ID: 1129592944

View in Genome Browser
Species Human (GRCh38)
Location 15:76933207-76933229
Sequence GACCCACTTGGAACGCTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 54}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129592944_1129592946 -7 Left 1129592944 15:76933207-76933229 CCTGTCAGCGTTCCAAGTGGGTC 0: 1
1: 0
2: 0
3: 1
4: 54
Right 1129592946 15:76933223-76933245 GTGGGTCCTCAGAAAAATTCAGG 0: 1
1: 0
2: 0
3: 6
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129592944 Original CRISPR GACCCACTTGGAACGCTGAC AGG (reversed) Intronic