ID: 1129597915

View in Genome Browser
Species Human (GRCh38)
Location 15:76979345-76979367
Sequence AGGCCAAGCAGGACATGGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 2, 2: 17, 3: 50, 4: 309}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129597915_1129597924 10 Left 1129597915 15:76979345-76979367 CCGCACCATGTCCTGCTTGGCCT 0: 1
1: 2
2: 17
3: 50
4: 309
Right 1129597924 15:76979378-76979400 GGCCTCCAGCTCGGACAACTTGG No data
1129597915_1129597923 1 Left 1129597915 15:76979345-76979367 CCGCACCATGTCCTGCTTGGCCT 0: 1
1: 2
2: 17
3: 50
4: 309
Right 1129597923 15:76979369-76979391 CCGCAGGGCGGCCTCCAGCTCGG 0: 1
1: 7
2: 18
3: 29
4: 184
1129597915_1129597927 16 Left 1129597915 15:76979345-76979367 CCGCACCATGTCCTGCTTGGCCT 0: 1
1: 2
2: 17
3: 50
4: 309
Right 1129597927 15:76979384-76979406 CAGCTCGGACAACTTGGCATTGG 0: 1
1: 4
2: 11
3: 15
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129597915 Original CRISPR AGGCCAAGCAGGACATGGTG CGG (reversed) Intergenic
900351575 1:2237528-2237550 ACCCCAACCAGGACAGGGTGAGG - Intronic
900433047 1:2611901-2611923 AGGCCACGCAGGAGCAGGTGCGG + Intronic
901061580 1:6474246-6474268 AGGGCAGGCAGGCCTTGGTGTGG - Intronic
902269972 1:15296777-15296799 TGGCCCAGCAGGACAAGGTGAGG + Exonic
905974647 1:42165631-42165653 AGGGCAGGCAGGACAGGATGGGG - Intergenic
906223688 1:44103670-44103692 CGGCCAAGCAGGACATGGCGCGG - Intergenic
906251973 1:44317742-44317764 AGGTCAAGCAGGAGTTGGCGGGG + Intronic
907159592 1:52360577-52360599 AGGCCTAGCAGGCCCTGGAGTGG - Intronic
907454258 1:54565066-54565088 AGGCCAAGGAGGGCCTGGGGTGG - Intronic
909232292 1:73105917-73105939 AGGCCAAGCAGGACGCAGCGAGG + Intergenic
910257263 1:85260122-85260144 AGGTCAAGCAGGAAATGATTTGG - Intergenic
911293440 1:96084680-96084702 AGGACAAGCAGGACAGGGATCGG + Intergenic
912511432 1:110192682-110192704 AGGACGAGCTGGACAAGGTGCGG + Exonic
912714918 1:111976342-111976364 AGGCCAGGCAGGGCATTCTGTGG - Intronic
915619823 1:157074337-157074359 GGGCCAAGCAGGACATGTTGCGG + Intergenic
916415503 1:164588835-164588857 AGGAAAAGGAGGGCATGGTGGGG - Intronic
916786714 1:168092021-168092043 GAGCCAAGGAGGACATGGTGTGG + Intronic
919744570 1:201000425-201000447 GGGCCAAGCAGGACCTGGAGCGG - Exonic
920346802 1:205311164-205311186 AGGCCAAGAAAGACAAGGAGAGG + Intronic
922079677 1:222283637-222283659 TGGCCAAGCAGGTCAAGGTTGGG + Intergenic
922279197 1:224106695-224106717 AGGGAAAGCAGGTCATGGAGAGG + Intergenic
922606957 1:226895406-226895428 AAGCCCTGCAGGACATGGAGGGG - Exonic
1063434339 10:6018300-6018322 AGGGCAGGGAGGACAGGGTGAGG + Intronic
1063714528 10:8514031-8514053 GGGTCAAGCAGGACATGGCGCGG - Intergenic
1064129247 10:12693495-12693517 AAGCCTAGGTGGACATGGTGAGG + Intronic
1064304624 10:14154007-14154029 AGGCCAAGCAGGGGATGGCGAGG - Intronic
1067122740 10:43488391-43488413 AAGCAAAGCAGGACAAGGTTAGG + Intergenic
1067166251 10:43868599-43868621 AGGCCTAGCAGGGCTTGCTGAGG + Intergenic
1069139997 10:64810730-64810752 AGGGCAAGCAGAGCATGGTGGGG - Intergenic
1069204140 10:65660559-65660581 AAGCCTAGGAGGACCTGGTGTGG + Intergenic
1069660594 10:70121095-70121117 AGGCCTATGAGGACATGGTGAGG - Exonic
1069735120 10:70648988-70649010 AGGCCAACCTGGAATTGGTGGGG - Intergenic
1070959052 10:80486192-80486214 AGGTGAAGCAGCAGATGGTGAGG + Intronic
1071371066 10:84952386-84952408 AGGATAAGAAGGACATGGGGTGG + Intergenic
1071431503 10:85610587-85610609 AGCCCAGCCAGGGCATGGTGGGG - Intronic
1072189585 10:93068989-93069011 AAGCCAAGCAGCACCTCGTGGGG - Intergenic
1072806328 10:98425853-98425875 GGGGCAGGCAGTACATGGTGTGG + Exonic
1073176092 10:101558684-101558706 AGGCGCAGCAGGAGAGGGTGGGG - Intergenic
1073266107 10:102229466-102229488 AGGCCAAGCAGGCCCTGGGATGG + Exonic
1074084447 10:110197248-110197270 AGGCCATGCAGGGGATGCTGTGG + Intergenic
1074096514 10:110318152-110318174 AGGCCAGGAGGGAGATGGTGTGG - Intergenic
1074404424 10:113168916-113168938 AGGCCACACAGGAGGTGGTGGGG + Intergenic
1074449066 10:113544604-113544626 GTCCCAAGCAGGACAAGGTGAGG - Intergenic
1075565642 10:123501923-123501945 AAGCCAAGCAAGAAATGGGGTGG - Intergenic
1076033060 10:127175694-127175716 GGGCCAAGCAGGACCGGGGGAGG - Exonic
1077128595 11:957282-957304 AGGCCCAGGAGGACAGGGTTTGG - Intronic
1077162942 11:1121863-1121885 AGGCCCAGGAGGACGGGGTGGGG - Intergenic
1077709032 11:4517352-4517374 AGGCCAAGAAGGATGTGGTAGGG - Intergenic
1077730948 11:4729296-4729318 CAGCCAAGCAGGTGATGGTGAGG + Intronic
1078665134 11:13318130-13318152 GGGCCAAGCAGGCCATGGAAAGG - Intronic
1079121166 11:17686226-17686248 AGGCCAGGGACGCCATGGTGGGG - Intergenic
1080350434 11:31379188-31379210 AGGCCATGCAGCAGGTGGTGCGG + Intronic
1080732902 11:34978818-34978840 AGGCCTTGTTGGACATGGTGAGG + Intronic
1081676305 11:44972012-44972034 GAGCCAAGCAGGAGATGGGGTGG + Intergenic
1082806582 11:57455592-57455614 AGGCCAGGCAGAACAAGGTGTGG + Intergenic
1083968848 11:66059993-66060015 AGGCCCTGCAGGAGAAGGTGAGG + Exonic
1085415612 11:76317426-76317448 GGGGCAAGCAGCACATGGTCTGG - Intergenic
1087943113 11:104125211-104125233 AGGTCAAGCAGCACATGCTCTGG + Intronic
1088145396 11:106670744-106670766 TGGCTAAGCAGGACAAGGTTGGG - Intergenic
1088210297 11:107447355-107447377 AGACCAAGCTGAACATGCTGAGG + Intronic
1088506358 11:110531506-110531528 GGGACAAGCAGGAGGTGGTGTGG + Intergenic
1088619905 11:111671298-111671320 GGGCCAATCAGGACATGGTGTGG - Intronic
1088913760 11:114211656-114211678 AGGACAAGCAGGAAATGGGGCGG - Intronic
1089433254 11:118438820-118438842 AGAGCAAGGAGGACATGATGGGG + Intronic
1089589226 11:119529904-119529926 AGGGGAACCAGGACAAGGTGTGG - Intergenic
1089599213 11:119603199-119603221 GGGCCAAGCAGGACATGGCGCGG - Intergenic
1090472854 11:126995850-126995872 AGGGCCAGCAGGAGATGGGGTGG - Intronic
1091323954 11:134670372-134670394 AGTCCAGGGAGGGCATGGTGTGG - Intergenic
1091957615 12:4660644-4660666 AGACTAAGCAGGACATGATAAGG + Intronic
1096518716 12:52172293-52172315 AGGCCAAGCAGGACATGGCGCGG - Exonic
1096533869 12:52258538-52258560 AGTAGAGGCAGGACATGGTGCGG + Intronic
1096552198 12:52380458-52380480 AGGCCAAGCAGGACATGGCGCGG - Exonic
1096559854 12:52428351-52428373 AGGCCAAGCAGGACATGGCTCGG - Exonic
1096562669 12:52447873-52447895 AGGCCAAGCAGGACCTGGCCCGG - Exonic
1096564839 12:52469765-52469787 AGGCCAAGCAGGACCTGGCCCGG - Exonic
1096566759 12:52488423-52488445 AGGCCAAGCAGGACCTGGCCCGG - Exonic
1096569947 12:52516732-52516754 AGGCCAAGCAGGACATGGCCCGG - Exonic
1096574855 12:52546381-52546403 AGGCCAAGGAGGAGCTGGCGCGG - Exonic
1096578260 12:52568264-52568286 AGGCCAAGGAGGAGCTGGCGCGG - Exonic
1096589301 12:52646835-52646857 AGGCCAAGGAGGACTTGGCGCGG - Exonic
1096626423 12:52898774-52898796 GGGCCAAGCAGGACATGGCGCGG - Exonic
1096627915 12:52906573-52906595 GGGCCAGGCAGGGCATGCTGTGG + Intronic
1098264714 12:68706707-68706729 GGGCCAAGCAGGACATGGCACGG + Intronic
1099314235 12:81064781-81064803 AGCCAAAGCAGGGCATGGCGGGG + Intronic
1099629852 12:85128664-85128686 AGGCCAAGCAAGACCTGCTTTGG - Intronic
1101191573 12:102338949-102338971 CGGCCTTGCAGGTCATGGTGAGG - Intergenic
1104393825 12:128414843-128414865 AAGCCAACCAGGACCTGCTGCGG + Exonic
1104544752 12:129700565-129700587 AGGCCAACCAGGATATCATGAGG - Exonic
1104609603 12:130217378-130217400 GGGCCAGGCAGGATAAGGTGGGG + Intergenic
1104776880 12:131394830-131394852 AGGCCAAGCAGGAGGTGTGGGGG - Intergenic
1104942351 12:132400926-132400948 AGCCCAAGCAGCCCATGGAGAGG - Intergenic
1108490291 13:50974980-50975002 AGGCCTTGCAGGTCATGATGTGG - Intergenic
1110178562 13:72587467-72587489 TGGCCAAGCTGGACATAGTGAGG - Intergenic
1112580360 13:100672885-100672907 AGCCCAGGCAGGACATCATGTGG - Intronic
1114251979 14:20969480-20969502 AGGCCAAGCAGAGACTGGTGAGG - Intergenic
1116781680 14:49243943-49243965 AGGGCAAGCAGAGCAGGGTGGGG + Intergenic
1120480332 14:85041319-85041341 ATGCCAGGCAGCACATGGTGAGG - Intergenic
1121215553 14:92244886-92244908 AGCCCAAGCAGTACTTGGGGTGG + Intergenic
1121349928 14:93165231-93165253 AGGCCAGGCAGGCCATGGCCTGG - Intergenic
1122013483 14:98773237-98773259 AGGACAAGCAGGACTTGGCCAGG + Intergenic
1122149688 14:99718217-99718239 AGGGGAAGCAGGGCATGTTGAGG - Intronic
1123435280 15:20249707-20249729 AGGCCAGGCATGACAGGGTCTGG - Intergenic
1123726852 15:23111864-23111886 AGGACAGGCAGGACATGGTGAGG - Intergenic
1124917258 15:33987880-33987902 AGACCCAGCAGGACCTGGTTAGG - Intronic
1125107912 15:35995700-35995722 AATCCAAGCAAGAGATGGTGGGG - Intergenic
1125599129 15:40906199-40906221 AAGCCAAGCAAGACATGGAATGG + Intergenic
1127856296 15:62956469-62956491 AGGGCAAGCAGAAGATGGTTTGG + Intergenic
1128283267 15:66414888-66414910 GGGCCAAGAAGGTCATGGCGGGG + Intronic
1128842254 15:70859797-70859819 GGGCCAGGCAGGATATGGTGTGG + Intronic
1129225430 15:74167926-74167948 AGGCCAAGCAGGACAGAAGGCGG - Intergenic
1129476910 15:75791817-75791839 AGTCCCAGCAGGGCCTGGTGGGG - Intergenic
1129597915 15:76979345-76979367 AGGCCAAGCAGGACATGGTGCGG - Intergenic
1129741387 15:77991311-77991333 AGGGCAGGCAGGACAGGGTGGGG - Intronic
1129844276 15:78761096-78761118 AGGGCAGGCAGGACAGGGTGGGG + Intronic
1130257532 15:82332703-82332725 AGGGCAGGCAGGACAGGGTGGGG - Intergenic
1130597412 15:85257261-85257283 AGGGCAGGCAGGACAGGGTGGGG + Intergenic
1131111224 15:89766455-89766477 TGGACAAGCAGGAGATGATGTGG - Intronic
1132298183 15:100759813-100759835 AGAGCAAACAGGACATTGTGAGG + Intergenic
1133196212 16:4172584-4172606 GGGCCAAGCAGCACTTTGTGTGG - Intergenic
1133252209 16:4490303-4490325 AGGCAAAGCAGGAAAGGCTGTGG - Intronic
1134448222 16:14346786-14346808 AGGCCAAGAAGAAAATGGGGAGG + Intergenic
1135421467 16:22308209-22308231 AGCCCAAGCAGCAGAAGGTGGGG + Exonic
1136052397 16:27661263-27661285 AGGGCATGCAGGGAATGGTGGGG + Intronic
1136270416 16:29145146-29145168 AGGCTGAGCTGGCCATGGTGAGG - Intergenic
1136849327 16:33601265-33601287 AGGCCAGGCATGACAGGGTCTGG + Intergenic
1137408094 16:48205746-48205768 AGTCCAAGCAGGACCTGGCTGGG - Intronic
1137568120 16:49546772-49546794 AGGTCAAGCAGATCAGGGTGGGG - Intronic
1137610534 16:49814364-49814386 AGGGCAAGCAGGACAGGGGTGGG + Intronic
1139392155 16:66611932-66611954 AGGTTCAGCAGGACAAGGTGAGG - Intronic
1139579107 16:67861654-67861676 GGGTGAAGCAGGAGATGGTGTGG + Intronic
1140753704 16:78048791-78048813 CGGCCAAGCGGGACATGGCACGG - Intronic
1141228906 16:82145995-82146017 AGGCCCAGCTGGAGATGGCGAGG - Intergenic
1141744171 16:85914605-85914627 AGGATGAGCAGGACCTGGTGTGG + Intronic
1141744180 16:85914647-85914669 AGGATGAGCAGGACCTGGTGTGG + Intronic
1141744188 16:85914689-85914711 AGGATGAGCAGGACCTGGTGTGG + Intronic
1141744196 16:85914731-85914753 AGGATGAGCAGGACCTGGTGTGG + Intronic
1141744212 16:85914815-85914837 AGGATGAGCAGGACCTGGTGTGG + Intronic
1142044735 16:87918404-87918426 AGGCCAAGGAGGAAAGGCTGGGG - Intronic
1142074002 16:88106955-88106977 AGGCTGAGCTGGCCATGGTGAGG - Intronic
1142267739 16:89072265-89072287 GGGCCCAGCAGGACCTGGGGAGG + Intergenic
1203111034 16_KI270728v1_random:1449915-1449937 AGGCCAGGCATGACAGGGTCTGG + Intergenic
1144093634 17:11880626-11880648 AGGCAAAGCAGGGGGTGGTGTGG + Intronic
1144261089 17:13521584-13521606 AGGCCATGCAGGGCACGTTGAGG - Intronic
1144645922 17:16973315-16973337 AGGACGAGGAGGACATGGAGAGG + Intergenic
1145081455 17:19897811-19897833 AGGCCAGGAAAGGCATGGTGGGG + Intergenic
1145995582 17:29103148-29103170 AGAGCAAGTAGGACATGGTGAGG - Intronic
1146373798 17:32281190-32281212 AGGGCAGGCAGGCCCTGGTGGGG + Intronic
1146565475 17:33909299-33909321 AGGCCTACAAGGACAAGGTGAGG + Intronic
1146842635 17:36166385-36166407 AGCCCCACCAGGACAGGGTGTGG + Exonic
1146854947 17:36254344-36254366 AGCCCCACCAGGACAGGGTGTGG + Exonic
1146865673 17:36334032-36334054 AGCCCCACCAGGACAGGGTGTGG - Exonic
1146870847 17:36378236-36378258 AGCCCCACCAGGACAGGGTGTGG + Exonic
1146878206 17:36429318-36429340 AGCCCCACCAGGACAGGGTGTGG + Exonic
1146882155 17:36450464-36450486 AGCCCCACCAGGACAGGGTGTGG + Intergenic
1146914859 17:36672029-36672051 AGGCCTGGCAGGACATGGCTGGG + Intergenic
1147068542 17:37934644-37934666 AGCCCCACCAGGACAGGGTGTGG - Exonic
1147073731 17:37978860-37978882 AGCCCCACCAGGACAGGGTGTGG + Intronic
1147080065 17:38014181-38014203 AGCCCCACCAGGACAGGGTGTGG - Intronic
1147085252 17:38058398-38058420 AGCCCCACCAGGACAGGGTGTGG + Exonic
1147096014 17:38138141-38138163 AGCCCCACCAGGACAGGGTGTGG - Intergenic
1147101199 17:38182364-38182386 AGCCCCACCAGGACAGGGTGTGG + Intergenic
1147265024 17:39229402-39229424 AGGCCAGGAAGGACATCGAGAGG - Intergenic
1147760625 17:42795462-42795484 GGGCCGAGCAGGAGGTGGTGAGG - Exonic
1147944832 17:44075057-44075079 AGGCCAGCCAGCACCTGGTGAGG - Exonic
1149845797 17:60008870-60008892 AGCCCCACCAGGACAGGGTGTGG + Intergenic
1150084145 17:62265450-62265472 AGCCCCACCAGGACAGGGTGTGG + Intergenic
1150327868 17:64271196-64271218 AGGCTCAGCAGGAGAGGGTGCGG - Intergenic
1151165895 17:72203614-72203636 AGTCCAGGCATGAAATGGTGAGG - Intergenic
1152073863 17:78147098-78147120 AGGCCAAGCAGGCCAGTGTGGGG + Intronic
1152706429 17:81845996-81846018 AGGGCAGGCAGGGCACGGTGAGG + Intronic
1156915473 18:42461427-42461449 ATGCCAGGCAGGCCATGCTGGGG - Intergenic
1157063545 18:44321130-44321152 AGGCCAAGCAGGATATGGCATGG - Intergenic
1157121727 18:44917687-44917709 AGGACAAGCTGGAGAGGGTGAGG - Intronic
1157331629 18:46708346-46708368 TGTCCAAGCAGGACTTAGTGTGG - Intronic
1158640392 18:59198383-59198405 AAGGCAAGCAGAACATGCTGGGG + Intergenic
1158727118 18:59983735-59983757 AAGCCAAGCAGGTCAAGGTCAGG - Intergenic
1159244608 18:65789622-65789644 ATTCCAGGCAGGATATGGTGAGG + Intronic
1162741021 19:12773810-12773832 GGGCCTGGCAGGCCATGGTGGGG - Intronic
1163302513 19:16456942-16456964 AGGGCAAGCAGAACATGGGGAGG + Intronic
1164578292 19:29418833-29418855 AGGAGAAGCTGCACATGGTGAGG + Intergenic
1165809118 19:38600071-38600093 AGGCCACGCTGGAAATGGTGAGG - Exonic
1166348973 19:42185258-42185280 GGGCCAAGCAGGAGATGTGGAGG - Intronic
1166647475 19:44542935-44542957 CAGCAAAGCAGGACAGGGTGAGG + Intergenic
1167005694 19:46775213-46775235 AGGCCAGGCAGGTCACGGTGGGG + Exonic
1167295589 19:48647084-48647106 AGACCAAGCAGCAGATGGGGTGG + Intergenic
1167384114 19:49154120-49154142 AGGCCATGGTGGACATGTTGGGG + Exonic
1167597325 19:50434707-50434729 AGGCCAAGCAGGCTGTGGGGTGG + Intronic
1167880578 19:52454034-52454056 AGCCCAAGGAGGACAAGGTTGGG - Intronic
1168400372 19:56082185-56082207 AGGACAAGCAGCACAGGGTATGG + Intergenic
926310020 2:11668607-11668629 AGGCCCAGCAGGGCCTGGAGGGG + Intronic
926457804 2:13089999-13090021 AGGCCAAGAAAGACATTGAGTGG - Intergenic
926998690 2:18769073-18769095 AGGCCATACAGGAAATGGAGAGG - Intergenic
927081758 2:19637373-19637395 AGGCAAAGCAGCACATTGTATGG + Intergenic
927949006 2:27154997-27155019 AGTCTGAGCAGGACAGGGTGGGG - Exonic
931804854 2:65794349-65794371 AGGACAAGGAGGACATGTAGAGG - Intergenic
932117682 2:69068031-69068053 AGGCCAAGCAGGACCTGATCTGG - Intronic
932411527 2:71550622-71550644 AGCACATGCAGGACATGCTGGGG + Intronic
932569693 2:72932020-72932042 AGGCCAAGCAGTGCATGCAGAGG - Intronic
933969280 2:87457211-87457233 AGGCCAAACAGAACCTGGTGGGG - Intergenic
936324506 2:111493283-111493305 AGGCCAAACAGAACCTGGTGGGG + Intergenic
937350404 2:121156738-121156760 ATGCCAAGCAGGGGATGGTGGGG - Intergenic
940634694 2:156284377-156284399 AGGCAAAGGAGGAAAGGGTGAGG - Intergenic
942126116 2:172827427-172827449 AGGCCAACTAGGACAAGGAGAGG - Intronic
942385149 2:175434874-175434896 AGGCCAGGCAGGAAATAATGGGG + Intergenic
942558657 2:177198186-177198208 GGGCCAAGCAAGACATGGCATGG + Intergenic
943096597 2:183436571-183436593 AGGGCAAGGAGGACAGGGAGTGG + Intergenic
943330416 2:186552100-186552122 AGGGGAAGCAGGATAGGGTGGGG + Intergenic
944932926 2:204538685-204538707 AAGCCAAGCAAGACATGGGAAGG - Intergenic
945923916 2:215784068-215784090 AGCCAAAACAGGACATGCTGAGG + Intergenic
946176559 2:217925603-217925625 GGGACTAGCAGGAGATGGTGGGG - Intronic
946839817 2:223809175-223809197 TGGCCTTGCAGGCCATGGTGAGG - Intronic
947841064 2:233208343-233208365 AGGCCAGGCAGCCCAAGGTGGGG - Intergenic
1169031843 20:2415636-2415658 ATGCTCAGCAGGACCTGGTGAGG + Intronic
1169092686 20:2871312-2871334 AGGTCACCCAGCACATGGTGGGG + Intronic
1169416626 20:5422801-5422823 AGGACATTCAGGACAGGGTGTGG + Intergenic
1171022661 20:21600799-21600821 AGCCCAAGCAGCTCATGGAGAGG + Intergenic
1171480263 20:25449926-25449948 AGGCCCAAAAGGACAGGGTGTGG - Intronic
1171487830 20:25496746-25496768 AGGCAAGGCAGGACCTGGAGAGG - Exonic
1171964302 20:31517629-31517651 AGGCAGAGCAGGAGAAGGTGGGG + Intronic
1172836201 20:37874827-37874849 ATGCGAAGCAGGGCAAGGTGCGG - Intergenic
1174538694 20:51272856-51272878 AGGCCTTGCAAGCCATGGTGAGG + Intergenic
1175817540 20:61891360-61891382 AGGCTCAGCAGGACAGGGAGGGG - Intronic
1177474830 21:21606696-21606718 AGGCTTTGCACGACATGGTGAGG - Intergenic
1177903740 21:26949751-26949773 GGGCCAAGAAAGACATAGTGTGG + Intronic
1178272000 21:31199399-31199421 AGGGGATGCAGGAGATGGTGGGG - Intronic
1178755788 21:35348323-35348345 GGGCCCAGCAGGAAATGGAGAGG - Intronic
1178860789 21:36287338-36287360 AAACCAAGCAGCCCATGGTGAGG - Intronic
1179029045 21:37703963-37703985 AGGCCCAGCAGGGCAAGGCGGGG - Intronic
1179029079 21:37704113-37704135 AGGCCATGCTGAACATGCTGAGG + Intronic
1179981159 21:44896674-44896696 AGGCTCAGCAGGACAGGATGTGG - Intronic
1181775990 22:25160615-25160637 AGGCTACTCAGGACATGCTGTGG - Intronic
1181831450 22:25564184-25564206 AGGCTAAGCAGAACAAAGTGGGG - Intergenic
1182005635 22:26957177-26957199 AGGACAGGCAGGCCATGGTGGGG - Intergenic
1183101244 22:35585507-35585529 AGGCCAAGCAAGGGATGGTGAGG - Intergenic
1183334242 22:37237515-37237537 AGGCCAGGCAGAACCTGGTGGGG + Intronic
1183392200 22:37552102-37552124 AGGCCATGCAGGAGATGGTCAGG + Intergenic
1183474318 22:38027458-38027480 TGGCCAAGGAGGACATGCTGCGG - Intronic
1183606150 22:38867682-38867704 TGGCTCAGCAGGACTTGGTGCGG - Intronic
1183996142 22:41634116-41634138 AGCTCAGGCAGGACATGGAGGGG + Intronic
950697336 3:14713433-14713455 TGACTAAGGAGGACATGGTGTGG - Intronic
951723297 3:25725243-25725265 AGGCCTATCAGGACAGGGTTTGG + Intronic
951867981 3:27328801-27328823 AGTCCAAGCAAGAGATGATGGGG + Intronic
952733669 3:36666312-36666334 AGGTCAAGCAGGAGAGGGAGTGG - Intergenic
953298949 3:41751986-41752008 AGGACAGGTAGGACATGGTGAGG + Intronic
954316592 3:49804787-49804809 AGGCCAAGCAGGAACTGAGGGGG - Exonic
954601826 3:51876288-51876310 AGACCCAGCTGGACGTGGTGAGG + Intergenic
954677388 3:52323408-52323430 GGGCCAAGAAAGACAGGGTGAGG + Intronic
955839468 3:63096717-63096739 GGGCCAAGCAGGACATGGCGTGG - Intergenic
956125288 3:66005278-66005300 GGGCCAAGCAGGAGATGGGGAGG + Intronic
958020006 3:87983152-87983174 AGTTAAAGCAAGACATGGTGGGG + Intergenic
958133165 3:89455470-89455492 AGGCTACACAGGCCATGGTGAGG + Intronic
958935974 3:100255845-100255867 AGGGAAAGAAGAACATGGTGTGG + Intergenic
960286340 3:115833727-115833749 AGGCCATGCGGGACCTGGCGTGG - Intronic
961045623 3:123705736-123705758 AGGCCGAGCAAGAAAGGGTGGGG - Intronic
961054860 3:123779294-123779316 AGGCCCAGCATGACAGGCTGTGG + Intronic
961384679 3:126516764-126516786 AGGCCTAACAGGACACAGTGGGG - Intronic
961661812 3:128473052-128473074 AGGCCATGCAGTCCAAGGTGAGG + Intergenic
962410473 3:135137193-135137215 AGGCCAGGCAGGTAATGGAGAGG + Intronic
962712804 3:138101826-138101848 GGGCCAAGCAGGACATGGAGCGG - Intronic
963783622 3:149511164-149511186 ACGTCCAGCAGGGCATGGTGGGG - Intergenic
969348675 4:6585195-6585217 AGGCCAAGCAAGACAGGGCAGGG - Intronic
969585005 4:8086541-8086563 AGACCAGCCTGGACATGGTGAGG - Intronic
970335362 4:15034084-15034106 AGGCCACGTAGGAGATGGTCAGG + Intronic
971373696 4:26039019-26039041 AGGCCTTGCAGGCCATCGTGGGG - Intergenic
972896221 4:43624069-43624091 AGGCTTTGCAGGCCATGGTGAGG + Intergenic
973026772 4:45283473-45283495 AGGGCGAGCAGGGCATGGAGTGG + Intergenic
973832443 4:54775236-54775258 GGCCCAAGCAGGAGATGATGGGG + Intergenic
974013260 4:56626266-56626288 AGGCCAAGATGGACTTGGTTAGG - Intergenic
975939825 4:79629183-79629205 AAGCCAAACAAGGCATGGTGAGG - Intergenic
976443353 4:85102602-85102624 AGGACAAGGAGGACAGAGTGTGG + Intergenic
977928660 4:102729067-102729089 AGGCCAAGCAGGACATGGCATGG - Intronic
979492083 4:121339698-121339720 AGGCCAAGGAGTACAAGGAGAGG + Intronic
979621577 4:122804428-122804450 AGGGCAGGCATCACATGGTGAGG + Intergenic
981134053 4:141190121-141190143 AGGGCAAGCAGAGCAGGGTGGGG - Intronic
981359057 4:143826463-143826485 ATGCCAAGTAGGAGATGGAGAGG - Intergenic
982082411 4:151803697-151803719 AGCCCAAGCAAGAGATGGTGTGG - Intergenic
984003797 4:174284086-174284108 AGGCCCAGCACGACAGGGAGAGG - Exonic
984710606 4:182881020-182881042 AGTCCAAGCAGCACATGCTGAGG - Intergenic
986067983 5:4254799-4254821 AAGCAAAGAAGGAGATGGTGAGG + Intergenic
986402253 5:7394109-7394131 AGGGCAGGCAGGACAGGGTGGGG + Intergenic
988802883 5:34713225-34713247 AGGCCAAGGATAACATGGAGTGG + Intronic
995760129 5:115553756-115553778 AGAACAAGCTGGACATGATGTGG + Intergenic
996432898 5:123401237-123401259 GGGCCAAGCAGGACATGGCGTGG - Intronic
996976250 5:129438676-129438698 AGGCCAAACAGGGCATGGAATGG - Intergenic
997634679 5:135396591-135396613 AGGTCAAGCAGGAGATGGCTGGG - Intronic
997811960 5:136979286-136979308 AGGCCACCCAGGTCATTGTGGGG + Intronic
998054161 5:139060148-139060170 AAGCCAATCAGGATATGGAGGGG - Intronic
998098051 5:139408624-139408646 AGACTGAGCAGGACTTGGTGGGG + Intronic
998430593 5:142066477-142066499 AAGCCCAGCAGGACTTGCTGAGG + Intergenic
998682584 5:144486817-144486839 AGGCCAAGCAGGAGAAGGTGAGG + Intergenic
998717055 5:144896364-144896386 AGGCTAAGGAGGACACTGTGGGG + Intergenic
998887165 5:146706520-146706542 AGACCAAGTAGGACATGGCGCGG - Intronic
1000157088 5:158562792-158562814 AAAACAAGCAGGCCATGGTGAGG + Intergenic
1001286292 5:170426401-170426423 AGGCAAAGCAAGACAAGGTCAGG - Intronic
1001450864 5:171823316-171823338 AGGCCAAACAGGTCAGGGTCTGG + Intergenic
1002401098 5:178991961-178991983 AGGCCATGGTGGACATCGTGAGG - Exonic
1003625603 6:7738494-7738516 CGGCCAAGCAGGTCGTGGTGAGG - Intronic
1004222043 6:13755622-13755644 AGGCCTAGCAAGTCCTGGTGTGG - Intergenic
1005315518 6:24599437-24599459 GGGCCATGCAGGACATGGCATGG + Intronic
1006840598 6:37025904-37025926 AGGCCAAGGAGGACAAGAGGCGG + Exonic
1007282162 6:40720756-40720778 AGGCAAAGCACGAGACGGTGGGG - Intergenic
1008902947 6:56643767-56643789 AGGCCAAGAAGCAATTGGTGTGG - Intronic
1009566174 6:65313717-65313739 AGGCCACGTAGGAGATGGGGTGG - Intronic
1015505368 6:133980359-133980381 AGGACAACCAGCACATGGTAAGG - Intronic
1015852549 6:137589026-137589048 AGGCCAGACAGGAAAGGGTGGGG + Intergenic
1016076641 6:139804322-139804344 AGGGCAAGCCAGACATGGAGTGG + Intergenic
1018317273 6:162569361-162569383 AGGCCATGCAGGACATGGCGTGG + Intronic
1018780051 6:167055037-167055059 AGGACACGCTGGACACGGTGGGG + Intergenic
1018934608 6:168265556-168265578 AGACAATGCTGGACATGGTGAGG + Intergenic
1020368087 7:7401670-7401692 AGTGCAGGCAGGAGATGGTGTGG - Intronic
1020436142 7:8164428-8164450 AGGCAAAGCAGGCCCTGGTGAGG + Intronic
1021939922 7:25669142-25669164 AGGGGAAGAAGGAGATGGTGTGG - Intergenic
1023867605 7:44245655-44245677 AGACAAAGCAGGACATGCTTGGG + Intronic
1023889099 7:44380162-44380184 AGGCCAGGGAGGACAAGCTGTGG + Exonic
1024136202 7:46411791-46411813 AGGCCCAGGAGGACAGGGTTTGG - Intergenic
1026077455 7:67185383-67185405 AGTCCAAGCAAGAGATGGTTTGG + Intronic
1026699414 7:72626768-72626790 AGTCCAAGCAAGAGATGGTTTGG - Intronic
1026820054 7:73541304-73541326 AGGCCAGGCTGGAGATGATGAGG - Intronic
1026842959 7:73680961-73680983 AGGCCAAGTAGGACCAGCTGTGG + Exonic
1029100290 7:98124289-98124311 AGGTCAGACAGTACATGGTGAGG - Intronic
1029347372 7:99988163-99988185 GGGCCAAGGCGAACATGGTGTGG - Intergenic
1029400804 7:100344657-100344679 AGGCCAGGCTGGACAAGCTGAGG + Intronic
1033213111 7:139475166-139475188 AGGCCCAACAGGACAGGGTTTGG + Intronic
1033678045 7:143563701-143563723 TGACAAAGCAGGACAAGGTGAGG + Intergenic
1033693794 7:143765743-143765765 TGACAAAGCAGGACAAGGTGAGG - Intergenic
1034341306 7:150357989-150358011 ACGCCAAGGAGGACACGATGTGG - Intergenic
1034503107 7:151464257-151464279 AGGCTGACCAGGAGATGGTGGGG + Intergenic
1035441392 7:158904343-158904365 AGTCCAAGCACCACAGGGTGTGG - Intronic
1036048813 8:5173045-5173067 AGGCCAAGAAGGATCTGGAGTGG + Intergenic
1041698934 8:60766344-60766366 GGGCCTTGCAGGCCATGGTGAGG + Intronic
1041781155 8:61579304-61579326 GGGCCAAGCAGGACATGGCACGG + Intronic
1042153139 8:65811429-65811451 AGGCCTAGCAGGAGATGGGCGGG - Intronic
1042361126 8:67884432-67884454 AGGCCAAGCAGACAAGGGTGTGG + Intergenic
1044245792 8:89943794-89943816 AGTCCAAGCAGGAGATGTTGGGG + Intronic
1045911578 8:107416542-107416564 AGGCCAAAGAGGACAGGGTACGG - Intronic
1046180679 8:110643216-110643238 TTGCCAATCAGGACATCGTGAGG + Intergenic
1047175906 8:122540115-122540137 AGGACAACCAGGATGTGGTGAGG - Intergenic
1047420807 8:124706805-124706827 AGGCCCATCAAGACATAGTGGGG + Intronic
1047497565 8:125419465-125419487 AGGCCACACAGGACAAGGGGCGG + Intergenic
1047878465 8:129166751-129166773 AAGGCAAGCAGGAGATGGTGAGG - Intergenic
1048455931 8:134578502-134578524 GGATCAAGCAGGTCATGGTGAGG + Intronic
1048786773 8:138058873-138058895 AGGCACTGGAGGACATGGTGTGG - Intergenic
1048966805 8:139620797-139620819 AGGCCAGAAAGGACAGGGTGGGG + Intronic
1049097905 8:140559610-140559632 AGGCCAGGCCAGCCATGGTGGGG + Intronic
1049228131 8:141467393-141467415 GGGCCAAGCTGGAGATCGTGAGG - Intergenic
1049289569 8:141794607-141794629 AGGCCTAGCAGGAAGTGATGGGG + Intergenic
1049337076 8:142092300-142092322 AGGCCTGGCAGGACATCCTGGGG - Intergenic
1049683534 8:143930329-143930351 TGGCCAGGCAGGGCAGGGTGTGG - Intronic
1051562074 9:18453180-18453202 AGCCCAAGCAGGCCCAGGTGAGG - Intergenic
1051742910 9:20268539-20268561 GTGCAAAGCAGCACATGGTGAGG - Intergenic
1055516648 9:77040696-77040718 GGGCCAAGAAGGTCATGGTGGGG - Intergenic
1056762352 9:89424631-89424653 AAGCCAGGCAGGACACAGTGAGG - Intronic
1057943666 9:99306244-99306266 GGGCCAAGCAGGACATGATGGGG + Intergenic
1060058214 9:120434326-120434348 AGGGGAAGCAGGAGAGGGTGGGG + Intronic
1060215912 9:121738086-121738108 AGGCCAAGCAGGCAAGGTTGTGG + Intronic
1060509456 9:124221500-124221522 AAGCCAAACAGCAAATGGTGAGG - Intergenic
1060968383 9:127724197-127724219 AGGACCAGGAGGACATGGTGCGG + Exonic
1061193051 9:129093481-129093503 AGCCCAGGCAGGACAGGGAGGGG - Intergenic
1061329099 9:129881095-129881117 AGGCTCAGCAGGACGCGGTGTGG - Exonic
1061844542 9:133379665-133379687 AGGGCTAGCAGGGCATGGGGAGG + Intronic
1062192689 9:135255954-135255976 AGGCCAGGGAGGACATGGACAGG - Intergenic
1062285582 9:135771186-135771208 AGACCAGGCAGGACAGGGGGAGG + Intronic
1186815748 X:13236161-13236183 AGCCCAGGCAGCATATGGTGAGG + Intergenic
1188365647 X:29312119-29312141 AGGACAAGTAGGACATTGTCTGG + Intronic
1188496637 X:30789384-30789406 AGGCAAGGCAAGACATGGTATGG - Intergenic
1189893772 X:45632632-45632654 GGGCCAAGCAGGACATGGCGCGG - Intergenic
1190143526 X:47869353-47869375 AGGAAAAACAGGACATGGCGTGG + Intronic
1191758734 X:64624208-64624230 GGGCCAAGCAGGATATGGCATGG + Intergenic
1191850430 X:65582041-65582063 AGGCAAAGCAGGATGTGGTTGGG + Intergenic
1191856584 X:65631970-65631992 AGCCCAGGCTGGGCATGGTGGGG - Intronic
1192318302 X:70068173-70068195 AGGGCAGGCAGCACAGGGTGGGG + Intergenic
1192552986 X:72068809-72068831 AGGCAAAGCAGGAGAGGGAGGGG + Intergenic
1195111460 X:101654705-101654727 AAGCCAAGCAAGAGATGATGAGG - Intergenic
1197555497 X:127947531-127947553 AGGCCAAGGAGGAAAAGGGGAGG - Intergenic
1199785108 X:151098306-151098328 AGGCCAATCAGGACTATGTGGGG + Intergenic
1199927281 X:152480657-152480679 GGGCCAAGCAGGACATGGCGAGG + Intergenic
1200225232 X:154413352-154413374 AGTCCAGGCAGGGCATGGGGTGG + Intronic
1201233116 Y:11884872-11884894 AGGCAAAGCAGGACATCTTGAGG + Intergenic
1201735618 Y:17257202-17257224 TGGCCAAGCAAGGCCTGGTGGGG + Intergenic