ID: 1129597260

View in Genome Browser
Species Human (GRCh38)
Location 15:76974656-76974678
Sequence GACCCAAGAGGAGAATAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129597260_1129597276 25 Left 1129597260 15:76974656-76974678 CCTTCTTATTCTCCTCTTGGGTC No data
Right 1129597276 15:76974704-76974726 GCTGAGGCTGGCCAGCAGGGAGG No data
1129597260_1129597272 9 Left 1129597260 15:76974656-76974678 CCTTCTTATTCTCCTCTTGGGTC No data
Right 1129597272 15:76974688-76974710 CCTCTGATGGGGTGGGGCTGAGG No data
1129597260_1129597267 1 Left 1129597260 15:76974656-76974678 CCTTCTTATTCTCCTCTTGGGTC No data
Right 1129597267 15:76974680-76974702 GGGCTGACCCTCTGATGGGGTGG No data
1129597260_1129597265 -3 Left 1129597260 15:76974656-76974678 CCTTCTTATTCTCCTCTTGGGTC No data
Right 1129597265 15:76974676-76974698 GTCAGGGCTGACCCTCTGATGGG No data
1129597260_1129597266 -2 Left 1129597260 15:76974656-76974678 CCTTCTTATTCTCCTCTTGGGTC No data
Right 1129597266 15:76974677-76974699 TCAGGGCTGACCCTCTGATGGGG No data
1129597260_1129597269 3 Left 1129597260 15:76974656-76974678 CCTTCTTATTCTCCTCTTGGGTC No data
Right 1129597269 15:76974682-76974704 GCTGACCCTCTGATGGGGTGGGG No data
1129597260_1129597264 -4 Left 1129597260 15:76974656-76974678 CCTTCTTATTCTCCTCTTGGGTC No data
Right 1129597264 15:76974675-76974697 GGTCAGGGCTGACCCTCTGATGG No data
1129597260_1129597268 2 Left 1129597260 15:76974656-76974678 CCTTCTTATTCTCCTCTTGGGTC No data
Right 1129597268 15:76974681-76974703 GGCTGACCCTCTGATGGGGTGGG No data
1129597260_1129597273 13 Left 1129597260 15:76974656-76974678 CCTTCTTATTCTCCTCTTGGGTC No data
Right 1129597273 15:76974692-76974714 TGATGGGGTGGGGCTGAGGCTGG No data
1129597260_1129597275 22 Left 1129597260 15:76974656-76974678 CCTTCTTATTCTCCTCTTGGGTC No data
Right 1129597275 15:76974701-76974723 GGGGCTGAGGCTGGCCAGCAGGG No data
1129597260_1129597274 21 Left 1129597260 15:76974656-76974678 CCTTCTTATTCTCCTCTTGGGTC No data
Right 1129597274 15:76974700-76974722 TGGGGCTGAGGCTGGCCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129597260 Original CRISPR GACCCAAGAGGAGAATAAGA AGG (reversed) Intergenic
No off target data available for this crispr