ID: 1129592944

View in Genome Browser
Species Human (GRCh38)
Location 15:76933207-76933229
Sequence GACCCACTTGGAACGCTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 54}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129592944_1129592946 -7 Left 1129592944 15:76933207-76933229 CCTGTCAGCGTTCCAAGTGGGTC 0: 1
1: 0
2: 0
3: 1
4: 54
Right 1129592946 15:76933223-76933245 GTGGGTCCTCAGAAAAATTCAGG 0: 1
1: 0
2: 0
3: 6
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129592944 Original CRISPR GACCCACTTGGAACGCTGAC AGG (reversed) Intronic
900700449 1:4045462-4045484 GCCCCTCTTGGAAAGCTGCCTGG + Intergenic
903546141 1:24124463-24124485 GCCCCACTTGGACTGGTGACAGG - Intronic
908520389 1:64935742-64935764 GAACTGCTTGCAACGCTGACGGG + Intronic
1069350604 10:67521759-67521781 GACCCACCTGCACCTCTGACAGG + Intronic
1074898369 10:117796094-117796116 GACCCACTTGGAGGGAAGACAGG - Intergenic
1077259441 11:1608056-1608078 GACCCCCTTGGAACCCCCACAGG + Exonic
1079123611 11:17702740-17702762 GTCCCACTTGGGAGGCTGAGAGG - Intergenic
1082952499 11:58832320-58832342 GAAACACTTGGAATGCTGCCTGG + Intergenic
1083750373 11:64757788-64757810 CACCCACTTGGCACCCTGGCTGG + Exonic
1085687667 11:78638892-78638914 CACCCACCTGGAACTCTCACTGG - Intergenic
1086359187 11:86039277-86039299 CAGCTACTTGGAAGGCTGACAGG + Intronic
1090327912 11:125904666-125904688 GCCCCACTTCGAACGCTCGCGGG - Intronic
1091407158 12:216223-216245 GACCCACTTGGTATTCAGACTGG + Intergenic
1091407217 12:216603-216625 GACCCACTTGGTATTCAGACTGG + Intergenic
1092100896 12:5883006-5883028 GGCTCACTTGGAACCCTGGCAGG - Intronic
1094126771 12:27031917-27031939 GCCCCACTTGGAAAGCTGTGTGG + Intronic
1114611000 14:24040449-24040471 TAGCCACTTGGGAGGCTGACGGG - Intergenic
1123921726 15:25074800-25074822 GACCCACATGGAATGATGCCAGG - Intergenic
1129592944 15:76933207-76933229 GACCCACTTGGAACGCTGACAGG - Intronic
1134104194 16:11473965-11473987 TAGCTACTTGGAAGGCTGACAGG - Intronic
1134336915 16:13308782-13308804 GACCCAGTTGGAACCCTAAGAGG - Intergenic
1138923090 16:61556349-61556371 GACCCACGTGGAAAACAGACTGG - Intergenic
1147656823 17:42095845-42095867 GGCCCACCTGGAACACTCACAGG + Intergenic
1157474828 18:48016667-48016689 TACCCACTTGGCAGGTTGACAGG + Intergenic
1159388205 18:67754701-67754723 GACCCCCTGGGAAAGCTGAGTGG + Intergenic
1159682133 18:71367983-71368005 GAGTCCCTTGGAATGCTGACTGG + Intergenic
1163331343 19:16640188-16640210 CAGCTACTTGGAAGGCTGACAGG - Intronic
927964015 2:27258090-27258112 GACCTGCTTGGGACCCTGACGGG + Intronic
928652192 2:33414851-33414873 GACCCACTTGCAATGGTGGCAGG - Intergenic
936490715 2:112969808-112969830 GACCCCCATGGAGCACTGACAGG + Intergenic
939364670 2:141216473-141216495 GCCCCACTGGGAACTCTGAGTGG - Intronic
940695989 2:156979263-156979285 GTCTGACTTGGGACGCTGACAGG - Intergenic
945716217 2:213360509-213360531 GACACACCTGGAGAGCTGACAGG - Intronic
1170275634 20:14583744-14583766 GACTCACTTTAAACACTGACAGG + Intronic
1174236296 20:49095438-49095460 TAGCTACTTGGAAGGCTGACAGG - Intronic
1174775451 20:53339417-53339439 GAGCCACTTTGAACCCTGAAAGG + Intronic
1179047682 21:37861069-37861091 AAACCACTTAGAAGGCTGACAGG + Intronic
1179431991 21:41327915-41327937 GACCCACTGTGCATGCTGACAGG - Intronic
1182923347 22:34100256-34100278 CACCCACATGGAACTCTGCCAGG - Intergenic
1183080507 22:35452862-35452884 GACCCACATGCAAGGCGGACGGG - Intergenic
1183696035 22:39422883-39422905 GACCTCCTTGGATTGCTGACTGG + Intronic
955066138 3:55535155-55535177 GCCCCACTTGGAAAGCTGGTTGG - Intronic
956492237 3:69785455-69785477 GCCCCACTTGGATTGCTTACTGG - Intronic
961334127 3:126160017-126160039 GACCCTCTAGGAACACTGACTGG - Intronic
963302904 3:143618614-143618636 GACCAACCTGGCACGATGACAGG + Intronic
980462702 4:133136693-133136715 CACCCACTTGGGAGGCTGAGGGG + Intergenic
982910400 4:161134530-161134552 GAGCCATATGGAAAGCTGACAGG + Intergenic
1004466293 6:15888418-15888440 GACACATTTGGAATGATGACAGG + Intergenic
1019281704 7:203601-203623 GACCCACTTGGTAGACTGAGTGG + Intronic
1023035761 7:36130231-36130253 GAGCCACTGGGACCCCTGACAGG + Intergenic
1030114873 7:106055468-106055490 GACCCACCTGGAAAACTGATGGG - Intergenic
1035637423 8:1156909-1156931 GACCGACTGGGAACCCTGAGTGG - Intergenic
1039253225 8:35689616-35689638 GGCCCAGTTGGAAGGCTGTCAGG + Intronic
1049958300 9:713209-713231 GCTCCACTTGGAATGATGACTGG + Exonic
1057227717 9:93301365-93301387 GACCCACATGGACCTCTGATGGG - Intronic
1186241123 X:7567520-7567542 GCCCCAGTTTGAAAGCTGACAGG - Intergenic