ID: 1129589773

View in Genome Browser
Species Human (GRCh38)
Location 15:76905076-76905098
Sequence GGCTCGGAGGTCGGCCTCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 104}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129589773_1129589779 -5 Left 1129589773 15:76905076-76905098 CCTCCGAGGCCGACCTCCGAGCC 0: 1
1: 0
2: 0
3: 8
4: 104
Right 1129589779 15:76905094-76905116 GAGCCCTCCCCAGGCGACCGCGG 0: 1
1: 0
2: 1
3: 7
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129589773 Original CRISPR GGCTCGGAGGTCGGCCTCGG AGG (reversed) Intronic