ID: 1129592944 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 15:76933207-76933229 |
Sequence | GACCCACTTGGAACGCTGAC AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 56 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 1, 4: 54} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1129592944_1129592946 | -7 | Left | 1129592944 | 15:76933207-76933229 | CCTGTCAGCGTTCCAAGTGGGTC | 0: 1 1: 0 2: 0 3: 1 4: 54 |
||
Right | 1129592946 | 15:76933223-76933245 | GTGGGTCCTCAGAAAAATTCAGG | 0: 1 1: 0 2: 0 3: 6 4: 163 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1129592944 | Original CRISPR | GACCCACTTGGAACGCTGAC AGG (reversed) | Intronic | ||