-17097865 CTGTTCAACAGGAGGGCTATAGG - Intergenic
1005159554 6:22843279-22843301 ATGTACAAAAGGATTGCTAATGG + Intergenic
1005733302 6:28720205-28720227 TTGTACAACATGATGACTATAGG - Intergenic
1010006842 6:71004693-71004715 ATATACCACATGAGGACTATAGG - Intergenic
1010165354 6:72908283-72908305 ATGTACAACATGAGAACTAAAGG + Intronic
1012502063 6:99899189-99899211 ATGTACAACATGAGGACTATAGG - Intergenic
1012562657 6:100603376-100603398 AAGCACAACAGGAGGGCTTCTGG - Intronic
1013185270 6:107752167-107752189 ATTGACACCAGGAGGGCTCTAGG + Intronic
1013574997 6:111474010-111474032 CTGGACAACAGGAGGGCATTTGG + Intronic
1014289301 6:119539835-119539857 ATGGACAACAGGAGGACCAGTGG + Intergenic
1016984045 6:149881124-149881146 ATGATCATCAGGAGGGCCATCGG + Intergenic
1020588490 7:10103847-10103869 ACGTACAATATGAGGTCTATAGG + Intergenic
1020672325 7:11132165-11132187 ATATACAATATGAGGGCTACAGG - Intronic
1021893263 7:25208650-25208672 ATGTACAACATGAGGACTGTAGG - Intergenic
1024161099 7:46677285-46677307 ATGTACAACATGGTGGCTATAGG + Intronic
1025293056 7:57748339-57748361 ATATACAACATGAGGACTATAGG + Intergenic
1026364377 7:69633033-69633055 ATGTACAACATGAGGACTAAAGG - Intronic
1027925238 7:84452350-84452372 ATGAACAACAGCAAGGCCATGGG + Intronic
1030417282 7:109261632-109261654 ATATTCAACAGGAGGGTAATTGG - Intergenic
1030821685 7:114099850-114099872 ATATACAACATGAGGGTTTTGGG + Intronic
1031724930 7:125226676-125226698 ATGTATAGCATGAGGGCCATAGG - Intergenic
1031876701 7:127149957-127149979 ATGTACAACATGAAGGTCATAGG + Intronic
1031891348 7:127296575-127296597 GTGTACAGCAGCAGGGCAATGGG - Intergenic
1032695468 7:134332222-134332244 ATGTACAACATGAGGACTATAGG - Intergenic
1038075465 8:24067762-24067784 ATGTACAACAGGATGTCAAATGG - Intergenic
1038422297 8:27441019-27441041 ATCTCCCACAGGAGGGCTAATGG - Intronic
1039140293 8:34379830-34379852 ATGTACAACATGGGCACTATAGG + Intergenic
1039784565 8:40822061-40822083 ATGTACAACAGGACGCCAAGTGG + Intronic
1040421844 8:47247742-47247764 ATGTACAACATGAGGACTACAGG - Intergenic
1042165238 8:65938864-65938886 ATGTAAACCTGGAGGGCTGTGGG - Intergenic
1044049073 8:87476967-87476989 ATGTATAACAGGAGGACTATAGG + Intronic
1044068160 8:87723409-87723431 TTGTGAAACAGGAGGGCAATCGG + Intergenic
1044145056 8:88702718-88702740 ATGTACTACTTGAGGACTATAGG - Intergenic
1045792726 8:106003883-106003905 ATGTACAACATGAGAACTACAGG + Intergenic
1046495215 8:115005348-115005370 ATATACCACATGAGGACTATAGG - Intergenic
1048434811 8:134406331-134406353 ATGTACAACAGGAGGACTGTAGG - Intergenic
1049757350 8:144316603-144316625 ACGTACATGAGGACGGCTATTGG + Exonic
1050762963 9:9096151-9096173 ATGTGCAACATGAGGACTATAGG + Intronic
1051436606 9:17040323-17040345 ATGAACAACATGAGGACTACAGG - Intergenic
1054163477 9:61697560-61697582 ATATACAACATGAGGACTATAGG - Intergenic
1055870153 9:80867438-80867460 ATATACAACAGGAGGACTATAGG - Intergenic
1056429818 9:86516258-86516280 ATGTACAACATGGGGACTATAGG - Intergenic
1056685685 9:88757419-88757441 ATGTACAGCTGGATGGCTATCGG + Intergenic
1056724034 9:89096575-89096597 ATGTACAAAAAGAGGGCTTGGGG - Intronic
1058733360 9:107871605-107871627 ATGTACAACATGAGGACTATAGG - Intergenic
1059141809 9:111860230-111860252 ATGTACAACATAAGGATTATAGG - Intergenic
1059586847 9:115616446-115616468 ATGTACAAGAATAGTGCTATTGG + Intergenic
1059637968 9:116189198-116189220 ATGTATAGCATGAGGACTATAGG + Intronic
1059899137 9:118903255-118903277 ATATACAACATGAGGACTCTAGG + Intergenic
1060151387 9:121290785-121290807 ATGTGCAACATGAGGACTATAGG - Intronic
1203718937 Un_KI270742v1:185540-185562 ATGTACAACATGAGGACTGTAGG + Intergenic
1203653171 Un_KI270751v1:149215-149237 ATGTACAACATGAGGACTGTAGG + Intergenic
1186273978 X:7920121-7920143 ATGTAAATCAGGAGGGATGTGGG + Intronic
1187377158 X:18765379-18765401 GTGTACAACACGAGGACTATAGG + Intronic
1187621125 X:21056410-21056432 GTGTACAACATGAGAACTATAGG - Intergenic
1187874009 X:23788578-23788600 ATTTAATACAGGAGGGCTTTGGG + Intergenic
1187961088 X:24567135-24567157 ATTAACAGCAGGAGGGCTAATGG - Intronic
1189050925 X:37644696-37644718 ATGAAGAAGAGGAGGGCTACAGG - Intronic
1190124548 X:47692141-47692163 ATGTACAACATGAGGACTATAGG + Intergenic
1196361148 X:114861105-114861127 ATGTACAACATGTGGACGATAGG - Intronic
1198207477 X:134481175-134481197 ATGTACAACATGAAGTATATAGG - Intronic
1201694919 Y:16814251-16814273 TTGTACAACAGCATTGCTATGGG - Intergenic