ID: 1129597916

View in Genome Browser
Species Human (GRCh38)
Location 15:76979350-76979372
Sequence GCGGCAGGCCAAGCAGGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 3, 2: 24, 3: 43, 4: 301}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129597916_1129597924 5 Left 1129597916 15:76979350-76979372 CCATGTCCTGCTTGGCCTGCCGC 0: 1
1: 3
2: 24
3: 43
4: 301
Right 1129597924 15:76979378-76979400 GGCCTCCAGCTCGGACAACTTGG No data
1129597916_1129597927 11 Left 1129597916 15:76979350-76979372 CCATGTCCTGCTTGGCCTGCCGC 0: 1
1: 3
2: 24
3: 43
4: 301
Right 1129597927 15:76979384-76979406 CAGCTCGGACAACTTGGCATTGG 0: 1
1: 4
2: 11
3: 15
4: 73
1129597916_1129597923 -4 Left 1129597916 15:76979350-76979372 CCATGTCCTGCTTGGCCTGCCGC 0: 1
1: 3
2: 24
3: 43
4: 301
Right 1129597923 15:76979369-76979391 CCGCAGGGCGGCCTCCAGCTCGG 0: 1
1: 7
2: 18
3: 29
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129597916 Original CRISPR GCGGCAGGCCAAGCAGGACA TGG (reversed) Intergenic
900351576 1:2237533-2237555 GCAGCACCCCAACCAGGACAGGG - Intronic
900458725 1:2790035-2790057 GCGCCAGGCGAAGCAGGACGCGG + Intronic
900471740 1:2858348-2858370 GGGGCAGGCCAGCCAGGACTGGG - Intergenic
900522688 1:3113282-3113304 GTGGGAGGGGAAGCAGGACAGGG + Intronic
900541128 1:3203464-3203486 TAGGCAGGCCATGCAGCACATGG - Intronic
902363235 1:15953704-15953726 GGGACAGGCCAAGCAGGACCTGG + Intronic
903070810 1:20726225-20726247 CCGGCAGGCCGAGCATCACATGG - Intronic
904356904 1:29946252-29946274 GCAGCAGCTCCAGCAGGACAGGG - Intergenic
904663971 1:32105897-32105919 GAGGCAGGCAAAACAGAACAGGG + Intergenic
905965710 1:42093514-42093536 GTGGCAGCCCAAGCAGTACCTGG + Intergenic
906223690 1:44103675-44103697 CCAGCCGGCCAAGCAGGACATGG - Intergenic
906537985 1:46562572-46562594 GGGGGATGCCAAGCAGGACTGGG - Intronic
907733461 1:57089507-57089529 GCGGAAGGTGAAGCAGGACCAGG + Intronic
908315711 1:62930280-62930302 GAGGCAAGACAAGCAGGAAATGG + Intergenic
912443679 1:109717253-109717275 GCTGCAGGCACAGCAGGTCAGGG - Intronic
915367358 1:155323630-155323652 GGGGCTGGCCAGGCAGGGCAAGG - Intronic
915839383 1:159202610-159202632 GGGGCAGTCCAGCCAGGACAGGG - Intronic
915897194 1:159821352-159821374 GTGGCAGGCCAAGAGGGCCATGG - Intergenic
916120693 1:161525627-161525649 GCGGGATGCCAAGCTGGACAAGG + Exonic
916130459 1:161607259-161607281 GCGGGATGCCAAGCTGGACAAGG + Intronic
917364761 1:174218044-174218066 GGGGCAGGACAAGCAGGCTAGGG - Intronic
917959590 1:180131784-180131806 GGGGCAGGCCATGAAGGTCAGGG + Intergenic
918216283 1:182394232-182394254 GGGGCTGGCCAAGGAGGACAAGG - Intergenic
919712137 1:200739121-200739143 GCGGCAGGGGAAGGAGGAGACGG + Intergenic
920376677 1:205512529-205512551 GGGGGAGGCCATGCAGGCCAAGG + Intronic
920792410 1:209105923-209105945 GTGGCATGCCCAACAGGACAGGG + Intergenic
921351660 1:214242372-214242394 GCGGAAGGCAAAGCAGGAGCAGG - Intergenic
921905994 1:220496175-220496197 GAGGAAGGCAAAGCAGGACCAGG + Intergenic
923559449 1:235027695-235027717 GCGGAAGGCAAAGCAGGAGCAGG + Intergenic
924062792 1:240193684-240193706 GCTGCAGGCCAAGGAGGCCCGGG - Intronic
924457476 1:244230184-244230206 GCAGGGAGCCAAGCAGGACAAGG + Intergenic
924777351 1:247119358-247119380 GAGGCAGGCCCACCAGGAGAAGG - Intergenic
1063142428 10:3267407-3267429 GAGGGAGGCCAAGGAGGCCAAGG - Intergenic
1063714529 10:8514036-8514058 GCAGCGGGTCAAGCAGGACATGG - Intergenic
1065636505 10:27741449-27741471 GCGGCAGGCCCTGCAAGACATGG - Exonic
1065947281 10:30617251-30617273 GGGTCAGGCCATGCAGGACCAGG + Intronic
1067786991 10:49257638-49257660 CCGGCAGGGCCAGCAGGACTGGG - Intergenic
1069635071 10:69920058-69920080 GGAGCAGCCCAGGCAGGACAGGG + Intronic
1069846398 10:71374736-71374758 GCGGCAAGCCAAGGAGGTTAGGG - Intergenic
1070742266 10:78910941-78910963 GGGGCAGGCAGAGCATGACACGG + Intergenic
1070853159 10:79584162-79584184 GCAGCAGGAGAAGCAGGAGAAGG + Intergenic
1072665304 10:97388428-97388450 GTGGCTGGCAGAGCAGGACAGGG - Intronic
1073060364 10:100730095-100730117 GCCGCAGGCCCAGGAGGCCAGGG - Intergenic
1074153865 10:110781746-110781768 GCGGAGGGCCAAGGAGGACCAGG + Exonic
1074769826 10:116726053-116726075 ACAACAGGCCAAGCAGGACAAGG + Intronic
1075349371 10:121710276-121710298 ACAGCAGGCCAAACAGGGCAGGG - Intergenic
1076162323 10:128254790-128254812 GCAGCAGGAGAAGCAGGTCAGGG - Intergenic
1076921283 10:133455952-133455974 GCTGCAGACCCAGGAGGACAGGG + Intergenic
1077018688 11:407898-407920 GCAGCAGGGCCAGCAGGACCAGG + Exonic
1077180103 11:1208476-1208498 GGGGCAGGCCGAGCAGCAGAGGG - Intergenic
1077463308 11:2721751-2721773 GCTGCAGGCCAGGCAGGCCGAGG - Intronic
1077663939 11:4091986-4092008 GAGGCAGGGCAGGCAGGCCATGG - Exonic
1077881966 11:6357992-6358014 GCGGCAGGGGGAGCAGGGCAAGG - Intergenic
1078191540 11:9095561-9095583 GCAGCGGGCCGAGCAAGACATGG + Intronic
1083901992 11:65647643-65647665 GCGGCCGGCCCCGCAGGTCAGGG + Exonic
1083913958 11:65727988-65728010 GTAGCAGGCCAAGCAGGACCTGG + Intergenic
1083913963 11:65728009-65728031 GGCGCCGGCCAAGCAGGACCTGG + Intergenic
1084029549 11:66473332-66473354 GCGGCAGGCATAGCGGGAGATGG - Exonic
1084518950 11:69651171-69651193 GCGCCAGGCCCAGCAGAACATGG + Exonic
1084540214 11:69781904-69781926 GTGGAAGGCCAAGAAGGAAAGGG + Intergenic
1084792086 11:71481334-71481356 GCTGCAGGGCAATCAGAACATGG - Exonic
1086416938 11:86598122-86598144 GCGCCAGCCGAAGCAGGGCAAGG + Intronic
1088844877 11:113656771-113656793 GCGCCAGCCGAAGCAGGGCAAGG + Intergenic
1089599214 11:119603204-119603226 GGAGCGGGCCAAGCAGGACATGG - Intergenic
1089644593 11:119870387-119870409 GCAGCAGGCCAAGCAGGTTTGGG - Intergenic
1091632934 12:2176070-2176092 GAGGAAAGCAAAGCAGGACAGGG + Intronic
1091709284 12:2726403-2726425 GAGGATGGCCATGCAGGACAAGG + Intergenic
1092183464 12:6461903-6461925 GGGACAGGACAAGCAGGCCAAGG + Intronic
1094480536 12:30877749-30877771 GGGGCAGGGAAAGCAGGGCAGGG + Intergenic
1096181909 12:49555828-49555850 GAGGGAGGCCAGGCAGGGCAGGG + Exonic
1096302206 12:50440024-50440046 GTGGGAGGCCAGGCAGGAAAAGG + Intronic
1096518717 12:52172298-52172320 GCAGCAGGCCAAGCAGGACATGG - Exonic
1096531513 12:52245510-52245532 GCAGCGGGGCAAGCAGGATATGG + Exonic
1096532769 12:52252361-52252383 GCAGAAGGCCAAGCAGGACATGG - Intronic
1096537925 12:52287202-52287224 GCAGAAGGCCAAGCAGGACATGG - Exonic
1096540846 12:52306158-52306180 GCAGAAGGCCAAGCAGGACATGG + Exonic
1096542525 12:52315993-52316015 GCAGAAGGCCAAGCAAGACATGG - Exonic
1096547419 12:52350211-52350233 GCAGAAGGCCAAGCAGGACATGG + Intergenic
1096549391 12:52362351-52362373 GCAGAAGGCCAAGCAGGACATGG - Exonic
1096552199 12:52380463-52380485 GCAGCAGGCCAAGCAGGACATGG - Exonic
1096554700 12:52396112-52396134 GCAGAAGGCCAAGCAGGACATGG - Exonic
1096557779 12:52414061-52414083 GCAGAAGGCCAAGCAGGACATGG - Intergenic
1096559855 12:52428356-52428378 GCAGAAGGCCAAGCAGGACATGG - Exonic
1096562670 12:52447878-52447900 GCAGAAGGCCAAGCAGGACCTGG - Exonic
1096564840 12:52469770-52469792 GCAGAAGGCCAAGCAGGACCTGG - Exonic
1096565437 12:52473787-52473809 GAGGCAGGAGAAGCAGGACAAGG + Intergenic
1096566760 12:52488428-52488450 GCAGAAGGCCAAGCAGGACCTGG - Exonic
1096569948 12:52516737-52516759 GCAGAAGGCCAAGCAGGACATGG - Exonic
1096584430 12:52610715-52610737 GCAGCAGGCCAAGGAGGAGCTGG - Exonic
1096589302 12:52646840-52646862 GCAGCAGGCCAAGGAGGACTTGG - Exonic
1096593258 12:52676375-52676397 GCAGCAGGCCAAGGAAGACCTGG - Exonic
1096598932 12:52715677-52715699 GCGGCAGGCCAAAGAGGACCTGG - Intergenic
1096603390 12:52746687-52746709 GCAGCAGGCCAGGGAGGACCAGG - Intergenic
1096611928 12:52807744-52807766 GCAGCAGGCCAAGGAGGAGCTGG - Exonic
1096626424 12:52898779-52898801 GCAGCGGGCCAAGCAGGACATGG - Exonic
1097615581 12:61880402-61880424 GCAGTGGGCCAAGCAGGACATGG + Intronic
1097904923 12:64909930-64909952 GCGGCAGGCCCTGCAGTACCAGG - Intergenic
1098264713 12:68706702-68706724 TGGGCGGGCCAAGCAGGACATGG + Intronic
1098294569 12:68991207-68991229 GCGGAAGCCGAAGCAGGGCAAGG + Intergenic
1100176951 12:92041828-92041850 GCAGCTGGCCATGCAGGAGATGG + Intronic
1100727755 12:97427015-97427037 GCAGGAGGAAAAGCAGGACAGGG - Intergenic
1101833179 12:108275091-108275113 GTGGCATGGCAAGCAGCACAGGG + Intergenic
1102730731 12:115106560-115106582 GTGGAAGGCCAAGCATGCCACGG - Intergenic
1103331935 12:120160171-120160193 GCTGCAGGCCCAGCTAGACAGGG - Exonic
1103927428 12:124430685-124430707 GCGGCGGGCCAAGGAGAGCAAGG - Exonic
1104902484 12:132197006-132197028 CCGGCAGACACAGCAGGACAGGG - Exonic
1111674211 13:91367122-91367144 ACTGCAGGCCAAGTAGGATATGG - Intergenic
1112317647 13:98377833-98377855 GCTGCAGGTGAAGCAGGACTTGG + Exonic
1113017226 13:105841151-105841173 GCGGCAGGCCAAGGAAAACCAGG - Intergenic
1113594338 13:111520732-111520754 GGGGAAGGCCAAGCTGGGCAGGG - Intergenic
1114540246 14:23450123-23450145 GCAGAAGGCAAAGCAGGAGAAGG - Intergenic
1116326892 14:43541225-43541247 ACAGCGGGCCAAGCAGGACTTGG - Intergenic
1118292895 14:64541821-64541843 GCGCGACGCCAAGCTGGACAAGG + Exonic
1118594030 14:67422262-67422284 GGGGAAGGCAAGGCAGGACAAGG - Intergenic
1118880320 14:69820044-69820066 GCGGTAGGCAGAGCTGGACATGG + Intergenic
1119741117 14:77014295-77014317 GCTCCAGTCCAAGCAGAACAGGG + Intergenic
1120953532 14:90062343-90062365 GCGCCAGGCCAAGCAGCGCTGGG + Exonic
1121215550 14:92244881-92244903 GTGGCAGCCCAAGCAGTACTTGG + Intergenic
1121530764 14:94651630-94651652 GAGGGAGGGCAAGCAGGGCAGGG + Intergenic
1122288762 14:100668270-100668292 GAGGCAGACCAAGATGGACAGGG + Intergenic
1122302203 14:100737625-100737647 GCTGCAGGGCAGGCAGGACGAGG + Exonic
1122540790 14:102496714-102496736 GCAGGAGGCCAAGAAGGGCAGGG - Intronic
1122598554 14:102909526-102909548 GCCACAGGCCAAGAAGGGCACGG - Exonic
1122816799 14:104318085-104318107 GGGCCAGGCCACTCAGGACAAGG - Intergenic
1122822941 14:104356204-104356226 ATGGCAGGGGAAGCAGGACATGG - Intergenic
1123056431 14:105572740-105572762 GCTGCAGCCTCAGCAGGACAGGG - Intergenic
1123057502 14:105579067-105579089 GCTGCAGCCTCAGCAGGACAGGG + Intergenic
1123080864 14:105692868-105692890 GCTGCAGCCTCAGCAGGACAGGG - Intergenic
1123081777 14:105699000-105699022 GCTGCAGCCTCAGCAGGACAGGG + Intergenic
1123435281 15:20249712-20249734 GGTGCAGGCCAGGCATGACAGGG - Intergenic
1123726853 15:23111869-23111891 AAGGCAGGACAGGCAGGACATGG - Intergenic
1123834820 15:24178531-24178553 GTGGCAGGCCATGAAGGAGATGG + Intergenic
1123854514 15:24394195-24394217 GTGGCAGGCCATGAAGGAGATGG + Intergenic
1123870539 15:24567378-24567400 GTGGCAGGCCATGAAGGAGATGG + Intergenic
1126467329 15:48972984-48973006 GCAGCGGGCCAAGCAGGACATGG + Intergenic
1129597916 15:76979350-76979372 GCGGCAGGCCAAGCAGGACATGG - Intergenic
1130064641 15:80593775-80593797 GCGGCAGGGCAAGCAGGGCGAGG - Exonic
1131017077 15:89066761-89066783 GCGGCAGGCCAAGAGAGCCACGG + Intergenic
1132535520 16:477555-477577 GCGGGACGCCAGGCAGGAAAAGG - Intronic
1133488138 16:6240116-6240138 GCGGAAGGTGAAGCAGGACATGG - Intronic
1134626602 16:15726955-15726977 GGGCCAGGCCAAGCAGGAGGTGG - Exonic
1136049038 16:27637664-27637686 GAGGCAGGGCGATCAGGACAGGG + Intronic
1136849326 16:33601260-33601282 GGTGCAGGCCAGGCATGACAGGG + Intergenic
1138350483 16:56343973-56343995 GCGGCAGGCCAGGCAGGGCAAGG - Exonic
1138516159 16:57536452-57536474 GCGGCAGGCCAAGGCGGCCCGGG - Intronic
1138558962 16:57788695-57788717 GCAGCAGGCCCTGCAGGACAAGG - Intronic
1140753706 16:78048796-78048818 ACAGCCGGCCAAGCGGGACATGG - Intronic
1141775787 16:86121841-86121863 GCGGCGGGACAAGCAGGAGGAGG - Intergenic
1203111033 16_KI270728v1_random:1449910-1449932 GGTGCAGGCCAGGCATGACAGGG + Intergenic
1142699201 17:1649268-1649290 GCGGCAGCTCAAGGAGGTCACGG - Exonic
1142848352 17:2692664-2692686 GCTGCTGGCGAAGCAGTACAGGG + Exonic
1143016789 17:3895118-3895140 CTGTCAGGCCAAGCAGGATATGG + Intergenic
1144607804 17:16683470-16683492 GCGGCAGGGCAAGGCGGCCAAGG - Intergenic
1144852004 17:18248549-18248571 GCCGCAGCCCAAGCTGTACAAGG - Exonic
1145197030 17:20902686-20902708 GCGGCAGGGCAAGGCGGCCAAGG + Intergenic
1145214722 17:21042916-21042938 GCGGCTGGCCAGGCTGGCCAAGG + Exonic
1146458022 17:33022167-33022189 GTGGCAAGCCAAGCAAGAGAAGG - Intronic
1146673083 17:34755456-34755478 GATGCAGGACCAGCAGGACAAGG + Intergenic
1146914857 17:36672024-36672046 GGAGCAGGCCTGGCAGGACATGG + Intergenic
1148269048 17:46249436-46249458 GGGCCAAGTCAAGCAGGACAAGG - Intergenic
1151290420 17:73145999-73146021 GAGGCAGGCCAACCAGGAGCAGG - Intergenic
1151479504 17:74361923-74361945 GAGGGAGGCCAAGCAGGAAGGGG - Exonic
1152251892 17:79216707-79216729 GTGCCCGGTCAAGCAGGACAGGG - Intronic
1152621480 17:81367073-81367095 GTGACAGTCCAAGCAGGACCTGG + Intergenic
1155155221 18:23151873-23151895 GCTGTGGGCCAGGCAGGACATGG + Intronic
1156221333 18:35055298-35055320 GCTGCAAGCCAAGGAGCACATGG - Intronic
1157063546 18:44321135-44321157 GTAGCAGGCCAAGCAGGATATGG - Intergenic
1160826175 19:1081545-1081567 GTGGCAGGCCAGGCAGCACTGGG - Exonic
1160908929 19:1465967-1465989 GCGGCATGGCGAGCAGGACTGGG - Exonic
1161217042 19:3099746-3099768 GCGGGAGGCCAGGCTGGACCAGG - Intronic
1161314669 19:3612357-3612379 CCGGCGGGCCAAGGAGGGCATGG - Exonic
1161814420 19:6490873-6490895 TCAGCAGGCCAAGGAGGTCAAGG - Intergenic
1162494764 19:11017552-11017574 GAGGCAGGACAAGCAGCTCATGG - Intronic
1162734226 19:12737083-12737105 GAGTCAGGCCAAGGAGGACCGGG + Intergenic
1162969538 19:14171893-14171915 GGGCTAGGCCAGGCAGGACACGG + Intronic
1163243268 19:16076932-16076954 GGGGCCGGCCAAGCGGGAAATGG + Intronic
1166214448 19:41326088-41326110 GCAGCAGGCAAGGCAGGGCAGGG - Intronic
1167272161 19:48511694-48511716 GGGGCAGGAGACGCAGGACAGGG + Intronic
1167571823 19:50293259-50293281 GCGGCAGGCCCAGCAGGACCGGG + Exonic
1168707798 19:58479782-58479804 GCAGCAGGCCTAGCTGGGCAGGG + Intronic
925398950 2:3558204-3558226 GCGGCAGGGCAAGGCGGCCAAGG + Exonic
925539458 2:4951400-4951422 GCGGAAGGCAAAGCAGGAACAGG + Intergenic
927154412 2:20213292-20213314 GGGCCAGGCCAGGCAGGGCAAGG + Intronic
927853315 2:26513326-26513348 GAAGCAGGCCAGGCAGGGCAGGG + Intronic
928122163 2:28591231-28591253 GGGACAGGCCCAACAGGACAGGG + Intronic
929996309 2:46828249-46828271 GAGGCAGGACAAGGAGGACGAGG - Intronic
932363424 2:71129873-71129895 CCGGCAGGTCAGGCAGGGCAGGG - Intronic
934117051 2:88808318-88808340 GTGGCAGGCAAGGCAGGGCAGGG + Intergenic
935063807 2:99631050-99631072 GAGGCAGGCAGAGCAGAACACGG + Intronic
937219680 2:120335302-120335324 GCAGCAGGCCCAGCAAGTCATGG - Intergenic
938017484 2:127879405-127879427 GCGGAAGGCAAAGCAGGAGCGGG - Intronic
938398548 2:130968328-130968350 GGGGCAGGCCAGGAAGGAAATGG + Intronic
939402667 2:141714735-141714757 CAGACAGGCCAAGTAGGACAGGG + Intronic
942190597 2:173465212-173465234 GCTGCAGGCCACGCAGGAAAAGG - Intergenic
942558656 2:177198181-177198203 GCAGCGGGCCAAGCAAGACATGG + Intergenic
942642220 2:178072335-178072357 GCGGAAGGGGAAGCAGGAGATGG - Exonic
943064423 2:183071390-183071412 GCAGCAAACCAAGCAGGACGTGG - Intergenic
944564001 2:200969203-200969225 GGGACAGGCCAAGAAGTACAAGG + Intergenic
944763435 2:202840681-202840703 GCAGCGGGCCAAGCAGGACATGG - Intronic
945920440 2:215749804-215749826 GCGCCACTCCATGCAGGACAAGG - Intergenic
946152555 2:217786078-217786100 GAGGCAGACGAAGCTGGACAAGG - Intergenic
946320870 2:218953740-218953762 GCAGCGGGCCAAGCAGGACATGG - Intergenic
948626035 2:239268620-239268642 CCTGCAGGCCAAGGAAGACAGGG + Intronic
948857221 2:240735741-240735763 GCGGCAGGAGAAGCAAGGCACGG + Intronic
948908185 2:240989761-240989783 GCCGCAGGCCACGCAGGCCCTGG + Intronic
1170552562 20:17490151-17490173 GCAGCTGGCTAAGCAGGACCTGG + Intergenic
1170712417 20:18803664-18803686 GCAGCTGGCCAAGAAGCACATGG - Intergenic
1171056989 20:21916697-21916719 GCGGCAGCCGAAGCAGGGCGAGG - Intergenic
1171246183 20:23611599-23611621 GCAGGAGGCCCAGCAGGACCAGG + Intergenic
1171309712 20:24136268-24136290 ATGCCAGGCCAAGCAGGAAAGGG + Intergenic
1172082142 20:32350556-32350578 GGGGCAGGGAAAGCAAGACAGGG - Intergenic
1172846120 20:37930876-37930898 GCGGCAGCTCCAGGAGGACAGGG - Intronic
1173433588 20:43012920-43012942 GAGGCAGGTCAAGCAGGTGAGGG - Intronic
1173665984 20:44763392-44763414 GCAGCAGGCCCAGCAGGCCATGG - Intronic
1175089301 20:56488837-56488859 GCGACAGGCCAGGGAGGCCAAGG - Intronic
1175668247 20:60878724-60878746 GCAGAAGGCCAGGCAGGGCATGG - Intergenic
1175803113 20:61812336-61812358 CCGGCAGGCCCAGCAGCCCAGGG - Intronic
1176641671 21:9310399-9310421 GCTGGAGGCCATGCAGGGCACGG + Intergenic
1180350687 22:11799755-11799777 GCTGGAGGCCATGCAGGGCATGG + Intergenic
1180387522 22:12192327-12192349 GCTGGAGGCCATGCAGGGCACGG - Intergenic
1180757081 22:18169613-18169635 GCGGAAGGCCAAGCAGGAGCAGG - Intronic
1180875960 22:19175377-19175399 GCGCCAGGCCAAGAAGGATCTGG - Intergenic
1181074697 22:20367852-20367874 GCGGAAGGCCAAGCAGGAGCAGG + Intronic
1181326207 22:22049091-22049113 GGGGGAGCCCCAGCAGGACATGG - Intergenic
1181615967 22:24054653-24054675 GCGGCAGCCAAAGCTGGACCAGG - Intronic
1182623660 22:31630969-31630991 GCGGACGGCCCAGCAGGACTGGG - Intronic
1183184841 22:36285905-36285927 GCGCCAGGCCCAGCAGGAGCGGG - Exonic
1184432944 22:44452222-44452244 GCGGAAGGCAAAGCAGGAGCCGG - Intergenic
1184761274 22:46546037-46546059 GCGGGGGGCCAGGGAGGACAAGG - Intergenic
950848203 3:16035349-16035371 ACCAAAGGCCAAGCAGGACAAGG - Intergenic
950877474 3:16289280-16289302 GTGGCAGGCCAGGCAGGAGTGGG + Intronic
951124149 3:18963648-18963670 GCGCCAGCCGAAGCAGGGCAAGG - Intergenic
952611534 3:35216052-35216074 GCAGCGGGCCAAGCAGGACATGG - Intergenic
953406638 3:42663136-42663158 CGGGCAGGCCAGGCAGGAGATGG - Intronic
954225481 3:49178171-49178193 GAGGCAGGCCAAGGAGGCCAGGG - Intronic
954812331 3:53255888-53255910 GCTGCAGGCCTTGAAGGACACGG - Exonic
955839469 3:63096722-63096744 GCAGCGGGCCAAGCAGGACATGG - Intergenic
957018575 3:75097829-75097851 GCGCGAGCCCAAGCAGGACGAGG - Intergenic
957410915 3:79838532-79838554 GCGGCAGCACAAGCATCACATGG - Intergenic
957966187 3:87324343-87324365 GCAGTGGGCCAAGCAGGACATGG + Intergenic
959409937 3:106008407-106008429 GAGGCAGGCTAAGAATGACAGGG + Intergenic
960239018 3:115318286-115318308 GCGGGAGCCGAAGCAGGGCAAGG - Intergenic
960926792 3:122802214-122802236 GCGACAGGCAGGGCAGGACAGGG + Intronic
962134709 3:132721992-132722014 CCGCGAGGCCAAGCTGGACACGG - Exonic
962712805 3:138101831-138101853 GCAGCGGGCCAAGCAGGACATGG - Intronic
964407442 3:156364112-156364134 GTGGCATGCCAAGGAGGGCATGG + Intronic
964478275 3:157116802-157116824 GATGCTGACCAAGCAGGACATGG - Intergenic
965605789 3:170496511-170496533 GCAGCGGGCCAAGCAGGACATGG + Intronic
967168718 3:186806865-186806887 GAAGCAGGACAAGGAGGACAGGG - Intronic
967858826 3:194136966-194136988 GCGGCATTCCAAGCTGGAGAAGG + Exonic
1202745223 3_GL000221v1_random:94619-94641 GCTGGAGGCCATGCAGGGCACGG - Intergenic
968554178 4:1238929-1238951 GCGGTAGCCCAGGCAGGAAAGGG - Intronic
968905227 4:3447742-3447764 GGGGCAGGGCAGGGAGGACAGGG + Intronic
969348677 4:6585200-6585222 GAGCAAGGCCAAGCAAGACAGGG - Intronic
971306635 4:25488212-25488234 GAAGCAGGACAAGCAGGACGTGG + Intergenic
972672619 4:41227973-41227995 CCCGCAGGCCAAGCAAGAAAAGG + Intergenic
972850445 4:43042598-43042620 GCGAAAGGCCAAGCAGGAGCAGG - Intergenic
975689107 4:76948359-76948381 GAGGCAGGGCCAGCGGGACAGGG + Intergenic
977928661 4:102729072-102729094 GCAGCAGGCCAAGCAGGACATGG - Intronic
981660614 4:147162218-147162240 GCAGTAAGCCAAGCTGGACATGG - Intergenic
981957998 4:150502731-150502753 GCGTGAGGCGAAGCAGGGCAAGG + Intronic
983540741 4:168906970-168906992 CCGGCAGGCCATGCAGTACAGGG + Intronic
983704294 4:170639390-170639412 GCGCCAGCCGAAGCAGGGCAAGG + Intergenic
983896345 4:173085438-173085460 GCAGAATGCCAAGCAGGAGAGGG + Intergenic
984364857 4:178785374-178785396 CTGGCAGGCCAAGCAGGAGGAGG + Intergenic
985636636 5:1038897-1038919 GCAGGAGGCCAAGCAGCAGAAGG + Exonic
985703323 5:1386590-1386612 GCAGCCGGCCAGGGAGGACAGGG - Intergenic
986008031 5:3684344-3684366 ACAGCAGGCCAGTCAGGACAGGG - Intergenic
987115886 5:14726412-14726434 GAGGCAGGGCAAGCAGGGGAAGG + Intronic
987307273 5:16649154-16649176 GCACCAGGCGAAGCAGGGCAAGG - Intergenic
987336605 5:16902913-16902935 GTGCCAGGCCCAGAAGGACATGG + Intronic
987424291 5:17755573-17755595 GCGCCAGCCAAAGCAGGGCAAGG - Intergenic
989617796 5:43354970-43354992 GCCCCAGGCAAAGCAAGACAGGG - Intergenic
990002688 5:50912923-50912945 GCGGAAGGCAAAGGAGGACTGGG - Intergenic
990900479 5:60743905-60743927 GCAGTGGACCAAGCAGGACATGG - Intergenic
991932270 5:71765536-71765558 GGAGCAGGGGAAGCAGGACAGGG + Intergenic
996432899 5:123401242-123401264 GCAGCGGGCCAAGCAGGACATGG - Intronic
998131132 5:139651502-139651524 GAGGCAGGCAGAGCAGGAAAGGG - Intronic
998166594 5:139847928-139847950 CCCGCGGGCCAAGCAGGACTCGG - Exonic
998682583 5:144486812-144486834 ACAGAAGGCCAAGCAGGAGAAGG + Intergenic
998887166 5:146706525-146706547 TCAGCAGACCAAGTAGGACATGG - Intronic
999338212 5:150742999-150743021 GCGCCAGCCGAAGCAGGGCAAGG + Intronic
1001513876 5:172341501-172341523 GCGGAAGGCAAAGCAGGAGTAGG - Intronic
1002000010 5:176192156-176192178 GAGGCAGGGGAGGCAGGACAGGG - Intergenic
1002312435 5:178323021-178323043 GAGGGAGGCTAAGCAGGACGGGG + Intronic
1002455861 5:179345121-179345143 GCGGCGGGGCACGCGGGACAGGG + Intronic
1003060224 6:2857238-2857260 GCTGCAGCCCAAGGAAGACATGG + Intergenic
1003566760 6:7229188-7229210 GCTGCAGGCCAAGCAAGGCCAGG - Exonic
1004279411 6:14268383-14268405 GTGGCTGGCCAAGGGGGACATGG - Intergenic
1004516705 6:16327347-16327369 GCAGCAGGCCATCCAGGCCAAGG - Exonic
1005315517 6:24599432-24599454 GCAGTGGGCCATGCAGGACATGG + Intronic
1005426701 6:25710372-25710394 GTGGCAGGCCAAGAAGGTCTTGG + Intergenic
1005619814 6:27609402-27609424 GCAGCAGGCCAAGTAATACATGG + Intergenic
1006122674 6:31816719-31816741 GCGCGACGCCAAGCTGGACAAGG + Exonic
1006124537 6:31828913-31828935 GCGCGACGCCAAGCTGGACAAGG + Exonic
1006465367 6:34190847-34190869 GCGCCAGGCCCAGGAGTACAAGG + Intergenic
1007394596 6:41570371-41570393 GTGTCAGGCCAAGGAGGAAAGGG - Intronic
1007521288 6:42453034-42453056 GCGGCAGGCGCAGCAGGCCGGGG + Intergenic
1007690556 6:43698406-43698428 GCTGCAGGGCAGGCAGGACAGGG + Intergenic
1009476474 6:64097715-64097737 GCGTCAGCCAAAGCAGGGCAAGG - Intronic
1009499150 6:64389923-64389945 GCGCCAGCCGAAGCAGGGCAAGG + Intronic
1010107147 6:72182923-72182945 GCGGAAGGCCAAGCGCGAGAAGG + Exonic
1012475676 6:99613370-99613392 GGGGCAGCCCAAGAAGGGCAAGG + Exonic
1012682298 6:102197230-102197252 AAGGCATGCCCAGCAGGACATGG - Intergenic
1015539180 6:134297322-134297344 GCAGCGGGCCTAGCAGGACATGG - Intronic
1017396870 6:154010969-154010991 GTGGCAGGAGAAGCAGCACAAGG + Exonic
1017596464 6:156034298-156034320 GCGCCAGCCGAAGCAGGGCAAGG + Intergenic
1018317272 6:162569356-162569378 GCAACAGGCCATGCAGGACATGG + Intronic
1018708181 6:166478061-166478083 GGGGGAGGCCAAGCAGGGGAGGG + Intronic
1019542213 7:1556481-1556503 GCGGCAGGCCAAGGAGGGCCGGG + Intronic
1019737927 7:2659648-2659670 GCGGCCGGGCTACCAGGACAGGG + Intronic
1021638554 7:22715198-22715220 GAGGCAGGCCAAGCAGGAAGGGG + Intergenic
1021952324 7:25787318-25787340 GAGGCAGGACATACAGGACAAGG - Intergenic
1022437447 7:30403079-30403101 GCAGCAGGCAAAGCAGGAGCAGG - Intronic
1022439352 7:30420321-30420343 GCGCCAGCCAAAGCAGGGCAAGG - Intergenic
1023289665 7:38656273-38656295 GCAGCTAGCCAAGCAGGACATGG + Intergenic
1024213475 7:47227321-47227343 TGGGAAGGCCCAGCAGGACAGGG - Intergenic
1024251297 7:47507716-47507738 CAGGCAGGCCTTGCAGGACAGGG + Intronic
1025988306 7:66474732-66474754 CCGGCTGGCCAAGCCAGACACGG + Intergenic
1027342144 7:77221006-77221028 GCGGAAGGCAAAGCAGGAGCAGG + Intronic
1027935801 7:84600411-84600433 GTGGAAGGCAAAGCAGGACCAGG - Intergenic
1033843509 7:145403705-145403727 GCAGCAGCCCAAGCTGTACATGG - Intergenic
1035006260 7:155663404-155663426 GTGGAAGGCCAAGCAGGAACAGG + Intronic
1035258034 7:157644403-157644425 ACGGCAGCCCCAGCAGGCCAGGG + Intronic
1035327687 7:158075507-158075529 GCAGCAGGTCCAGCAGGAGACGG + Intronic
1035352956 7:158259288-158259310 CAGGCAGGCCACGCAGGACACGG + Intronic
1035918073 8:3646803-3646825 GAGGCAGGGGAAGCAAGACAGGG - Intronic
1037845012 8:22275418-22275440 GCGGCATGCCAGGCAGGCCAGGG + Intronic
1038948276 8:32385553-32385575 GCGGAAGGCAAAGGAGGAGAAGG + Intronic
1038998277 8:32950571-32950593 GCAGCAGGCCAAGGAGGAGCAGG + Intergenic
1039156467 8:34564240-34564262 GCGGAAGGCAAAGCAGGAGCAGG - Intergenic
1041327174 8:56680524-56680546 GCGGTATGCCAACCTGGACATGG + Intergenic
1041781154 8:61579299-61579321 GCAGCGGGCCAAGCAGGACATGG + Intronic
1042410436 8:68459964-68459986 GCGCGAGCCGAAGCAGGACAAGG + Intronic
1044199048 8:89412966-89412988 GCAGTGAGCCAAGCAGGACATGG - Intergenic
1044530271 8:93299674-93299696 GAGGCAGGCCAATCAGCACCTGG + Intergenic
1046262432 8:111786539-111786561 GCAGCAGGCCCAGTAGGAGATGG + Intergenic
1047497562 8:125419460-125419482 GGGTCAGGCCACACAGGACAAGG + Intergenic
1048345708 8:133572664-133572686 GCGGCAGGCGAGCCAGGGCAAGG - Intergenic
1049159739 8:141089574-141089596 GCGTCACGCCATGCAGGAAATGG + Intergenic
1049336691 8:142090305-142090327 ACGGCAGGCCCCGCTGGACATGG + Intergenic
1049731417 8:144180480-144180502 GGGCGTGGCCAAGCAGGACACGG + Exonic
1051553887 9:18360906-18360928 GCGGCAGGGAAAGCAGGAGATGG - Intergenic
1056388564 9:86119422-86119444 GCGGCAGGCCAGGCACTGCAGGG + Intergenic
1056617020 9:88177521-88177543 GCGGGAGGGCATGCAGGAGAAGG + Intergenic
1057398098 9:94698199-94698221 ACTGCAGGCCAAGCAGAATATGG + Intergenic
1057723507 9:97552393-97552415 GAGGAAGACAAAGCAGGACAAGG - Intronic
1058755632 9:108080518-108080540 GAGGCAGGCCAGGCAGGAAGAGG - Intergenic
1060809926 9:126605884-126605906 GAGGTAGGCCAAGGAGAACAGGG + Intergenic
1061132058 9:128713814-128713836 GAGGCAGGGCAGTCAGGACAAGG - Intronic
1061329100 9:129881100-129881122 GGGGCAGGCTCAGCAGGACGCGG - Exonic
1061684926 9:132267800-132267822 AGGGCAGCCCAAGGAGGACATGG - Intronic
1062130859 9:134892364-134892386 GGGGCAGGCCAGGCAGGGCTAGG - Intergenic
1062333082 9:136053066-136053088 GCAGCTGGCCAAGCAGGAGGGGG - Intronic
1062381872 9:136290638-136290660 GCGGCAGGCCCTGGAGGAGAAGG - Exonic
1203713847 Un_KI270742v1:124570-124592 GCTGGAGGCCATGCAGGGCACGG - Intergenic
1186316988 X:8381895-8381917 GAGGCTGGCCACGCAGGAGACGG + Intergenic
1187820148 X:23278492-23278514 TTGGCAGGCCAAGCAAGACCAGG + Intergenic
1189466439 X:41281185-41281207 GCGGCATTCCAGGCAGGACAGGG + Intergenic
1189893773 X:45632637-45632659 GCAGCGGGCCAAGCAGGACATGG - Intergenic
1190055570 X:47179392-47179414 GCGGCAGGGGAAGCAGGCCCTGG - Exonic
1191220776 X:57985761-57985783 GCAGCGGGCCAAGCAGGACATGG + Intergenic
1191758733 X:64624203-64624225 GCAGTGGGCCAAGCAGGATATGG + Intergenic
1196547182 X:116975807-116975829 GCAGCAGTCCAAGTAGTACATGG - Intergenic
1197812244 X:130455556-130455578 GCGGAAGGCAAAGCAGGAGCAGG - Intergenic
1198619199 X:138488010-138488032 GCAGGGGGCCAACCAGGACATGG - Intergenic
1198904225 X:141542930-141542952 GCGTGAGCCCAAGCAGGGCAGGG - Intergenic
1198999967 X:142624140-142624162 GCGGAAGGCAAAGCAGGAGCAGG + Intergenic
1199441798 X:147877018-147877040 GCGGGAGGCAACACAGGACAAGG - Intergenic
1199927280 X:152480652-152480674 GCAGCGGGCCAAGCAGGACATGG + Intergenic
1200231031 X:154444006-154444028 GCGGGAGTCCACGCAGGACCAGG + Intergenic
1201244960 Y:11994294-11994316 GTGGCAGCCAAAGCAGGGCAAGG - Intergenic