ID: 1129595711

View in Genome Browser
Species Human (GRCh38)
Location 15:76962515-76962537
Sequence TCCATTATTCACTCTCTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129595703_1129595711 3 Left 1129595703 15:76962489-76962511 CCTCTTCCCCACCCTCTACCGGT No data
Right 1129595711 15:76962515-76962537 TCCATTATTCACTCTCTACAGGG No data
1129595708_1129595711 -9 Left 1129595708 15:76962501-76962523 CCTCTACCGGTTTCTCCATTATT No data
Right 1129595711 15:76962515-76962537 TCCATTATTCACTCTCTACAGGG No data
1129595707_1129595711 -8 Left 1129595707 15:76962500-76962522 CCCTCTACCGGTTTCTCCATTAT No data
Right 1129595711 15:76962515-76962537 TCCATTATTCACTCTCTACAGGG No data
1129595704_1129595711 -3 Left 1129595704 15:76962495-76962517 CCCCACCCTCTACCGGTTTCTCC No data
Right 1129595711 15:76962515-76962537 TCCATTATTCACTCTCTACAGGG No data
1129595706_1129595711 -5 Left 1129595706 15:76962497-76962519 CCACCCTCTACCGGTTTCTCCAT No data
Right 1129595711 15:76962515-76962537 TCCATTATTCACTCTCTACAGGG No data
1129595705_1129595711 -4 Left 1129595705 15:76962496-76962518 CCCACCCTCTACCGGTTTCTCCA No data
Right 1129595711 15:76962515-76962537 TCCATTATTCACTCTCTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129595711 Original CRISPR TCCATTATTCACTCTCTACA GGG Intergenic
No off target data available for this crispr