ID: 1129595706

View in Genome Browser
Species Human (GRCh38)
Location 15:76962497-76962519
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129595706_1129595710 -6 Left 1129595706 15:76962497-76962519 CCACCCTCTACCGGTTTCTCCAT No data
Right 1129595710 15:76962514-76962536 CTCCATTATTCACTCTCTACAGG No data
1129595706_1129595711 -5 Left 1129595706 15:76962497-76962519 CCACCCTCTACCGGTTTCTCCAT No data
Right 1129595711 15:76962515-76962537 TCCATTATTCACTCTCTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129595706 Original CRISPR ATGGAGAAACCGGTAGAGGG TGG (reversed) Intergenic
No off target data available for this crispr