ID: 1129597267

View in Genome Browser
Species Human (GRCh38)
Location 15:76974680-76974702
Sequence GGGCTGACCCTCTGATGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129597260_1129597267 1 Left 1129597260 15:76974656-76974678 CCTTCTTATTCTCCTCTTGGGTC No data
Right 1129597267 15:76974680-76974702 GGGCTGACCCTCTGATGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129597267 Original CRISPR GGGCTGACCCTCTGATGGGG TGG Intergenic
No off target data available for this crispr