ID: 1129597921

View in Genome Browser
Species Human (GRCh38)
Location 15:76979365-76979387
Sequence GCTGGAGGCCGCCCTGCGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 12, 2: 16, 3: 44, 4: 283}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129597921_1129597929 29 Left 1129597921 15:76979365-76979387 CCTGCCGCAGGGCGGCCTCCAGC 0: 1
1: 12
2: 16
3: 44
4: 283
Right 1129597929 15:76979417-76979439 AGCCAGCTCCCCGCGCTGCTCGG 0: 1
1: 1
2: 9
3: 26
4: 194
1129597921_1129597924 -10 Left 1129597921 15:76979365-76979387 CCTGCCGCAGGGCGGCCTCCAGC 0: 1
1: 12
2: 16
3: 44
4: 283
Right 1129597924 15:76979378-76979400 GGCCTCCAGCTCGGACAACTTGG No data
1129597921_1129597927 -4 Left 1129597921 15:76979365-76979387 CCTGCCGCAGGGCGGCCTCCAGC 0: 1
1: 12
2: 16
3: 44
4: 283
Right 1129597927 15:76979384-76979406 CAGCTCGGACAACTTGGCATTGG 0: 1
1: 4
2: 11
3: 15
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129597921 Original CRISPR GCTGGAGGCCGCCCTGCGGC AGG (reversed) Intergenic
900215355 1:1478766-1478788 GAGGGAGGCCGCCCGGCTGCGGG + Intronic
900222616 1:1517433-1517455 GAGGGAGGCCGCCCGGCTGCGGG + Intronic
900269146 1:1778346-1778368 GCTGGCGGCGGCGCGGCGGCGGG - Intronic
900364771 1:2306627-2306649 GCTGCGGGCCGACCTGCTGCGGG + Exonic
900368917 1:2322883-2322905 GCTGGTGGCCACCGTGCGGCAGG + Intronic
900620290 1:3583931-3583953 TCTGGAGGCCGGGCTGCTGCAGG - Intronic
901062058 1:6476084-6476106 TCTGGAGGCAGCCATGCTGCAGG - Intronic
901399745 1:9007566-9007588 GCTGGAGGGAGCCCTGTGGGAGG - Intronic
902504365 1:16929845-16929867 GCTGGAGCAGGCTCTGCGGCTGG + Exonic
903187111 1:21634913-21634935 GCAGGAAGAGGCCCTGCGGCCGG - Intronic
903241271 1:21984211-21984233 GCTGCAGGAGGCCCTGCTGCCGG + Exonic
903879174 1:26497128-26497150 GATGGGGGCCGCCCTGGGGAAGG - Intergenic
905058647 1:35120935-35120957 CCTGGGGGTCGCCGTGCGGCGGG - Intergenic
906223696 1:44103690-44103712 GCTGGAGGCCGCCCTCCAGCCGG - Intergenic
906282406 1:44563313-44563335 GCTGGTGGCCCCCCTGCTTCAGG + Intronic
908401241 1:63774462-63774484 GCTGCTGGCCGCGCTGCTGCTGG + Exonic
909232288 1:73105897-73105919 GCTGGAGGCCGCCGTGTAGCAGG + Intergenic
912619481 1:111140451-111140473 GCGCGAGGCCACCCTGCGCCAGG - Intronic
913318847 1:117575001-117575023 GCCTGAGGCCTCCCTACGGCAGG - Intergenic
914932812 1:151949876-151949898 GCTGGAGGCCACCCTGCAGTGGG - Intergenic
915298195 1:154936655-154936677 GCTGGGAGGCGCCCCGCGGCTGG - Exonic
915461305 1:156072268-156072290 GGTGGAGACAGCCCTGGGGCAGG - Exonic
915619818 1:157074317-157074339 GCTGGAGGCCGCCCTGCAGCGGG + Intergenic
921376163 1:214476057-214476079 GGTGGAGGGGGCCCTGAGGCTGG + Intronic
921398104 1:214690154-214690176 GCTGTAGGCCGACCTGCTGTGGG - Intergenic
922573129 1:226645407-226645429 GGTGGGGGCAGCCCTGGGGCAGG + Intronic
922793129 1:228321571-228321593 GGTGGGGGATGCCCTGCGGCTGG + Exonic
923834086 1:237590787-237590809 GCTGGAGGGCTCCCTGGGGCTGG + Exonic
923840504 1:237665508-237665530 GTTTGGGGCTGCCCTGCGGCTGG + Intronic
1063714534 10:8514051-8514073 GCTGGAGGCCGCCCTGCAGCGGG - Intergenic
1067570122 10:47365413-47365435 GCAGGAGGCTGCCATGCAGCTGG - Intergenic
1070102123 10:73398249-73398271 GCTGGAGGCTACCCTGCGCCTGG - Exonic
1070179098 10:73997799-73997821 GCGGGAGGCGGCCCGGGGGCGGG + Intergenic
1071527351 10:86366282-86366304 GCTGGAGGCCGGGCCGAGGCTGG - Intronic
1073460304 10:103661998-103662020 GCTGGGGGCAGGCCTGAGGCTGG - Intronic
1073536263 10:104279429-104279451 TCTGAAGGCAGCCCTGCGTCAGG + Exonic
1076284604 10:129281097-129281119 GCTGCAAGCCTCCCTGTGGCTGG + Intergenic
1077076147 11:703102-703124 CCTGGAGGCCGTCCTGCAGGTGG + Exonic
1077467833 11:2741956-2741978 GCGGCAGCCCGCCCTGGGGCAGG - Intronic
1077730324 11:4723099-4723121 GCTGGAGGCCGCCCTGCAGCGGG - Intronic
1078081436 11:8207277-8207299 GCTGGAGCCCACCCTGGGTCTGG + Intergenic
1078191536 11:9095546-9095568 GCTGGAGGCCGCCCTGCAGCGGG + Intronic
1081806475 11:45893660-45893682 GAGGGAGGCCGGCCTGCGGAGGG + Intronic
1082025068 11:47565640-47565662 GCTGGAGGCCGGCCTGGCGCGGG + Exonic
1083163091 11:60867612-60867634 GCTGGTTGCCACCCTGGGGCTGG + Exonic
1083458050 11:62792022-62792044 GCGGAAGGCGGCTCTGCGGCAGG - Intergenic
1083714555 11:64568055-64568077 GCAGGAGGCTGCCTTGCGGCTGG + Intronic
1083913954 11:65727973-65727995 GCTGGAGGCTGCCCTGTAGCAGG + Intergenic
1083924040 11:65795314-65795336 GGTGGGGGCTGCCCTGCAGCAGG - Exonic
1083950610 11:65953609-65953631 GCAGCAGGCCGAGCTGCGGCGGG + Exonic
1084175670 11:67421039-67421061 GCTGTGGGCCGCGCCGCGGCTGG + Exonic
1085644373 11:78213662-78213684 GATGTAGGCCGCCCTGCTCCGGG - Exonic
1087214512 11:95480901-95480923 CCTGGAGGCTGCCCTGCGTGTGG + Intergenic
1088579214 11:111299589-111299611 CCGGGAGGCCGCCCTTCGGTAGG - Exonic
1088619911 11:111671318-111671340 GCTGGAGGCCGCCCTGCAATGGG - Intronic
1088717135 11:112558762-112558784 TCTGGAGGCTTGCCTGCGGCTGG + Intergenic
1089124784 11:116169269-116169291 AATGGAGGCAGCCCTGGGGCTGG + Intergenic
1089599219 11:119603219-119603241 GCTGGAGGCCGCCCAGGAGCGGG - Intergenic
1089615255 11:119691464-119691486 GCTGAAGGCTGCTCTGCGGGTGG + Intronic
1089692991 11:120198152-120198174 GCTGGAGGCAGGCCTGGGGAGGG + Intergenic
1090920922 11:131205199-131205221 GCTACAGGCCGTCCTGGGGCTGG + Intergenic
1091174565 11:133546801-133546823 GGAGGAGGCCGCACTGGGGCAGG - Intergenic
1091385839 12:94098-94120 GCTGGTGGACTCCCTGAGGCAGG + Intronic
1092253421 12:6914096-6914118 GCCGGGGGCCGCCCTCGGGCAGG + Exonic
1092256302 12:6928216-6928238 GATGGGGGCCGCCCTCCGGGGGG + Intronic
1094101317 12:26767137-26767159 GAAGGAGGCCGGCCTGCTGCAGG - Intronic
1096518722 12:52172313-52172335 GCTGGAGGCCGCCCTGCAGCAGG - Exonic
1096521132 12:52185410-52185432 GCTGGAGGCCAACCTGCTGCAGG - Exonic
1096531507 12:52245495-52245517 GCTGGAAGCCGCCCTGCAGCGGG + Exonic
1096532773 12:52252376-52252398 GCTGGAGGGTGCCCTGCAGAAGG - Intronic
1096537929 12:52287217-52287239 GCTGGAGGGCGCCCTGCAGAAGG - Exonic
1096540842 12:52306143-52306165 GCTGGAGGGTGCCCTGCAGAAGG + Exonic
1096542528 12:52316008-52316030 GCTGGAGGGCGCCCTGCAGAAGG - Exonic
1096547415 12:52350196-52350218 GCTGGAGGACGCCCTGCAGAAGG + Intergenic
1096549395 12:52362366-52362388 GCTGGAGGGCGCCCTGCAGAAGG - Exonic
1096562674 12:52447893-52447915 GCTGGAGGATGCCCTGCAGAAGG - Exonic
1096564844 12:52469785-52469807 GCTGGAGGATGCCCTGCAGAAGG - Exonic
1096566764 12:52488443-52488465 GCTGGAGGATGCCCTGCAGAAGG - Exonic
1096569952 12:52516752-52516774 GCTGGAGGAGGCCCTGCAGAAGG - Exonic
1096574862 12:52546401-52546423 GCTGGAGGGCGCCCTGCACCAGG - Exonic
1096578267 12:52568284-52568306 GCTGGAGGGCGCCCTGCACCAGG - Exonic
1096581383 12:52587746-52587768 GCTGGAGGGCGCCCTGCACCAGG - Exonic
1096584435 12:52610730-52610752 GCTGGAGGGCGCCCTGCAGCAGG - Exonic
1096589307 12:52646855-52646877 CCTGGAGGAGGCCCTGCAGCAGG - Exonic
1096593262 12:52676390-52676412 CCTGGAGGATGCCCTGCAGCAGG - Exonic
1096611933 12:52807759-52807781 GCTGGAGGCTGCCCTGCAGCAGG - Exonic
1096617158 12:52839879-52839901 GCTGGAGGCTGCTCTGAGGATGG - Exonic
1096626429 12:52898794-52898816 GCTGGAGGCCGCCCTGCAGCGGG - Exonic
1097615576 12:61880387-61880409 GCTGGAGGCCGCCCTGCAGTGGG + Intronic
1100083123 12:90876822-90876844 GCTGGAGGCCTCCTTGGGGAAGG - Intergenic
1101144805 12:101830890-101830912 GGCGGAGGCGGACCTGCGGCCGG + Exonic
1102344963 12:112153664-112153686 GCTGGAGTCAGCCCTGGGGTTGG + Intergenic
1102969638 12:117155842-117155864 GCTGGTGGTGGCCGTGCGGCAGG + Exonic
1103342558 12:120228871-120228893 TCGGGAGGCCGCCCTGGGGCAGG + Intronic
1103916592 12:124378923-124378945 CTTGGAGGCTGCCCTGCCGCTGG + Intronic
1107710527 13:43146293-43146315 GCTGGAGGCAGTGCTGCGGGAGG + Intergenic
1108688761 13:52844860-52844882 GCTGGAGCCCATCCTGCAGCGGG - Exonic
1108710631 13:53028979-53029001 GCTGGAGCCCGACCTGGAGCTGG - Exonic
1110706213 13:78603437-78603459 GCTGGCGGCGGCCCCGCCGCGGG + Exonic
1113082466 13:106534167-106534189 GCGGGAGGCCGAGGTGCGGCGGG + Intronic
1113661206 13:112107491-112107513 GCTGGTGCCCGCCCTGCACCCGG - Intergenic
1113878364 13:113608478-113608500 GCTGGAGGAAGCCCTGCTGGGGG - Intronic
1114075592 14:19159572-19159594 GCTGGATGTCCCCCTGGGGCTGG + Intergenic
1116326896 14:43541240-43541262 GCTGGTGGCTGCCCTACAGCGGG - Intergenic
1119704986 14:76777857-76777879 CCTGGAGGCTGCCCTGGGGAAGG - Intronic
1119741059 14:77014012-77014034 GCTGGAGGCCCTTCTGGGGCAGG + Intergenic
1121183349 14:91946115-91946137 GCTAGAGGCAGCCCTGGGACAGG + Intronic
1121334710 14:93070226-93070248 GCTGGAGGGGGCCCGGCAGCAGG + Intronic
1122268563 14:100558028-100558050 GCTGGAGCCCCACCTGCAGCTGG - Intronic
1122961451 14:105095626-105095648 ACTGGAGGCAGCTCTGCAGCAGG - Intergenic
1126467324 15:48972969-48972991 GCTGGAGGCCGCCCAGCAGCGGG + Intergenic
1127489159 15:59445946-59445968 GCTGGAGGTCACCCTGCAGTGGG - Intronic
1127875800 15:63110372-63110394 GCTGGAAGCCGCTATGCTGCTGG + Intergenic
1128081003 15:64856874-64856896 GCTGGAGGCCTCACTGAGGACGG - Intronic
1128160651 15:65421443-65421465 GCTGGAGGCCGCCGCGAGGCTGG - Intronic
1128742735 15:70095455-70095477 TCTCAGGGCCGCCCTGCGGCTGG + Intronic
1128742940 15:70096130-70096152 GGTGGGGGCCGCCCCGGGGCTGG - Intronic
1129597921 15:76979365-76979387 GCTGGAGGCCGCCCTGCGGCAGG - Intergenic
1129770620 15:78201203-78201225 GCTGGAGGCCGGGTTGCTGCTGG - Intronic
1131231893 15:90665598-90665620 GCCGGAAGCGGCCGTGCGGCCGG - Intergenic
1132397010 15:101481542-101481564 GCAGGAGGAGGCCCTGAGGCAGG + Intronic
1132543018 16:520169-520191 GCTGGAGGCCGAGCAGCGGCGGG + Exonic
1132604773 16:789085-789107 GGTGGACGCCGACCTGCAGCCGG + Exonic
1132622391 16:874023-874045 GCTGGTGGAGGCCCGGCGGCGGG + Intronic
1132628040 16:901705-901727 GCTGGAGACAGCCCTGAGTCAGG + Intronic
1132779530 16:1614849-1614871 CCTGGGGGCTGCCCTGCGGCGGG - Exonic
1132865359 16:2090425-2090447 GCTGTGGGGCGCCCTACGGCTGG - Exonic
1132905690 16:2281544-2281566 CACGGAAGCCGCCCTGCGGCTGG - Intronic
1133270741 16:4609798-4609820 GCTGGAGGCCGCAGAGCTGCTGG + Exonic
1136611966 16:31371806-31371828 GGTGGCGGCCGCGCTGGGGCTGG + Intronic
1137738462 16:50742236-50742258 GCTGGCGGCCGGCGGGCGGCCGG + Intronic
1138536586 16:57663569-57663591 GCTGGAGGCCTAGATGCGGCTGG - Exonic
1139546754 16:67653233-67653255 CCTGGGGGCCCCCCGGCGGCGGG - Exonic
1141680253 16:85539622-85539644 GTTGGAGGCCGTTCTGTGGCTGG + Intergenic
1142156098 16:88533472-88533494 GCTGGAGCCCGGCGTGGGGCTGG - Exonic
1142246291 16:88971616-88971638 GCCAGAGGCCGGCCTGCAGCAGG - Intronic
1142289251 16:89185249-89185271 GCTCGGGGCTGCCCTGCTGCAGG - Exonic
1142356334 16:89603721-89603743 GCTGGAGGGGACCCTGGGGCTGG + Intergenic
1142660471 17:1425695-1425717 CCTGGAAGAGGCCCTGCGGCTGG - Intronic
1142668053 17:1473651-1473673 GCTGGAGCCCTCCCTGCATCTGG + Intronic
1142978816 17:3659992-3660014 GCTGCTGGCCACCCTGCGGCTGG + Intronic
1142984715 17:3688941-3688963 GAGGGAGGCAGCCCTGAGGCAGG - Intronic
1144344749 17:14339768-14339790 TCTGGAGGCCAGCCTGGGGCTGG + Intronic
1144599482 17:16599759-16599781 GTTGGAGACAGCCCTGGGGCTGG + Intergenic
1144702970 17:17350804-17350826 GCTAGAGGCCCCCCTGCTGGAGG - Intergenic
1146805161 17:35858971-35858993 TCTGGAGGCAGCCCTGTGCCTGG - Exonic
1146952586 17:36917023-36917045 GTTGGAGGCCTCCCTGGGCCAGG + Intergenic
1147350057 17:39835327-39835349 GCTGGAGGCCGCCCTACAGTGGG - Intronic
1147440360 17:40443750-40443772 CCTCGTGGCCGCCCTGCTGCTGG + Exonic
1147971096 17:44219444-44219466 CCCGGAGGCCGCGCTGCGCCGGG - Intronic
1148645282 17:49216647-49216669 GCAGGGGGCCGCCCTGCGGCAGG + Exonic
1151670627 17:75570013-75570035 GGTGGAGGCCGACCTGCTGCAGG + Exonic
1152070574 17:78131963-78131985 GCGGGAGGCAGCGCAGCGGCTGG + Exonic
1152357340 17:79813533-79813555 GCGGGGGGGCGCCCGGCGGCCGG + Intergenic
1152586358 17:81191227-81191249 GCTGGAGGCCGACATGGCGCTGG - Exonic
1152588315 17:81198950-81198972 GGTGGTGGCCTCCCTGCTGCAGG - Exonic
1152728309 17:81958428-81958450 TCTGGAGGCTGCCGGGCGGCAGG - Intronic
1152762878 17:82118595-82118617 GGTGGAGGCAGGCCTGCTGCAGG + Intronic
1152822008 17:82442210-82442232 GCTGGAGGCTGCCCTGCAGCTGG + Exonic
1153131475 18:1859136-1859158 GCTGGAGGTCTCCCTGGGGAAGG + Intergenic
1154021703 18:10668953-10668975 GCTACAGGCCCCCCTGCAGCTGG - Intronic
1155047218 18:22113568-22113590 CCTGGAGGTGGCCCTGCGCCAGG + Intergenic
1156447486 18:37248431-37248453 GCTGGAGGGTGCCCTGCAGGGGG + Intronic
1157063551 18:44321150-44321172 GCTGAAGGCCGCCCTGTAGCAGG - Intergenic
1157192023 18:45589653-45589675 GCTGGAGGCGGCTCAGCGGGAGG - Intronic
1157581463 18:48776414-48776436 GCAGGAGGCTGCCATGGGGCGGG + Intronic
1160894822 19:1397457-1397479 GCTGGAGGCCGGCTTCCGGAGGG - Intronic
1160990853 19:1859764-1859786 GCTGGGTGCTGGCCTGCGGCAGG + Intronic
1161374717 19:3933524-3933546 CCTGGAGGCCGCCCCGGGGGAGG - Exonic
1161426736 19:4207832-4207854 GCTGGGCTCCGCCCTGCAGCAGG - Exonic
1161516505 19:4699582-4699604 GCTGGTGACCGCCTTGCTGCGGG + Intronic
1161581208 19:5082076-5082098 GCTGACGGCCGCCTTGGGGCAGG + Intronic
1162557647 19:11397399-11397421 GCTGGAGGCTGCCCTGCCCTTGG - Intronic
1162786852 19:13040442-13040464 CCTGGTGGATGCCCTGCGGCAGG + Intronic
1163314056 19:16530837-16530859 GCTGCTGGCCGCCCTGCAGAAGG - Exonic
1163552546 19:17973839-17973861 GCTGCAGGCCGCCCGGGGCCCGG - Exonic
1163795296 19:19334487-19334509 GCTGGGGGCAGCCTTGGGGCTGG - Intronic
1165847983 19:38831271-38831293 CCTGGAGGCCTGCCTGCGGGGGG - Intronic
1166874949 19:45891292-45891314 GCTGGAGCCCGCCTTGCTGTGGG + Exonic
1166920563 19:46226568-46226590 GCCGGAGGCCCCTCTGCTGCTGG - Intergenic
1167110297 19:47456856-47456878 CCTGGAGGCCGCCGGACGGCGGG + Intronic
1167288679 19:48613030-48613052 GCCGGCGCCCGTCCTGCGGCTGG - Exonic
1167307414 19:48716985-48717007 GCTGGAGGCAGCCCTGCCCCCGG + Intronic
1167591262 19:50405775-50405797 GCTGGAGGGCGCCTGGCTGCAGG - Intronic
1168118469 19:54239382-54239404 ACTGGAGGGAGCCCTGCTGCAGG - Intronic
925897956 2:8487775-8487797 GCTGGAGCCCGCCGTGCCTCTGG - Intergenic
925919233 2:8627864-8627886 GGAGGAGGCCGCCCTGCAGAGGG + Intergenic
926101917 2:10123177-10123199 GCGGGAGGCAGCCCTGGGGAGGG - Intronic
927103073 2:19802681-19802703 CCTGGAGGCCAACCTGGGGCTGG + Intergenic
929000700 2:37344782-37344804 GCTGGTGGCCGCCCTGCCCTGGG + Exonic
932252691 2:70258307-70258329 GCTGGAGCGCGCCCCGCGCCGGG + Intronic
932621737 2:73268973-73268995 GCTGGAGGTGGACCGGCGGCTGG - Exonic
932880111 2:75493322-75493344 GCTGGAGCGCGCCCAGCGGCTGG - Exonic
934521637 2:95023759-95023781 GCTGGAGGATGCCCTGCCGAGGG + Intergenic
934558322 2:95299205-95299227 GCTGGTGGCCTTCCTGTGGCTGG + Intronic
937910478 2:127073266-127073288 CCTGGACGCTGCCCTGCGGAGGG - Intronic
938196607 2:129334328-129334350 GCAGGAGGCCTCCCTGGCGCAGG - Intergenic
938536341 2:132252621-132252643 CCTGGAGGCGGCCCAGCGACTGG - Intronic
942558653 2:177198166-177198188 GCTGGAGGCGGCCCTGCAGCGGG + Intergenic
944645862 2:201780743-201780765 GCCGGAGAGCGCCCTGCGGGGGG - Intronic
944763439 2:202840696-202840718 GCTGGAGGCTGCCCTGCAGCGGG - Intronic
946320874 2:218953755-218953777 GCTGGAGGCCGCCATGCAGCGGG - Intergenic
946483188 2:220075952-220075974 GCTGGGGGCTGCCCAGGGGCTGG - Intergenic
948826529 2:240575792-240575814 GTTGGGGGCCTCCCTGGGGCCGG + Intronic
949057521 2:241936641-241936663 GCTGGAGGCCGCTTTGCCGCGGG + Intergenic
949060707 2:241955436-241955458 GGAGGAGGCTGCCCTGCTGCAGG + Intergenic
1168750754 20:279427-279449 GCAGGAGGCCGCACGGGGGCGGG - Intronic
1168803889 20:661911-661933 ACTGGAGGCACCCCTGCAGCAGG - Exonic
1169122705 20:3106970-3106992 GCTTGAGGCCTCCCAGCGGCTGG - Intergenic
1171750889 20:29047356-29047378 CCCGGAGGCCGCTCTCCGGCTGG - Intergenic
1172523536 20:35584036-35584058 GCTGGAGCTCTTCCTGCGGCTGG - Intergenic
1172714224 20:36951239-36951261 GGGGGAGGGAGCCCTGCGGCGGG - Intronic
1174599476 20:51712813-51712835 GATGGAGGCCTCCCTGGTGCTGG + Intronic
1175725165 20:61313027-61313049 ACTGGGGGCCACCCTGGGGCAGG - Intronic
1175835749 20:61993296-61993318 TCTGGCTGCCTCCCTGCGGCAGG - Intronic
1176040744 20:63064559-63064581 GCTGGAGGCCGCCCGGGCTCTGG + Intergenic
1176130296 20:63493926-63493948 GCTGGAGGCCTCCCTGGGGAGGG + Intronic
1178380124 21:32100679-32100701 GCAGCAGGCCTCCCTGCGGTGGG - Intergenic
1178624234 21:34202165-34202187 GCTGGTGGCCACTCGGCGGCCGG - Intergenic
1179023515 21:37660042-37660064 GAGGGAGGCTGCCCTGGGGCAGG + Intronic
1180096690 21:45558643-45558665 GCTACAGGAAGCCCTGCGGCTGG + Intergenic
1180109613 21:45642089-45642111 GCTGACGGCCGCCCTGAGCCTGG + Intergenic
1180256777 21:46635334-46635356 GCAGGAGTCCGACCTGGGGCGGG - Intronic
1181031383 22:20150199-20150221 GCTGGGGGCCCTCCTGGGGCCGG - Exonic
1181511950 22:23393203-23393225 GCTGGGGGCCCTCCTGGGGCCGG + Intergenic
1182422630 22:30256037-30256059 GCTGCAGGCTGGCCTGGGGCTGG - Intergenic
1182451295 22:30423466-30423488 GCAGGAGGCCGCCCAAAGGCGGG + Exonic
1183858476 22:40652484-40652506 GCTGTGGCCTGCCCTGCGGCTGG + Intergenic
1184176607 22:42792719-42792741 GCTGCAGGAGGCCCTGTGGCAGG + Intergenic
1184420793 22:44381832-44381854 GCTGGAGACCACCCTGCCACTGG - Intergenic
1184523634 22:45009367-45009389 GCTGGAGCCTGCCCGGGGGCGGG - Intronic
1184664257 22:45978954-45978976 ACCGGCGGCCTCCCTGCGGCGGG + Intergenic
1184669891 22:46007045-46007067 GCAGGAGGCCCCCCTGGGCCAGG + Intergenic
1185203487 22:49523024-49523046 GCTGAAGGCCGTCCTGGGGTGGG + Intronic
1185334255 22:50264541-50264563 TCTGGAGGACGCGCTGGGGCCGG - Exonic
950532996 3:13563841-13563863 TCTGGAGGCGACCCTGGGGCGGG + Intronic
951122396 3:18944154-18944176 GCTGGAGGCCTCCTTGGGGAAGG - Intergenic
952611539 3:35216067-35216089 GCTGGAAGCCGCCCTGCAGCGGG - Intergenic
953404617 3:42654320-42654342 GGTGGAGGGCAGCCTGCGGCAGG + Intronic
953571531 3:44075590-44075612 GCTGCAGGCTGCCCTACAGCTGG + Intergenic
953928927 3:46996432-46996454 GCTGGTGGCCCCCCTGCAGGAGG + Exonic
953930171 3:47002009-47002031 GCTGGAGGCTGCACTGGGGCGGG + Exonic
955397506 3:58567416-58567438 GCAGGAAGCAGCCCTGAGGCTGG - Intronic
955839474 3:63096737-63096759 GCTGGAGGCCGCCCTGCAGCGGG - Intergenic
957966181 3:87324328-87324350 GCTGGGGCCCGCCCTGCAGTGGG + Intergenic
960947780 3:122978668-122978690 CCTGGAGGCTGCCCAGCGGAGGG - Intronic
961554461 3:127688652-127688674 GCTGGAGGATGCCCAGCAGCAGG + Intergenic
961810526 3:129519209-129519231 GATGGAGGCTGCCCTCCTGCAGG - Intronic
962601240 3:136992266-136992288 GCAGGAGTCCACCCTGGGGCTGG + Intronic
962632582 3:137294375-137294397 GCTGGTGGGCGCCCTGCAGGAGG - Intergenic
962712809 3:138101846-138101868 GCTGGAGGGCGCCCTGCAGCGGG - Intronic
965605784 3:170496496-170496518 GCTGGAGGCCGCCCTGCAGCGGG + Intronic
968666074 4:1823047-1823069 GCTGGAGGCCACGCTGCAGGAGG - Exonic
968751191 4:2389903-2389925 GCAGGAGGCAGCTCTGAGGCTGG - Intronic
969605727 4:8201408-8201430 GCTGGAGGCTGGCCTGGGGCTGG + Intronic
969652787 4:8477792-8477814 GCTGGAGCTCTCCCTGCAGCAGG + Intronic
972725822 4:41745952-41745974 GCTGGAGGCCTGGCTGCGGCTGG - Exonic
977928666 4:102729087-102729109 GCTGGAGGCCGCCCTGCAGCAGG - Intronic
978600081 4:110418739-110418761 GGTGGAGGCCGCTGTGGGGCAGG + Intronic
982288756 4:153759802-153759824 GCTGGAGGCCCCCCCGCAGCAGG - Exonic
984928230 4:184825554-184825576 GCCGGAGGCCGCGCTTCGGCTGG - Intronic
985542850 5:494817-494839 CCTGGAGGCTGCCCAGCCGCTGG + Intronic
985632624 5:1021938-1021960 GCTGCAGGCGGCCCTGGGGGAGG - Intronic
985789030 5:1915546-1915568 CATGGGGGCCGCCCTGCGTCTGG + Intergenic
986249504 5:6043778-6043800 TCTGGAGTCCGCCCTGTGGGTGG - Intergenic
987578538 5:19759735-19759757 GCTGGAGGCCTCCTTGGGGAAGG + Intronic
988609215 5:32710105-32710127 GCGGGAGTCCGCCGCGCGGCGGG - Intronic
989459565 5:41682016-41682038 GCTGGATGCCTCACTGTGGCTGG - Intergenic
994320797 5:98392442-98392464 GCTGGAGGCTGCCCCGCAGCCGG - Intergenic
995798136 5:115962680-115962702 GCTGGTAGCCGCCCTCCTGCTGG + Exonic
996432904 5:123401257-123401279 GCTGGAGGCCGCCCTGCAGCGGG - Intronic
999191218 5:149748864-149748886 GCTGGAGGCTGCTCTGCAGAAGG + Intronic
999204241 5:149836765-149836787 GCTGGAGACCGCCCTGGAGGAGG + Exonic
999322723 5:150625132-150625154 GCGGGAGGACGCCCTGACGCCGG + Intronic
999449458 5:151667374-151667396 GCAGGATGCCGCCCTGCAGCTGG + Intronic
1001452312 5:171836239-171836261 GCTGGAGACGGCCTTTCGGCAGG - Intergenic
1002496917 5:179621912-179621934 GCTGGAAGCCGCCTTGCAGGGGG - Intronic
1002567593 5:180120442-180120464 GCTGGAGGCAGCGCTGGGCCAGG - Intronic
1005315512 6:24599417-24599439 GCTGGAGGCCACCCTGCAGTGGG + Intronic
1005421535 6:25656228-25656250 TGTGGAGGCCTCCCTGCTGCTGG - Intronic
1006230743 6:32584398-32584420 TCAGGAGGCCGCCCTGTGACCGG - Intronic
1006256693 6:32838095-32838117 GCTGGAGGGGACCCTGCGGCTGG - Exonic
1006311432 6:33263960-33263982 ACTGGAAGCAGCCCTGCTGCTGG + Intronic
1007336423 6:41158190-41158212 GCTGGAGGGGGCCTTGGGGCAGG + Intergenic
1007927680 6:45663353-45663375 CCCGGAGGCCGCCCCGCGTCTGG + Intronic
1010108193 6:72192338-72192360 GCTGGAGGTCTCCCTGGGGAAGG + Intronic
1015539185 6:134297337-134297359 GCTGGAGGCCGCCCTGCAGCGGG - Intronic
1017822264 6:158057881-158057903 GCTCCAGGCAGCCCTGGGGCGGG - Intronic
1018317268 6:162569341-162569363 GCTGGAGGCTGCCCTGCAACAGG + Intronic
1018746259 6:166764536-166764558 GCTGGAGGAGGCCATGCCGCAGG + Intronic
1019014628 6:168871015-168871037 GCTGGAGGTCGGCGTGTGGCCGG + Intergenic
1019469532 7:1211372-1211394 GCTGGAGGCCGAGCTGAGACAGG + Intergenic
1019681858 7:2354991-2355013 GCTGGCGGCGGCTCGGCGGCCGG - Exonic
1021729957 7:23586401-23586423 GATGGCGGCGGCACTGCGGCCGG + Intergenic
1022164021 7:27740299-27740321 GCTGGAGGCCGCCCCGCACAAGG - Intronic
1022704482 7:32789700-32789722 GCTGCAGGTCGCCCTGTGCCTGG + Intergenic
1022908654 7:34879444-34879466 GCTGCAGGTCGCCCTGTGCCTGG + Intergenic
1024222694 7:47300832-47300854 GCTGAGGGCCTCTCTGCGGCCGG - Intronic
1024234944 7:47390911-47390933 GCTGGAGGACGCCCTCTGGGAGG - Intronic
1025155082 7:56597758-56597780 GCTGAAGGCTGCCCTGAGGTGGG - Intergenic
1028477154 7:91265063-91265085 GCTGGAGGCTCCGCTGCTGCTGG + Exonic
1029444331 7:100604263-100604285 GCTGGGGGCGGGGCTGCGGCCGG - Intronic
1029537255 7:101163913-101163935 GGTGGAGGCCGGGCGGCGGCAGG - Exonic
1029649284 7:101879789-101879811 GCTGGACGCTGCCTTGGGGCAGG - Intronic
1032097742 7:128947823-128947845 GCTGGAGGCCACCCAGGAGCAGG + Exonic
1034174808 7:149091443-149091465 CCTGCAGGCGGCCCTGAGGCCGG - Intergenic
1034201716 7:149286935-149286957 GGTGGAGACCACCCTGGGGCTGG + Intronic
1034437075 7:151067815-151067837 GCCGGAGGCAGCCCTGGGGTGGG - Intronic
1035635770 8:1143067-1143089 GCTGGTGGCCCCGCTGTGGCCGG - Intergenic
1036642198 8:10591623-10591645 GCTGGAGACTGCGCTGCGGCGGG + Intergenic
1036676732 8:10839993-10840015 GGCGGTGGCCGCCCTGCGGGAGG + Intergenic
1036682385 8:10885144-10885166 GCTGACTGCCTCCCTGCGGCAGG + Intergenic
1039525349 8:38209759-38209781 GCTGGAACCTGCCCTGTGGCAGG - Intronic
1040545799 8:48397007-48397029 GCTGGCGGGCGGCCTGCGGCAGG - Intergenic
1040799005 8:51320867-51320889 GCTGGAGGCACGCCTGAGGCAGG - Exonic
1041781150 8:61579284-61579306 GCTGGAGGCTGCCCTGCAGCGGG + Intronic
1042859154 8:73295448-73295470 GCTGGAGTTCGCCCGGCGTCGGG + Exonic
1045098721 8:98825300-98825322 GCCGGAGCCTCCCCTGCGGCCGG - Intronic
1045738002 8:105318810-105318832 CCTGGAGTCCGGCCGGCGGCGGG + Exonic
1046002880 8:108443206-108443228 GCAGAAGGCTGCACTGCGGCCGG + Intergenic
1049614510 8:143570247-143570269 CCTGGAGGGCGTCCTGCTGCTGG - Exonic
1049695747 8:143983614-143983636 GGAGGAGGCCGCTCTGCAGCTGG - Exonic
1049800235 8:144514271-144514293 ACTGGAGGCAGCTGTGCGGCTGG + Exonic
1050334208 9:4574970-4574992 ACTGGAGGCCACCCTGCTGTAGG + Intronic
1052781223 9:32783415-32783437 GAGGGAGGCCACCCGGCGGCAGG - Intergenic
1054745961 9:68853958-68853980 GCTGGAGGCCGGCTTGTGCCAGG + Intronic
1054810705 9:69431541-69431563 CCTGGAGGCCACCCTGGGTCAGG - Intronic
1056386315 9:86099697-86099719 GCCGGTGGCCGCCCCTCGGCGGG + Intronic
1056552020 9:87660023-87660045 GCTGGGGGCGCCCCTGCGGGAGG + Intronic
1056760132 9:89408674-89408696 GGAGGAGGCAGGCCTGCGGCAGG + Intronic
1057432209 9:95004861-95004883 GCGGGAGGGCGACCTGCGGGAGG + Intronic
1057695041 9:97317124-97317146 GATGGAGTCCACCCTGCAGCAGG + Exonic
1057825683 9:98370572-98370594 GCAGGTGGCCGGCCTGCTGCAGG + Intronic
1057943659 9:99306224-99306246 GCTGGAGGCCGCCCTGCAGCGGG + Intergenic
1059268769 9:113059971-113059993 GCAGGAGGCCGCCGTCCTGCAGG + Intergenic
1059269905 9:113065420-113065442 GCAGGAGGCCGCCGTCCTGCAGG + Intergenic
1059271039 9:113070868-113070890 GCAGGAGGCCGCCGTCCTGCAGG + Intergenic
1059272172 9:113076314-113076336 GCAGGAGGCCGCCGTCCTGCAGG + Intergenic
1059273307 9:113081756-113081778 GCAGGAGGCCGCCGTCCTGCAGG + Intergenic
1059274443 9:113087202-113087224 GCAGGAGGCCGCCGTCCTGCAGG + Intergenic
1061009854 9:127948463-127948485 GCTGCAGGGGGCCCTGCGCCTGG - Intronic
1062048710 9:134436386-134436408 ACTGGAGGCCTCCCTGGGGATGG - Intronic
1062181040 9:135191477-135191499 GCTGGGGGCCATCCTGAGGCTGG + Intergenic
1062474308 9:136719816-136719838 GCAGGAGGCTGCCCTGCTCCTGG - Intronic
1062529868 9:136995132-136995154 GCGGGAGGGCGCCCTGGGCCTGG - Intronic
1186426419 X:9466323-9466345 GCTGGAGGCCCGCCTGCGCTGGG + Intronic
1189893776 X:45632652-45632674 GCTGGAGGCCGTTCTGCAGCGGG - Intergenic
1191220772 X:57985746-57985768 GCTGGAGGCTGCCCTGCAGCGGG + Intergenic
1192246582 X:69378141-69378163 GCTGGAGGCCAGGCTGCTGCTGG - Intergenic
1192429120 X:71100802-71100824 CATGGAGGCGGCCCGGCGGCGGG - Exonic
1193500411 X:82267131-82267153 GGCGGAGGCAGCCCTTCGGCGGG - Intergenic
1197718557 X:129728223-129728245 GCTGGGGGCTGGCCTGGGGCTGG + Intergenic
1198619204 X:138488025-138488047 GCTGGAGGCAGCCCCGCAGGGGG - Intergenic
1199682730 X:150238883-150238905 GCAGGAGGCCGCACTGGTGCAGG - Intergenic
1199927275 X:152480637-152480659 GCTGGAGGCCACCCTGCAGCGGG + Intergenic
1200144974 X:153921747-153921769 GCTGCAGGGCGAGCTGCGGCGGG - Exonic