ID: 1129597919

View in Genome Browser
Species Human (GRCh38)
Location 15:76979356-76979378
Sequence CGCCCTGCGGCAGGCCAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 3, 2: 17, 3: 46, 4: 276}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129597919_1129597927 5 Left 1129597919 15:76979356-76979378 CCTGCTTGGCCTGCCGCAGGGCG 0: 1
1: 3
2: 17
3: 46
4: 276
Right 1129597927 15:76979384-76979406 CAGCTCGGACAACTTGGCATTGG 0: 1
1: 4
2: 11
3: 15
4: 73
1129597919_1129597923 -10 Left 1129597919 15:76979356-76979378 CCTGCTTGGCCTGCCGCAGGGCG 0: 1
1: 3
2: 17
3: 46
4: 276
Right 1129597923 15:76979369-76979391 CCGCAGGGCGGCCTCCAGCTCGG 0: 1
1: 7
2: 18
3: 29
4: 184
1129597919_1129597924 -1 Left 1129597919 15:76979356-76979378 CCTGCTTGGCCTGCCGCAGGGCG 0: 1
1: 3
2: 17
3: 46
4: 276
Right 1129597924 15:76979378-76979400 GGCCTCCAGCTCGGACAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129597919 Original CRISPR CGCCCTGCGGCAGGCCAAGC AGG (reversed) Intergenic
900305147 1:2002624-2002646 CGCCCTGCTGCATTCCAACCTGG + Intronic
901012459 1:6209452-6209474 CGCGCTGCTGCAGGCCATGGTGG + Exonic
901417580 1:9128426-9128448 TGCCCTGGGGCAGGCACAGCGGG + Intronic
901480385 1:9520904-9520926 CACACTGAGGCAGGCCAGGCTGG + Intergenic
901843183 1:11966343-11966365 CCCCCTGCAGCAGGCAAGGCTGG - Intronic
902334585 1:15747624-15747646 CTCCCTGAGGCAGGTCAAGAGGG - Exonic
902449313 1:16486517-16486539 GGCCCTGCTGCAGGCCCAGCTGG - Intergenic
902505435 1:16936760-16936782 GGCCCTGCTGCAGGCCCAGCTGG + Exonic
903154416 1:21434426-21434448 GGCCCTGCTGCAGACCCAGCTGG + Intergenic
906223694 1:44103681-44103703 CGCCCTCCAGCCGGCCAAGCAGG - Intergenic
906343880 1:45003429-45003451 CGCCCTGGGCAAGGCCAAGAGGG + Exonic
906653869 1:47533706-47533728 CGGGCCGCGGCAGGCCAGGCGGG + Intergenic
906745199 1:48216596-48216618 GGCCCTGCAGCAGCCCTAGCTGG - Intergenic
907150844 1:52285905-52285927 AGCACTTTGGCAGGCCAAGCCGG + Intronic
907319957 1:53595938-53595960 AGCCATGGGGCAGGCCAGGCAGG + Intronic
907396053 1:54190764-54190786 GGCCGGGCCGCAGGCCAAGCTGG + Exonic
907884139 1:58577361-58577383 CGTCCCACGGAAGGCCAAGCCGG + Exonic
908851380 1:68380294-68380316 AGCACTTTGGCAGGCCAAGCTGG + Intergenic
909232290 1:73105906-73105928 CGCCGTGTAGCAGGCCAAGCAGG + Intergenic
912344558 1:108952549-108952571 AGCACTGTGGGAGGCCAAGCTGG + Intronic
913017462 1:114753668-114753690 AGCACTGTGGCAGGCCAAGGTGG + Intronic
913512133 1:119571659-119571681 GGCCCTGCGGGAGCCCAAGAAGG + Intergenic
913516362 1:119608831-119608853 GGCCCTGCGGGAGCCCAAGAAGG + Intergenic
914788632 1:150856190-150856212 CGCACTTCGGGAGGCCAAGGCGG + Intronic
915176747 1:154021980-154022002 AGCCCTTTGGGAGGCCAAGCTGG - Intronic
915619820 1:157074326-157074348 CGCCCTGCAGCGGGCCAAGCAGG + Intergenic
916120690 1:161525621-161525643 GGCCCTGCGGGATGCCAAGCTGG + Exonic
916130456 1:161607253-161607275 GGCCCTGCGGGATGCCAAGCTGG + Intronic
918226899 1:182492235-182492257 CGCACTTCGGGAGGCCAAGGCGG + Intronic
919104268 1:193129377-193129399 AGCACTGCGGGAGGCCAAGGCGG - Intronic
919458427 1:197847185-197847207 AGCACTTCGGGAGGCCAAGCGGG + Intergenic
920271057 1:204764042-204764064 TGCCCTGCTGCAGGCTGAGCCGG - Intergenic
920348340 1:205321339-205321361 CTCCCTGCCGGCGGCCAAGCCGG + Intronic
921010322 1:211134250-211134272 CGGCCTGCGGGAGACCAAGCTGG + Intergenic
923896925 1:238281176-238281198 AGCCCTTCGGGAGGCCAAGGCGG - Intergenic
1063707084 10:8440922-8440944 CACCCCACGGCAGGCCATGCAGG - Intergenic
1063714532 10:8514042-8514064 CGCCCTGCAGCGGGTCAAGCAGG - Intergenic
1064623106 10:17234731-17234753 CGCCCTGCGCCAGGCAAAGCAGG + Exonic
1065660261 10:27998866-27998888 CGCCCTGCGGCCGCGCACGCCGG + Intronic
1065786751 10:29222978-29223000 AGCCCTTCGGGAGGCCAAGGTGG + Intergenic
1066186907 10:33018711-33018733 AGCACTTTGGCAGGCCAAGCTGG + Intergenic
1067473223 10:46550580-46550602 CACCGTGTGGCAGGCCCAGCTGG - Exonic
1067567718 10:47350467-47350489 TGCCCTCCTGCGGGCCAAGCTGG + Exonic
1067848520 10:49740678-49740700 CGCTCTCCTGCAGGCCAGGCAGG - Intronic
1067991205 10:51214722-51214744 AGCACTTTGGCAGGCCAAGCGGG - Intronic
1069589028 10:69630536-69630558 CGGCCTGCGCCAGGGCCAGCGGG + Intronic
1069776284 10:70929139-70929161 CTCCCTGGGTCAGGCCATGCTGG - Intergenic
1070727572 10:78802794-78802816 CTCCCTGGGCCAGGCCAGGCAGG + Intergenic
1070825903 10:79390602-79390624 CGCCCAGTGGCAGGCCAAGCAGG - Intronic
1071610015 10:87023471-87023493 AGCCCTTCGGGAGGCCAAGGTGG + Intronic
1072117460 10:92377515-92377537 AGCACTGTGGCAGGCCAAGGCGG + Intergenic
1072290409 10:93959851-93959873 CACCCGGCTGCAGGCCCAGCAGG - Intergenic
1072355506 10:94605877-94605899 AGCCCTTTGGGAGGCCAAGCCGG - Intronic
1072377300 10:94830503-94830525 CACCCTGCGGGAGCCGAAGCAGG - Intronic
1072624016 10:97099331-97099353 CGACCTGAGGCAGGCCAGCCTGG - Intronic
1072949161 10:99837382-99837404 AGCACTGTGGCAGGCCAAGGTGG - Intronic
1074458003 10:113612347-113612369 CGCCCTGGTGCATGCCAAGAAGG - Exonic
1075372008 10:121945251-121945273 AGCACTGTGGGAGGCCAAGCGGG - Intergenic
1076243467 10:128927997-128928019 CCGCCTACGGCAGGCCAAGGGGG + Intergenic
1076475750 10:130750409-130750431 CGCCATGGGGCAGGGCAGGCAGG - Intergenic
1077158838 11:1103516-1103538 CGCCCTGGGGCAGGACATGGGGG - Intergenic
1078770520 11:14346905-14346927 AGCCCTGTGGGAGGCCAAGGTGG + Intronic
1079451964 11:20605540-20605562 CGCCCTGCGGAAAACCAAACGGG - Intronic
1080844845 11:36017769-36017791 AGCACTGTGGGAGGCCAAGCGGG - Intronic
1081625868 11:44654758-44654780 CGCCATGTGGCTGGCAAAGCTGG + Intergenic
1082816338 11:57512342-57512364 AGCACTGCGGGAGGCCGAGCCGG + Intronic
1083913955 11:65727982-65728004 TGCCCTGTAGCAGGCCAAGCAGG + Intergenic
1084274439 11:68044314-68044336 CGCCCTGCAGGAGGCCCTGCGGG + Exonic
1084440922 11:69172735-69172757 CTCCCTGTGGCAGCCCCAGCAGG - Intergenic
1086197495 11:84158308-84158330 AGCCCTTTGGGAGGCCAAGCTGG - Intronic
1086317672 11:85610733-85610755 CGACCTGCTGTAGGCAAAGCTGG - Intronic
1086653334 11:89319086-89319108 GGCCCTGCGCCAGCCGAAGCAGG - Intergenic
1088272962 11:108054091-108054113 AGCACTGCGGGAGGCCAAGGTGG - Intronic
1088834512 11:113566705-113566727 CGCCCTGAGGCAGGGGGAGCTGG - Intergenic
1089593570 11:119560482-119560504 AGCCCTGGGGCAGGCCAGGACGG + Intergenic
1089599217 11:119603210-119603232 CGCCCAGGAGCGGGCCAAGCAGG - Intergenic
1092860964 12:12718353-12718375 CACCCTCCAGCAGGCAAAGCGGG - Intronic
1092880136 12:12881786-12881808 CCCCCTGCCGCAGGCCAGGGTGG + Intergenic
1096073415 12:48788403-48788425 CACCCTGCGGCAGGCCTTGGGGG + Intronic
1096149022 12:49297186-49297208 GGCCCTGCGCCAGGCCAAGCAGG + Exonic
1096518720 12:52172304-52172326 CGCCCTGCAGCAGGCCAAGCAGG - Exonic
1096531510 12:52245504-52245526 CGCCCTGCAGCGGGGCAAGCAGG + Exonic
1096532772 12:52252367-52252389 TGCCCTGCAGAAGGCCAAGCAGG - Intronic
1096537928 12:52287208-52287230 CGCCCTGCAGAAGGCCAAGCAGG - Exonic
1096540843 12:52306152-52306174 TGCCCTGCAGAAGGCCAAGCAGG + Exonic
1096547416 12:52350205-52350227 CGCCCTGCAGAAGGCCAAGCAGG + Intergenic
1096549394 12:52362357-52362379 CGCCCTGCAGAAGGCCAAGCAGG - Exonic
1096552202 12:52380469-52380491 TGCCCTGCAGCAGGCCAAGCAGG - Exonic
1096554701 12:52396118-52396140 GGCTCTGCAGAAGGCCAAGCAGG - Exonic
1096557782 12:52414067-52414089 AGCCCTGCAGAAGGCCAAGCAGG - Intergenic
1096559858 12:52428362-52428384 GGCCCTGCAGAAGGCCAAGCAGG - Exonic
1096562673 12:52447884-52447906 TGCCCTGCAGAAGGCCAAGCAGG - Exonic
1096564843 12:52469776-52469798 TGCCCTGCAGAAGGCCAAGCAGG - Exonic
1096566763 12:52488434-52488456 TGCCCTGCAGAAGGCCAAGCAGG - Exonic
1096569951 12:52516743-52516765 GGCCCTGCAGAAGGCCAAGCAGG - Exonic
1096574860 12:52546392-52546414 CGCCCTGCACCAGGCCAAGGAGG - Exonic
1096578265 12:52568275-52568297 CGCCCTGCACCAGGCCAAGGAGG - Exonic
1096581381 12:52587737-52587759 CGCCCTGCACCAGGCCAAGGAGG - Exonic
1096584433 12:52610721-52610743 CGCCCTGCAGCAGGCCAAGGAGG - Exonic
1096589305 12:52646846-52646868 GGCCCTGCAGCAGGCCAAGGAGG - Exonic
1096595508 12:52692527-52692549 GGCCCTGCAGCAGTCCAAGGAGG - Exonic
1096603393 12:52746693-52746715 TGCCCTGCAGCAGGCCAGGGAGG - Intergenic
1096611931 12:52807750-52807772 TGCCCTGCAGCAGGCCAAGGAGG - Exonic
1096614317 12:52823122-52823144 GGCCCTGCACCAGGCCAAGGAGG - Exonic
1096626427 12:52898785-52898807 CGCCCTGCAGCGGGCCAAGCAGG - Exonic
1097615578 12:61880396-61880418 CGCCCTGCAGTGGGCCAAGCAGG + Intronic
1098261982 12:68681237-68681259 AGCACTTCGGGAGGCCAAGCTGG + Intergenic
1098857406 12:75668458-75668480 CGCCCTTTGGGAGGCCAAGGTGG - Intergenic
1100008185 12:89919774-89919796 CGCCCAGCGCCCGGCCAAGGAGG - Intergenic
1100423449 12:94459955-94459977 GGCCCAGCGGCACGCGAAGCAGG + Intronic
1100560885 12:95748716-95748738 AGCACTTCGGGAGGCCAAGCTGG - Intronic
1103090563 12:118095286-118095308 AGCACTTTGGCAGGCCAAGCCGG - Intronic
1104256784 12:127146363-127146385 CGCCCCGCGGCTCGCCAATCAGG + Intergenic
1111885335 13:94013595-94013617 AGCCCTTTGGGAGGCCAAGCCGG - Intronic
1114642466 14:24232686-24232708 CGCCCTGCCGCCGCCGAAGCTGG + Intronic
1116314491 14:43370423-43370445 CACCCTGCGCGAGCCCAAGCAGG + Intergenic
1116326895 14:43541231-43541253 TGCCCTACAGCGGGCCAAGCAGG - Intergenic
1116539735 14:46086296-46086318 AGCCCTTCGGGAGGCCAAGGTGG - Intergenic
1117276109 14:54195462-54195484 AGCACTGTGGCAGGCCAAGGCGG + Intergenic
1121334164 14:93066938-93066960 AGCCCTGCACCAGGCCAAACGGG + Intronic
1122829982 14:104391153-104391175 GGCCCTGAGGCGGGCCCAGCAGG + Intergenic
1122887009 14:104714649-104714671 CCCCCTGCAGCAGGCCCAGGTGG + Exonic
1122963413 14:105110692-105110714 AGCACTGTGGCAGGCCAAGGCGG - Intergenic
1123630894 15:22258859-22258881 CACCTTGTGGCAGGCCAGGCAGG - Intergenic
1123901412 15:24880922-24880944 AGCACTGCGGGAGGCCAAGGCGG - Intronic
1124631014 15:31337179-31337201 TGGCCTGCGGCAGGGCAGGCAGG + Intronic
1125546809 15:40512079-40512101 AGCCCTCCGGCAGGCAACGCCGG + Intergenic
1126332368 15:47546980-47547002 CTTCCTGATGCAGGCCAAGCTGG - Intronic
1126467326 15:48972978-48973000 CGCCCAGCAGCGGGCCAAGCAGG + Intergenic
1128204711 15:65840709-65840731 AGCACTTCGGGAGGCCAAGCTGG + Intronic
1128495901 15:68198302-68198324 CACCCTGGGGCAGGCCACGCTGG - Intronic
1128938785 15:71769997-71770019 AGCACTGTGGCAGGCCAAGGCGG + Intronic
1129292892 15:74582076-74582098 TGCCCAGTGGCAGGCAAAGCAGG + Intronic
1129597919 15:76979356-76979378 CGCCCTGCGGCAGGCCAAGCAGG - Intergenic
1129629294 15:77240370-77240392 AGCCCTGTGGGAGGCCAAGGTGG + Intronic
1129783121 15:78287832-78287854 CGCCCTGCTACAGGCCTAGATGG - Intronic
1130064644 15:80593781-80593803 GGGCCTGCGGCAGGGCAAGCAGG - Exonic
1131125783 15:89855599-89855621 AGCACTGTGGCAGGCCAAGGCGG + Intronic
1131152807 15:90057446-90057468 AGCACTTCGGGAGGCCAAGCTGG + Intronic
1132145522 15:99426989-99427011 CACCCTGCAGCAGGTCAGGCTGG + Intergenic
1132605729 16:792968-792990 CTCCCTGCGGCAGGGCATGAGGG + Exonic
1133986222 16:10670277-10670299 AGCACTGTGGCAGGCCAAGGCGG + Intronic
1134328492 16:13228911-13228933 AGCCCTTCGGGAGGCCAAGGTGG + Intronic
1134626605 16:15726961-15726983 GGTCCTGGGCCAGGCCAAGCAGG - Exonic
1136353342 16:29726888-29726910 CGCACTGTGGGAGGCCAAGGTGG - Intergenic
1136417674 16:30113594-30113616 AGCCCAGCGGCAGGCTCAGCAGG - Exonic
1139377589 16:66509832-66509854 CCCTCTGCGGCAGGCAGAGCTGG - Exonic
1141649353 16:85384934-85384956 CGGCCTGCCGCAGACCCAGCAGG + Intergenic
1142049730 16:87950681-87950703 AGCCCTGTGGGAGGCCAAGGCGG - Intronic
1142147960 16:88500269-88500291 GGCCATGCGGCAGGCCCAGGAGG - Intronic
1142181990 16:88675760-88675782 AGCCCTGTGGGAGGCCAAGGCGG - Intergenic
1142693145 17:1619055-1619077 AGCCCTTCGGGAGGCCAAGGTGG + Intronic
1144161966 17:12568736-12568758 CTCCCTGCCACAGGCCAACCAGG + Intergenic
1145206398 17:20986269-20986291 AGCACTGTGGCAGGCCAAGGCGG + Intergenic
1146968803 17:37055672-37055694 CGCCCTGCAGAAGGCCCAGCCGG - Intronic
1147350055 17:39835318-39835340 CGCCCTACAGTGGGCCAAGCAGG - Intronic
1147598122 17:41729626-41729648 AGCACTGCGGGAGGCCAAGGCGG + Intronic
1147667936 17:42160357-42160379 GGGCCTGCTGCAGGCCAGGCTGG - Exonic
1147693232 17:42331678-42331700 AGCACTGTGGGAGGCCAAGCTGG + Intronic
1147879754 17:43646092-43646114 CGCCCCGCGGGCGGCCAACCCGG - Intronic
1148127268 17:45243267-45243289 CACCCTGCGGAAGGGCAACCTGG + Exonic
1148911370 17:50944768-50944790 CGCCCCGCGGGAGGCCCTGCAGG + Intergenic
1150259509 17:63777154-63777176 CGCCCTTTGGGAGGCCAAGGTGG - Intronic
1152251399 17:79214529-79214551 CTCCCTGGGGCAGGCCAAGTGGG + Intronic
1152392023 17:80008941-80008963 AGCCCTGGGGCAGACCCAGCTGG + Intronic
1153219176 18:2847214-2847236 CGCCCAGCGCCAGGGCACGCGGG - Exonic
1156271258 18:35534950-35534972 AGCCCTTTGGGAGGCCAAGCTGG + Intergenic
1157063549 18:44321141-44321163 CGCCCTGTAGCAGGCCAAGCAGG - Intergenic
1157521413 18:48347985-48348007 CTCCCTGGGGCAGGCCAACAGGG - Intronic
1159565234 18:70040970-70040992 AGCCCTTCGGGAGGCCAAGGTGG + Intronic
1160532903 18:79575979-79576001 CGCCCTGTGGGAGGCTCAGCAGG + Intergenic
1160825383 19:1077871-1077893 CAACCTGCGCAAGGCCAAGCAGG + Exonic
1161181090 19:2882799-2882821 AGCTCTGCGGGAGGCCAAGGCGG - Exonic
1161218015 19:3104434-3104456 CGGCCTGTGGCAGGCCCACCAGG + Intronic
1161317351 19:3623807-3623829 CGCACGGCGGCTGGCCAAGAAGG - Exonic
1161508399 19:4656837-4656859 CGCACTTCGGGAGGCCAAGGTGG - Intronic
1161734027 19:5979203-5979225 AGCACTGCGGGAGGCCAAGGTGG + Intergenic
1161873603 19:6890161-6890183 AGCCCTTCGGGAGGCCAAGGTGG - Intronic
1162017080 19:7851710-7851732 CGCCCTGCTGCAGGTGAACCAGG + Exonic
1162470619 19:10870660-10870682 GGCCCTGCGCCGGGCCAGGCTGG + Intergenic
1162948255 19:14056438-14056460 AGCCCTCAGGCAGGCCCAGCTGG - Exonic
1163148571 19:15398462-15398484 TGCCCTCTGGCAGGCCGAGCGGG - Intronic
1163390326 19:17026790-17026812 CGCTCCGCGCCCGGCCAAGCTGG + Exonic
1163905467 19:20148688-20148710 AGCACTGTGGCAGGCCAAGGCGG - Intergenic
1164165121 19:22666436-22666458 AGCATTGCGGGAGGCCAAGCTGG - Exonic
1164548716 19:29190123-29190145 AGCACTTCGGCAGGCCAAGGCGG + Intergenic
1164652074 19:29898249-29898271 AGCACTGTGGCAGGCCAAGGTGG - Intergenic
1164850307 19:31477810-31477832 CGCCCTTTGGGAGGCCAAGGTGG - Intergenic
1165101461 19:33440982-33441004 CTCCCTGCTCCCGGCCAAGCAGG - Intronic
1165406178 19:35632712-35632734 AGCCCTGTGGCAGGCAATGCTGG - Intronic
1166208059 19:41285919-41285941 AGCACTTCGGGAGGCCAAGCTGG + Intronic
1166261915 19:41645939-41645961 AGCACTGTGGCAGGCCAAGGCGG + Intronic
1166292906 19:41874598-41874620 AGCACTTCGGGAGGCCAAGCTGG + Intergenic
1166351285 19:42199590-42199612 CGCCCTGCTGCAGGCCCTGCGGG - Exonic
1167198887 19:48050298-48050320 CGCCCTGCCCCATGCCAGGCAGG + Intronic
1167564258 19:50246386-50246408 GGCCCTTCGGGAGGCCAAGGTGG - Intronic
1167571821 19:50293253-50293275 TGCTCGGCGGCAGGCCCAGCAGG + Exonic
1168205174 19:54845182-54845204 AGCCCTGCAGGAGGCCAAGGCGG + Intronic
1168639862 19:58023952-58023974 GGCCCTGTGGGAGGCCAAGGTGG - Intergenic
1168707793 19:58479776-58479798 CACCCTGCAGCAGGCCTAGCTGG + Intronic
925349354 2:3190087-3190109 CACCCTGGGGGAGGCCAGGCAGG - Intronic
926757055 2:16244746-16244768 GGGCCTGGGCCAGGCCAAGCAGG + Intergenic
927861448 2:26562608-26562630 CGCGCTGCGGGAGGCCATGGTGG - Exonic
928010379 2:27602029-27602051 AGCACTTCGGCAGGCCAAGGAGG - Intronic
933493018 2:83012428-83012450 AGCACTGTGGCAGGCCAAGGCGG + Intergenic
935293615 2:101629658-101629680 AGCACTGCGGGAGGCCAAGGTGG + Intergenic
941001266 2:160205728-160205750 TGCCCCGGGGCAGGCCCAGCTGG - Intronic
943064426 2:183071396-183071418 CGCCCTGCAGCAAACCAAGCAGG - Intergenic
943324908 2:186486302-186486324 GGCCCTGCGGCAGGACGAGGAGG - Exonic
943669798 2:190648865-190648887 CGCCCGGCGGCGGCCCACGCCGG + Intronic
944763438 2:202840687-202840709 TGCCCTGCAGCGGGCCAAGCAGG - Intronic
946320872 2:218953746-218953768 CGCCATGCAGCGGGCCAAGCAGG - Intergenic
946391845 2:219420866-219420888 CGCCCTGCGCCAGGCCAAGCAGG + Exonic
947642807 2:231716403-231716425 CGCCCTGAGGCAGGCAGGGCTGG - Intergenic
947752215 2:232539003-232539025 TGCCCAGTGGCAGGCCAAGATGG + Intergenic
948479130 2:238239553-238239575 CGCGCAGGTGCAGGCCAAGCTGG - Exonic
948898903 2:240946179-240946201 GGCCCAGCTGCTGGCCAAGCAGG + Intronic
948908182 2:240989755-240989777 GGCCCGGCCGCAGGCCACGCAGG + Intronic
1168757070 20:325423-325445 GGCCCGGCCGCAGCCCAAGCGGG + Exonic
1170888977 20:20363760-20363782 CCTCCTGCGGCAGGCGAGGCGGG + Intergenic
1170960057 20:21017645-21017667 CACACTGGGGCAGGCCTAGCAGG - Intergenic
1171056992 20:21916703-21916725 CACCGTGCGGCAGCCGAAGCAGG - Intergenic
1172094483 20:32453964-32453986 CTCCCTGCGGCAGCCCAGGGAGG - Intronic
1172510340 20:35496658-35496680 TGCCCTGCGCCAGGACATGCAGG + Exonic
1172627051 20:36353285-36353307 TGCCCTGCGGCAGGTCCTGCTGG + Intronic
1173646365 20:44635649-44635671 AGCACTGTGGGAGGCCAAGCTGG + Intronic
1173797799 20:45874760-45874782 CACCCTGAGGCAGGACAAGAGGG - Intronic
1175383781 20:58581255-58581277 AGCACTGTGGCAGGCCAAGGCGG - Intergenic
1175920292 20:62447529-62447551 CACCCTGCGGCTGGGCAAGGTGG - Intergenic
1176131713 20:63499159-63499181 CGCCCTGCAGCACGCCAATGCGG + Exonic
1176170889 20:63695963-63695985 AGGCCTGCAGCGGGCCAAGCCGG - Exonic
1176424517 21:6539915-6539937 CGACCTGAGGCTGGCCCAGCAGG - Intergenic
1176546248 21:8201738-8201760 CGCCCTGAGTCAGGTCAAGGAGG - Intergenic
1176565199 21:8384784-8384806 CGCCCTGAGTCAGGTCAAGGAGG - Intergenic
1179700010 21:43148230-43148252 CGACCTGAGGCTGGCCCAGCAGG - Intergenic
1180042657 21:45288132-45288154 CGCCCTGGCGCAGCCCACGCAGG + Intergenic
1180643451 22:17318154-17318176 AGCACTTCGGGAGGCCAAGCTGG + Intergenic
1180693596 22:17738118-17738140 GGCCCTGCTGCTGGCCAAGAAGG - Exonic
1180875963 22:19175383-19175405 AGCCCAGCGCCAGGCCAAGAAGG - Intergenic
1182146251 22:27998585-27998607 CGCCCTGGGGGAGGCCATGAAGG - Exonic
1182520254 22:30880999-30881021 CGCCCTGGGGCAGCCCCACCTGG - Intronic
1184248012 22:43245387-43245409 AGCCCTGGGGCAGACCCAGCCGG - Intronic
1184344594 22:43905329-43905351 CCCCCTGGGGCAGGCCAAGGAGG - Intergenic
1203251120 22_KI270733v1_random:117975-117997 CGCCCTGAGTCAGGTCAAGGAGG - Intergenic
950004735 3:9684493-9684515 CTCCCTCCACCAGGCCAAGCTGG + Intronic
952611537 3:35216058-35216080 CGCCCTGCAGCGGGCCAAGCAGG - Intergenic
953030725 3:39178105-39178127 TGCCCTGCTGCGGGCCAAGGGGG - Intergenic
954081263 3:48213156-48213178 AGCACTGTGGCAGGCCAAGGCGG + Intergenic
955839472 3:63096728-63096750 CGCCCTGCAGCGGGCCAAGCAGG - Intergenic
957966184 3:87324337-87324359 CGCCCTGCAGTGGGCCAAGCAGG + Intergenic
959418922 3:106110450-106110472 AGCACTGTGGCAGGCCAAGGCGG - Intergenic
961713815 3:128845838-128845860 AGCCCTGCTGCAGGCTCAGCTGG + Intergenic
961745353 3:129060872-129060894 CTCCCTGTGGGAGGCCATGCTGG - Intronic
962315894 3:134359385-134359407 CTCCCTGCGGCCTGCCAAGTCGG - Exonic
962712808 3:138101837-138101859 CGCCCTGCAGCGGGCCAAGCAGG - Intronic
963040440 3:141066155-141066177 GGCGCTGCGGCCGGCCAAGCGGG + Exonic
963891875 3:150644873-150644895 AGCACTGTGGCAGGCCAAGGTGG + Intergenic
963917014 3:150868016-150868038 AGCACTTCGGGAGGCCAAGCGGG + Intergenic
965605786 3:170496505-170496527 CGCCCTGCAGCGGGCCAAGCAGG + Intronic
966411919 3:179653431-179653453 CGGCCTGCGGCACGTGAAGCCGG + Intronic
967859791 3:194141862-194141884 TGCCAGGCGGCAGGCCACGCCGG + Intergenic
968377105 4:53096-53118 TGGGCTGCGTCAGGCCAAGCCGG + Intergenic
973704130 4:53564788-53564810 CACCCTGCGCCAGCCGAAGCAGG + Intronic
976996208 4:91437648-91437670 CACCCTGCGCCAGCCGAAGCAGG + Intronic
977928664 4:102729078-102729100 CGCCCTGCAGCAGGCCAAGCAGG - Intronic
981229567 4:142336713-142336735 CGGGCTGCAGCAGGCCAAGTGGG + Intronic
984533274 4:180944134-180944156 AGCACTGTGGCAGGCCAAGGCGG - Intergenic
984984964 4:185319444-185319466 AGCACTGTGGCAGGCCAAGGCGG - Intronic
985256235 4:188072622-188072644 CGCACTTTGGGAGGCCAAGCAGG + Intergenic
985727465 5:1523706-1523728 CGCCCTGCAGAAGGCCCAGGTGG - Exonic
989146721 5:38257759-38257781 CCCCCTGCCCCAGGCCCAGCTGG + Intergenic
990900482 5:60743911-60743933 CGCCCTGCAGTGGACCAAGCAGG - Intergenic
991020211 5:61972220-61972242 AAGCCTGGGGCAGGCCAAGCTGG - Intergenic
991502394 5:67289925-67289947 CTCCCTGGGGCAGGCCCAGCTGG + Intergenic
992536008 5:77704215-77704237 AGCCCTTTGGGAGGCCAAGCTGG - Intronic
994142359 5:96355945-96355967 AGCACTTTGGCAGGCCAAGCTGG - Intergenic
996341238 5:122441321-122441343 CGCCCTTGGGCAGGCCACCCAGG + Intronic
996432902 5:123401248-123401270 CGCCCTGCAGCGGGCCAAGCAGG - Intronic
996845096 5:127890124-127890146 AGCACTGTGGTAGGCCAAGCTGG + Intergenic
998368422 5:141645887-141645909 CCCCCTGCAGCAGGGCCAGCCGG + Exonic
998887169 5:146706531-146706553 CGCCCTTCAGCAGACCAAGTAGG - Intronic
999017806 5:148127603-148127625 AGCACTGTGGGAGGCCAAGCGGG + Intronic
1000022590 5:157331424-157331446 AGCCCTGCTGTTGGCCAAGCGGG + Intronic
1000513411 5:162211020-162211042 AGCCCTTCGGGAGGCCAAGTCGG + Intergenic
1001382953 5:171315862-171315884 AGCCCTTTGGGAGGCCAAGCCGG + Intergenic
1001383369 5:171318276-171318298 CGCCCTGAGGCAGGAGAAGTTGG + Intergenic
1002298974 5:178247034-178247056 CTCCCTGGGGCAGGGCATGCAGG + Intronic
1002471318 5:179437882-179437904 CAGCCTGCGGCAGGAGAAGCAGG - Intergenic
1006926577 6:37658722-37658744 AGCACTTCGGGAGGCCAAGCGGG + Intronic
1007063267 6:38963611-38963633 AGCACTGTGGCAGGCCAAGGCGG - Intronic
1007631955 6:43277542-43277564 CGCCCTGGGGCAGGCAAGGGTGG + Intronic
1010540677 6:77088320-77088342 CACCCTGCGCCAGCCAAAGCAGG - Intergenic
1011695639 6:89910186-89910208 AGCACTTCGGGAGGCCAAGCTGG + Intergenic
1015539183 6:134297328-134297350 CGCCCTGCAGCGGGCCTAGCAGG - Intronic
1016296324 6:142577160-142577182 CGCCGTGCGCAAGCCCAAGCAGG + Intergenic
1016557370 6:145353613-145353635 AGCCCTGCCTCAGGACAAGCAGG + Intergenic
1018317269 6:162569350-162569372 TGCCCTGCAACAGGCCATGCAGG + Intronic
1019542210 7:1556475-1556497 AGGTCTGCGGCAGGCCAAGGAGG + Intronic
1019732069 7:2633972-2633994 CACCCTGCTGGAGGCCAGGCAGG - Intronic
1019993030 7:4705427-4705449 AGCACTGCGGGAGGCCAAGGTGG - Intronic
1020142478 7:5620318-5620340 CGCCCTGCGGCAAGCCCTGCAGG + Intronic
1021975090 7:26004111-26004133 AGCCCTGGGGCAGGACAAGTAGG + Intergenic
1023289662 7:38656267-38656289 CGCCCTGCAGCTAGCCAAGCAGG + Intergenic
1023380089 7:39598527-39598549 AGCCCTTCGGTAGGCCAAGAAGG + Intronic
1023445478 7:40227295-40227317 CGCACTTTGGGAGGCCAAGCGGG - Intronic
1024311729 7:47975524-47975546 CACCCTGCAGCAGTCCATGCAGG - Intronic
1029436070 7:100564749-100564771 AGCCCTTTGGCAGGCCAAGGTGG - Intronic
1029653640 7:101910506-101910528 CGCACTTTGGCAGGCCAAGGCGG + Intronic
1032011716 7:128351734-128351756 CGCCCAGGCGCAGGCCTAGCTGG + Exonic
1032175956 7:129626065-129626087 AGCACTGTGGCAGGCCAAGGTGG - Intronic
1033189543 7:139264831-139264853 AGCACTTTGGCAGGCCAAGCGGG - Intronic
1036899266 8:12659165-12659187 CGCGCTGCGGCCGGGCAAGGAGG - Intergenic
1037421236 8:18705278-18705300 AGCCCTTTGGGAGGCCAAGCCGG + Intronic
1037902393 8:22695350-22695372 CGCAGGGCGGCGGGCCAAGCCGG + Intergenic
1038613297 8:29072307-29072329 CGTCCTGCTGCAGGCTCAGCCGG - Exonic
1039591448 8:38753349-38753371 AGCCCTTCGGTAGGCCAAGAGGG - Intronic
1040951452 8:52941439-52941461 CCCGCGGCGCCAGGCCAAGCGGG - Intergenic
1041781151 8:61579293-61579315 TGCCCTGCAGCGGGCCAAGCAGG + Intronic
1042594340 8:70429900-70429922 CGCCCTCCGTCAGCCCAGGCTGG + Intergenic
1042752629 8:72174813-72174835 AGCCCTGTGGGAGGCCAAGGAGG - Intergenic
1045223061 8:100217134-100217156 CACCATGCTGCAGGCCAGGCTGG + Intronic
1047254260 8:123204163-123204185 AGCACTTCGGGAGGCCAAGCAGG + Intronic
1049151983 8:141040940-141040962 GGCCCTGGGGCAGGGCATGCAGG + Intergenic
1049657009 8:143803472-143803494 CGCCGTGCGTCAGGCCCAGCAGG + Exonic
1049998689 9:1053258-1053280 CTCCCTGTGGCAGGGCAGGCAGG - Intronic
1051351611 9:16203071-16203093 CGCCTCTCGGCAGGCCAGGCTGG + Intergenic
1053478189 9:38396870-38396892 CGCCCTCCTTCTGGCCAAGCTGG - Exonic
1054340802 9:63859911-63859933 CGCACTGCCGCAGGCCAGGAGGG - Intergenic
1057943661 9:99306233-99306255 CGCCCTGCAGCGGGCCAAGCAGG + Intergenic
1058737723 9:107909203-107909225 AGCACTTCGGGAGGCCAAGCTGG - Intergenic
1060438619 9:123617626-123617648 CGCCTTCCGGTAGGCCAAGGAGG - Intronic
1203774359 EBV:64535-64557 AGCCCTGCAGCGGGCCAGGCCGG + Intergenic
1203572132 Un_KI270744v1:141150-141172 TGGGCTGCGTCAGGCCAAGCCGG - Intergenic
1186835377 X:13432048-13432070 CGCACTTCGGGAGGCCAAGGCGG + Intergenic
1189893774 X:45632643-45632665 CGTTCTGCAGCGGGCCAAGCAGG - Intergenic
1190053545 X:47169511-47169533 CGCGCTGCGCCAGGCCTGGCTGG + Intronic
1191220773 X:57985755-57985777 TGCCCTGCAGCGGGCCAAGCAGG + Intergenic
1194003959 X:88467490-88467512 AGCCCTTTGGCAGGCCAAGGTGG - Intergenic
1198312073 X:135433779-135433801 GGCCCTGCTGCAGGCCCAACTGG + Intergenic
1198883324 X:141306029-141306051 CACCCTGAGGCAGGCCAACCAGG - Intergenic
1199927277 X:152480646-152480668 CACCCTGCAGCGGGCCAAGCAGG + Intergenic
1200098238 X:153674018-153674040 GGCCCTGGGGCCGGCCCAGCCGG - Exonic
1201279802 Y:12331940-12331962 AGCACTTCGGCAGGCCAAGGAGG + Intergenic