ID: 1129592946

View in Genome Browser
Species Human (GRCh38)
Location 15:76933223-76933245
Sequence GTGGGTCCTCAGAAAAATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 163}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129592939_1129592946 19 Left 1129592939 15:76933181-76933203 CCCATTGTTCAATTCAAATGATG 0: 1
1: 0
2: 0
3: 21
4: 244
Right 1129592946 15:76933223-76933245 GTGGGTCCTCAGAAAAATTCAGG 0: 1
1: 0
2: 0
3: 6
4: 163
1129592943_1129592946 -6 Left 1129592943 15:76933206-76933228 CCCTGTCAGCGTTCCAAGTGGGT 0: 1
1: 0
2: 0
3: 25
4: 519
Right 1129592946 15:76933223-76933245 GTGGGTCCTCAGAAAAATTCAGG 0: 1
1: 0
2: 0
3: 6
4: 163
1129592938_1129592946 20 Left 1129592938 15:76933180-76933202 CCCCATTGTTCAATTCAAATGAT 0: 1
1: 0
2: 0
3: 17
4: 263
Right 1129592946 15:76933223-76933245 GTGGGTCCTCAGAAAAATTCAGG 0: 1
1: 0
2: 0
3: 6
4: 163
1129592940_1129592946 18 Left 1129592940 15:76933182-76933204 CCATTGTTCAATTCAAATGATGT 0: 1
1: 0
2: 1
3: 28
4: 294
Right 1129592946 15:76933223-76933245 GTGGGTCCTCAGAAAAATTCAGG 0: 1
1: 0
2: 0
3: 6
4: 163
1129592944_1129592946 -7 Left 1129592944 15:76933207-76933229 CCTGTCAGCGTTCCAAGTGGGTC 0: 1
1: 0
2: 0
3: 1
4: 54
Right 1129592946 15:76933223-76933245 GTGGGTCCTCAGAAAAATTCAGG 0: 1
1: 0
2: 0
3: 6
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129592946 Original CRISPR GTGGGTCCTCAGAAAAATTC AGG Intronic
901804478 1:11729507-11729529 GTAGGTGCTCAGTAAACTTCAGG - Intergenic
907697086 1:56742080-56742102 GTGGGTCCTCACTGAAACTCTGG + Intronic
907804413 1:57804038-57804060 ATGGGTTCTAATAAAAATTCCGG + Intronic
910647740 1:89531658-89531680 GTGGGGCCTCAGAGAAAGCCTGG + Intronic
910792048 1:91061572-91061594 GTGGGGCATCAGAAAAGATCTGG + Intergenic
911171374 1:94774031-94774053 GTGGTTTCTCAGAAACATACTGG + Intergenic
916101903 1:161399972-161399994 GTGCTTCCTCAGGAAACTTCCGG + Intergenic
917332832 1:173899854-173899876 ATTTGTCCTCAGAATAATTCTGG + Exonic
919852970 1:201686161-201686183 GTTGGTCCTCAGAGAAATCCAGG + Intronic
921047712 1:211489243-211489265 TTGGGTCCTAGGGAAAATTCAGG + Intronic
923038602 1:230303061-230303083 GTGGGTCCTCAACACAGTTCTGG - Intergenic
1064616352 10:17162346-17162368 GTTGGTCCTCACAAAAAATAGGG + Intronic
1067136970 10:43618168-43618190 GTTGGTGCTCAGACAAATTTTGG - Intergenic
1068639486 10:59387279-59387301 GTGAGTGCTCAGAAAAACTAAGG - Intergenic
1071457558 10:85862549-85862571 GTGGGTCCTCAGAAAGATAATGG + Intronic
1071804287 10:89099851-89099873 ATGGGTCCTTAAATAAATTCTGG + Intergenic
1072118100 10:92382830-92382852 GTGGCTCCACAGAAAGATTAAGG - Intergenic
1072601092 10:96930666-96930688 ATGGGTCCTCTCCAAAATTCAGG + Intronic
1073993328 10:109288579-109288601 TTGGATCCCCAGAAAGATTCAGG - Intergenic
1074836804 10:117303812-117303834 GTGGGTGCACAGAAGAATTGAGG + Intronic
1078454496 11:11464575-11464597 GTGGGTACTCAGAAAAAAGTAGG - Intronic
1082107749 11:48238877-48238899 ATGTGCCCTCATAAAAATTCAGG + Intergenic
1084272772 11:68038110-68038132 GTGGTTCCTCAGAAAATTGGGGG - Intergenic
1086963913 11:93008223-93008245 GTGGGGACACAGAAAAATTATGG - Intergenic
1089223591 11:116896556-116896578 ATGAGTACTGAGAAAAATTCAGG - Intronic
1092204197 12:6605966-6605988 GTGGGTCCTCGGAGGAATGCAGG - Intronic
1093271299 12:17065601-17065623 GTGGGTTCTCAGAACACTTAAGG - Intergenic
1094503402 12:31039717-31039739 GTGGCTCCTCCAGAAAATTCTGG - Intergenic
1096826059 12:54279123-54279145 GTAGGTCCACAGAAAAGTTTTGG - Intronic
1101093977 12:101316974-101316996 GTGGCTGCTCAAAAAAGTTCTGG + Intronic
1106457348 13:29938668-29938690 GTGAGCACTCAGAAAAATGCTGG - Intergenic
1107172971 13:37365303-37365325 GTGGGTCATAAGGAAAACTCTGG - Intergenic
1112226926 13:97548875-97548897 GTGGGTCAAAAGAAACATTCTGG + Intergenic
1112919441 13:104593447-104593469 GTGTGTCTTCAGAAAGACTCTGG - Intergenic
1113264796 13:108605857-108605879 GTGAGGGCTCAGAAAAATACTGG + Intronic
1116267936 14:42720155-42720177 GAGGGTCCTCAGAAAGCTTGTGG + Intergenic
1117229077 14:53696834-53696856 GTAGGTCCTCAAGAAAATGCAGG + Intergenic
1122459275 14:101881996-101882018 GTGGGTCCTCAGAGAGAGCCTGG - Intronic
1124010137 15:25831318-25831340 GTGCTACCTCAGAAAAATGCTGG + Intronic
1124653024 15:31486737-31486759 GTGGGTCCTCAAAAAAAGCCAGG - Intronic
1125306881 15:38327451-38327473 GTAGATCCTAAGAAAATTTCTGG + Intronic
1125901873 15:43355840-43355862 GTGAGGCCTAAGAAATATTCAGG + Intergenic
1128073568 15:64812341-64812363 CTGTGTCCTCAGATAACTTCTGG - Intergenic
1128780216 15:70354267-70354289 GTGGTTCACAAGAAAAATTCAGG + Intergenic
1129592946 15:76933223-76933245 GTGGGTCCTCAGAAAAATTCAGG + Intronic
1137887739 16:52125040-52125062 GTGGGTCCCCAAACAAATGCTGG + Intergenic
1138946024 16:61851008-61851030 GTGGGTACTGAGATAAACTCAGG - Intronic
1141226422 16:82120476-82120498 GTGTGTGCTGAGAAAAGTTCAGG + Intergenic
1146051714 17:29559467-29559489 GTGGGTCTTCAGTAATCTTCAGG - Intergenic
1147043646 17:37736810-37736832 GTAGGTGCTCAGAACCATTCGGG + Intronic
1149473863 17:56942285-56942307 GGGGATCCTGAGAAAAACTCTGG + Intronic
1149886535 17:60345679-60345701 CTGGCTCCTAAGAAAAATTGAGG + Intronic
1152179283 17:78807791-78807813 GTGGCTTCTCTGAACAATTCTGG + Intronic
1154428582 18:14291133-14291155 GTGTGTCCCTATAAAAATTCAGG + Intergenic
1154430855 18:14307477-14307499 GTGTGTCCCTATAAAAATTCAGG + Intergenic
1154433527 18:14326781-14326803 GTGTGTCCCTATAAAAATTCAGG + Intergenic
1156717576 18:40029509-40029531 GTGGAGGCTCAGAAAAATACGGG - Intergenic
1157125066 18:44948890-44948912 GTCAGTCCTGAGAAAGATTCTGG + Intronic
1158760412 18:60379359-60379381 GTAGGTGCTCAGTAAAATACTGG - Intergenic
1160699794 19:500391-500413 GTGGGTCCTTTGTAAATTTCAGG + Intronic
1162546440 19:11333496-11333518 GTGGGTGCTCAGCATATTTCTGG + Intronic
1164356717 19:27442848-27442870 GTAGTTTCTCAGAAAGATTCTGG - Intergenic
925786115 2:7432362-7432384 GTGGGTGCTCAGGATATTTCCGG - Intergenic
926472676 2:13280540-13280562 CTGTTTCCTCAGATAAATTCTGG + Intergenic
926787779 2:16535705-16535727 GTGGGCGCCCATAAAAATTCCGG + Intergenic
927360195 2:22223867-22223889 GTGAGTCCACAGAAGAATTGGGG + Intergenic
932630533 2:73339361-73339383 TTGGGTCCTTAGGACAATTCAGG - Intergenic
935532480 2:104252010-104252032 GTGATTCCTCAGAACCATTCAGG + Intergenic
938069637 2:128301594-128301616 GTGGTGACTCAGAAACATTCTGG - Intronic
941609825 2:167646925-167646947 CTGGGTCCTCAGAAGTGTTCTGG + Intergenic
941920264 2:170843160-170843182 GTGGGGCCTAAGAAAAATCAAGG - Intronic
941999580 2:171632517-171632539 GTTGGTCTTCAGAAAAAGTATGG + Intergenic
946942591 2:224785374-224785396 CTGTGTCCTGAGAAAAATCCCGG + Intronic
1169062348 20:2670519-2670541 GTGAGTCCTAAGAAACCTTCTGG - Intergenic
1170437340 20:16344361-16344383 GTCTGTCCTCAGAAAGATTTGGG - Intronic
1170852688 20:20018746-20018768 GTGGGCACTCAGAACAATGCAGG - Intronic
1174100259 20:48121800-48121822 CTGGCTCCTCAGAAAGTTTCTGG + Intergenic
1176843509 21:13858966-13858988 GTGAGTCCCTAAAAAAATTCAGG - Intergenic
1176846186 21:13878289-13878311 GTGTGTCCCTATAAAAATTCAGG - Intergenic
1176848919 21:13897832-13897854 GTGTGTCCCTATAAAAATTCAGG - Intergenic
1178404034 21:32310280-32310302 GTGGATCCTCAGCAAGATTTAGG + Intronic
1179331768 21:40409539-40409561 GTGGGCCCTCTGTAAAACTCAGG - Intronic
1181674436 22:24442530-24442552 GTGGGCCCTCATAGAAATGCAGG - Intergenic
1183684687 22:39354936-39354958 ATGGGGCCACAGGAAAATTCTGG + Intronic
949164734 3:925505-925527 GTGAGTACTCAGAATAAATCAGG - Intergenic
951106403 3:18748619-18748641 GTGGCTCCCCAAATAAATTCTGG + Intergenic
952388242 3:32858670-32858692 GTAGGGCCTCAGAACAATTTGGG + Intronic
953917033 3:46926801-46926823 GTGGTCCCTCAGAAAAGTCCTGG + Intronic
954403181 3:50330129-50330151 GTGGGTGCTCAGAATAAGGCAGG - Exonic
954675626 3:52313926-52313948 GTGAGTCATCAGAATAATCCAGG + Intergenic
956354657 3:68377937-68377959 GTGGGTACACAGAAGAATTGAGG + Intronic
959782361 3:110250152-110250174 GTGTTTCCGCAGAAAATTTCTGG - Intergenic
962088843 3:132221499-132221521 GTGGGGCCTAAGAAATATTAAGG - Intronic
962202450 3:133412966-133412988 GTGGTTACTCAGATACATTCTGG - Intronic
963156324 3:142100903-142100925 ATGGGCCCTCAGAAAGATCCAGG - Intronic
966667082 3:182483298-182483320 AGGGTTCCTCAGAAAAGTTCTGG + Intergenic
971238638 4:24867427-24867449 GTGTGACCTCAGAAGAATGCTGG + Intronic
971475036 4:27064873-27064895 GTGGGACTTCAGCAAAACTCAGG - Intergenic
975092175 4:70416903-70416925 TTGGGTCCACAGAAAACATCAGG + Intergenic
977021205 4:91762477-91762499 GTAGGTCCTCATTAAAATTCAGG + Intergenic
978957497 4:114632384-114632406 GTGGATTTTCAGAAAAATTATGG + Intronic
980974097 4:139594432-139594454 GTGTGTCCTCAGAAAAGTGTTGG - Intronic
982221463 4:153129067-153129089 GTGGATCATCAGCAAATTTCTGG + Intergenic
982315664 4:154029037-154029059 GTGGTTCCTCTGGAAAGTTCTGG - Intergenic
984353224 4:178622111-178622133 GTGGGTGCTCAGAAGAGTTGAGG - Intergenic
986777998 5:11036738-11036760 GCGGTTTCTCAGAAAACTTCCGG + Intronic
987495495 5:18638433-18638455 GTGGGTCTACAGAAAAATAAAGG - Intergenic
988963751 5:36394415-36394437 ATGGGTCCTCAGCGAACTTCGGG + Intergenic
989335272 5:40308997-40309019 GTGAGTCCTCAGGAATGTTCTGG + Intergenic
990303130 5:54468882-54468904 ATGGGTCCTCTCCAAAATTCAGG - Intergenic
991731450 5:69593530-69593552 CTGGGTCATCAGAGAAATTTAGG + Exonic
991807882 5:70448685-70448707 CTGGGTCATCAGAGAAATTTAGG + Intergenic
991863501 5:71034323-71034345 CTGGGTCATCAGAGAAATTTAGG - Intergenic
992658072 5:78930075-78930097 GTGGGGCCTAAGGAAAACTCAGG - Intronic
993141486 5:84039319-84039341 TTGGATCCACAGATAAATTCAGG - Intronic
993639978 5:90390952-90390974 GTGGAGCCTAACAAAAATTCAGG - Intergenic
995006964 5:107210400-107210422 GTGGTTCCTCAGAAAAATAGAGG + Intergenic
998071014 5:139198154-139198176 GTGGGTCCCCAGAACACTGCTGG + Intronic
998823434 5:146077357-146077379 TTGAGACCTCAGAGAAATTCTGG + Intronic
999247077 5:150160751-150160773 GTGTGCCCTCAAAAAAGTTCTGG - Intergenic
1000736029 5:164901732-164901754 GTGGGTCCTCACAAATTTACGGG - Intergenic
1006387589 6:33739993-33740015 GTCGGTCCTGAGAATAATGCAGG - Intronic
1008320324 6:50104340-50104362 CTGGTTCCACAGAGAAATTCTGG + Intergenic
1008642857 6:53482735-53482757 GTGGGTACTCATGAACATTCAGG + Intergenic
1014167428 6:118241159-118241181 TTGTTTCCTAAGAAAAATTCAGG - Intronic
1020967082 7:14884550-14884572 GTGCTGCCTCAGAAAAAGTCAGG - Intronic
1021609903 7:22446662-22446684 GTGAGTGCTCAGAAAAATAAGGG - Intronic
1023175644 7:37433102-37433124 TTGGGTCTTCAGCAAAATTGAGG + Intronic
1024686720 7:51753900-51753922 GTGGCTTCACAGAAATATTCCGG - Intergenic
1025832911 7:65069688-65069710 TTAGGTCCTCAAAAGAATTCAGG - Intergenic
1025902681 7:65759202-65759224 TTAGGTCCTCAAAAGAATTCAGG - Intergenic
1027645850 7:80797318-80797340 ATGGACCCTTAGAAAAATTCCGG + Intronic
1027717986 7:81698129-81698151 CAGGGTCCTCAGTAAAATTTAGG - Intergenic
1031307051 7:120141960-120141982 TTGGGTTCACAGAAAAATTGAGG + Intergenic
1032318272 7:130861179-130861201 GTGGGTACACAGAAGAATTGAGG + Intergenic
1032585041 7:133138595-133138617 GTGGGTCATCAGACACATCCAGG + Intergenic
1033283507 7:140022101-140022123 CTGAGTCCTCACAAAGATTCTGG + Intergenic
1033528214 7:142237688-142237710 GTCGGTACTGAGATAAATTCTGG + Intergenic
1036074140 8:5475979-5476001 GTAGGTGCTCAAAAAACTTCTGG - Intergenic
1036196918 8:6726493-6726515 GTGGGTTCTCTGAACATTTCTGG + Intronic
1036260061 8:7232396-7232418 GAGGGGCCTCCTAAAAATTCAGG + Intergenic
1036312102 8:7690965-7690987 GAGGGGCCTCCTAAAAATTCAGG + Intergenic
1037206010 8:16320845-16320867 GTGGGTGCACAGAAGAATTGAGG + Intronic
1041529416 8:58847025-58847047 GTGGGTGGTCTGAAAAATTCAGG + Intronic
1041589070 8:59555709-59555731 GTTGGTCCTCAGATGAACTCTGG + Intergenic
1043925107 8:86027900-86027922 GTGGTTCCTCAGCAGAGTTCTGG - Intronic
1044701272 8:94967430-94967452 GTAGGTACTCAGAAATATTTTGG - Intronic
1045256765 8:100531614-100531636 GTGGCTCCTCACTGAAATTCAGG - Intronic
1045448323 8:102291008-102291030 GTTGGTGCTCAGAAAGTTTCCGG + Intronic
1050632299 9:7573033-7573055 GTGGGTCCTGGGAGAAATTGGGG - Intergenic
1053736768 9:41107306-41107328 GGGGGTCCTAAGAAAAATGGAGG - Intergenic
1053839072 9:42173356-42173378 GTGGGTGCACAGAAGAATTGAGG + Intergenic
1054691605 9:68324091-68324113 GGGGGTCCTAAGAAAAATGGAGG + Intergenic
1054706424 9:68467149-68467171 CTGGGTCCTCACAAAAAATTAGG - Intronic
1055059990 9:72058566-72058588 GTGAGCACTCAGAGAAATTCTGG - Intronic
1055761773 9:79616676-79616698 GTGGGTCCTTAGTAAAACTGAGG + Intronic
1057073154 9:92117934-92117956 GGGGGTCCTCTGAGAAATGCAGG - Intergenic
1057393988 9:94663275-94663297 GTGGGGCCTCAGAGAAAGCCTGG - Intergenic
1060009710 9:120032816-120032838 GTGGCTGCTCTGAAAAATGCAGG + Intergenic
1185956199 X:4493591-4493613 TTGATTCCTCAGAAAATTTCTGG + Intergenic
1187506030 X:19879315-19879337 GTAGGTGCTCAGAAAATGTCAGG - Intronic
1188389718 X:29604856-29604878 GTGGATCCTGAAAAAAATACGGG - Intronic
1189618038 X:42804817-42804839 GGAGGACCTCAGAAAAAGTCTGG + Intergenic
1191600012 X:62993248-62993270 GTTGGTCTTGAGAAAAATTAGGG + Intergenic
1193056713 X:77159981-77160003 GTGGGTCCTCAGGGAACTTAAGG - Intergenic
1193087532 X:77460478-77460500 ATTGGTGCTCAGGAAAATTCTGG - Intergenic
1194077345 X:89413259-89413281 GTTTGTCCTAAGAAACATTCAGG - Intergenic
1196053978 X:111335248-111335270 GTGAGTCCTCATGAAAATACAGG - Intronic
1197460096 X:126730363-126730385 GTATGTGCTGAGAAAAATTCAGG - Intergenic
1200429993 Y:3068798-3068820 GTTTGTCCTAAGAAACATTCAGG - Intergenic