ID: 1129597922

View in Genome Browser
Species Human (GRCh38)
Location 15:76979369-76979391
Sequence CCGAGCTGGAGGCCGCCCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 209}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129597922_1129597929 25 Left 1129597922 15:76979369-76979391 CCGCAGGGCGGCCTCCAGCTCGG 0: 1
1: 0
2: 2
3: 22
4: 209
Right 1129597929 15:76979417-76979439 AGCCAGCTCCCCGCGCTGCTCGG 0: 1
1: 1
2: 9
3: 26
4: 194
1129597922_1129597927 -8 Left 1129597922 15:76979369-76979391 CCGCAGGGCGGCCTCCAGCTCGG 0: 1
1: 0
2: 2
3: 22
4: 209
Right 1129597927 15:76979384-76979406 CAGCTCGGACAACTTGGCATTGG 0: 1
1: 4
2: 11
3: 15
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129597922 Original CRISPR CCGAGCTGGAGGCCGCCCTG CGG (reversed) Intergenic
900366693 1:2314611-2314633 CCGGGCCGGAAGCCGCGCTGGGG + Intergenic
900376231 1:2356051-2356073 CCGACCTGGCTGCCGCACTGGGG - Intronic
900556829 1:3284847-3284869 CAGAGCTGGAGGCCGGGCTGAGG + Intronic
900958951 1:5907190-5907212 CCCAGCTGGCGGCCTCCCCGCGG - Exonic
901325656 1:8363842-8363864 CAGAGCAGGATGCCACCCTGGGG + Intronic
901506926 1:9690653-9690675 CCAAGCTGGAGTCCTCCCTGCGG - Intronic
901882671 1:12203333-12203355 CCCACCTGGAGGCGGCCCAGAGG - Intronic
902241151 1:15090336-15090358 CCAGGCTGGAGGCCTCCCGGGGG + Intronic
904500205 1:30908798-30908820 CCGCGCTGGGGGCGGCCCGGCGG - Intergenic
904905650 1:33895604-33895626 CAGAGCTTGAGCCCGCCCTCTGG + Intronic
905358315 1:37400543-37400565 CCCAGCTGGAGGGGGCCTTGAGG - Intergenic
906319142 1:44805947-44805969 CCTAGGAGGAGGCCCCCCTGGGG - Exonic
906475774 1:46168498-46168520 CAGGGCTGGAGGCAGCCCTGGGG - Intronic
906550979 1:46666330-46666352 CAGAGCTGCAAGCAGCCCTGGGG + Intronic
911378352 1:97079789-97079811 CAGAGCTGGAGGCCTGGCTGTGG - Intronic
912845795 1:113073596-113073618 CCGAGCTGGAGGGCGCTGTCGGG + Exonic
915148735 1:153811817-153811839 CCACGCTGGAGGCTGCTCTGGGG + Exonic
916071989 1:161175848-161175870 AGGAGCTGGAGGACCCCCTGGGG + Exonic
920196245 1:204229045-204229067 CCAACCTGGAGGCAGCCCTGCGG - Exonic
920223977 1:204424734-204424756 CCGAGCTGGAGGCCTGCCCAGGG + Exonic
922029251 1:221782114-221782136 CAGAGTTGGAAGCTGCCCTGAGG + Intergenic
922109574 1:222543888-222543910 CAGAGCTGCAGGCAGCCCTGAGG + Exonic
923591838 1:235327341-235327363 CCGAGCGAGAGGCCGGCCGGGGG + Intronic
1062884625 10:1006852-1006874 CCCAGGTGGAAGCGGCCCTGAGG - Intronic
1065814220 10:29470063-29470085 CCGACTTGGGGGCCGCTCTGAGG - Intronic
1069569812 10:69487514-69487536 CAGAGCTCCCGGCCGCCCTGAGG + Intronic
1070577150 10:77687771-77687793 CCGAGCTGGAGTTGGCCCTGAGG - Intergenic
1070787827 10:79172261-79172283 CCCAGCTGGGAGCCTCCCTGGGG + Intronic
1071598194 10:86942969-86942991 CCCTGCTGGAGGACGCGCTGCGG - Exonic
1076053205 10:127351637-127351659 CCGGGCTGGTGGCAGTCCTGGGG - Intronic
1076325331 10:129616373-129616395 CAGAGCAGGAGGCAGCCATGTGG + Intronic
1076988557 11:257126-257148 CAGAGGTGGAGGCCTCCCTCGGG - Intergenic
1077141489 11:1026796-1026818 ACGAGGTGGAAGCGGCCCTGTGG - Intronic
1078709933 11:13781357-13781379 CCCAGCTGGAGGCCACTCTGTGG - Intergenic
1080590546 11:33719742-33719764 CAGAGCTGGCGGCAGCCCTGGGG + Intronic
1081910683 11:46697934-46697956 CCCAGCTGGAGGTCGCTATGGGG - Intronic
1083310721 11:61782289-61782311 CTGCGCTGGGGGCTGCCCTGGGG + Intronic
1083618054 11:64036047-64036069 CAGAGCCGGAGGGCGCCCAGGGG - Intronic
1083664816 11:64268668-64268690 CCGCCCTGGAGCCCGCACTGTGG - Exonic
1083693763 11:64428899-64428921 CAGAGCTGGAGGCAGCCGGGAGG - Intergenic
1083856937 11:65397662-65397684 CTGAGCTGGGGGCGGCACTGTGG + Intronic
1084536913 11:69762707-69762729 CCTGGCTGCAGGCTGCCCTGGGG - Intergenic
1084617387 11:70245561-70245583 CACAGGTGGTGGCCGCCCTGGGG - Intergenic
1088597385 11:111450470-111450492 CCGAGCCACAGGCCTCCCTGTGG - Intronic
1089124783 11:116169265-116169287 CTGAAATGGAGGCAGCCCTGGGG + Intergenic
1089149965 11:116356968-116356990 CCAAGCTGGAGCCCACCCTTGGG + Intergenic
1089198852 11:116711275-116711297 TGGAGGTGGAGGCCGGCCTGTGG - Intergenic
1089615253 11:119691460-119691482 CTGAGCTGAAGGCTGCTCTGCGG + Intronic
1091038304 11:132253819-132253841 CCGAGCTGAGGGCAGGCCTGAGG - Intronic
1091385838 12:94094-94116 CCTAGCTGGTGGACTCCCTGAGG + Intronic
1091777298 12:3192776-3192798 CAGAGCTGAGGGCCTCCCTGAGG + Intronic
1096148978 12:49296962-49296984 CCGAGCTGACGGCAGCGCTGAGG + Exonic
1096617159 12:52839883-52839905 ACGAGCTGGAGGCTGCTCTGAGG - Exonic
1103713363 12:122929217-122929239 CCGGGCTGGGGGCACCCCTGAGG + Exonic
1103942032 12:124506405-124506427 CCGAGCTGGCTGCCGTCCAGCGG - Intronic
1103991060 12:124799832-124799854 GTGAGCTGGAGGCAGCCCTCTGG - Intronic
1104442971 12:128810409-128810431 CCGAGCTGGCAGCTGCGCTGGGG - Intronic
1105472054 13:20703718-20703740 CCGAGCCGGGGGCCGCACGGGGG - Intronic
1106135114 13:26968017-26968039 CAGAGCTGGGGGCAGCCCTGCGG - Intergenic
1113614114 13:111669079-111669101 CGGGGCTGGTTGCCGCCCTGTGG + Intronic
1113619581 13:111753993-111754015 CGGGGCTGGTTGCCGCCCTGTGG + Intergenic
1113804954 13:113107199-113107221 CAGAGCCGGTGACCGCCCTGGGG - Intronic
1113947233 13:114051139-114051161 CCAAGCTGGGGGTCCCCCTGGGG + Intronic
1114702443 14:24692890-24692912 TTGAGCTGGAAGCAGCCCTGGGG + Intergenic
1116863537 14:50013439-50013461 GAGAACTGGAGGCCTCCCTGGGG - Intergenic
1117911560 14:60642371-60642393 CCGGGCTGGTCCCCGCCCTGTGG - Intergenic
1121275796 14:92666813-92666835 CCGAGCAGGAGGCATCCCAGAGG + Intronic
1121345947 14:93136032-93136054 CTAAGACGGAGGCCGCCCTGAGG + Intergenic
1122047861 14:99036193-99036215 CCGGGCTGCAGGCAGCCCCGTGG + Intergenic
1122066907 14:99180134-99180156 GTGAGCTGGAGGCTGCACTGTGG + Intronic
1122254709 14:100468284-100468306 CCGAGCACGAGCCCACCCTGAGG - Intronic
1122834413 14:104423936-104423958 CCCAGCTGGAGGGCAGCCTGGGG - Intergenic
1122862693 14:104589584-104589606 CAGAGCTGAAGGGAGCCCTGTGG + Intronic
1123031899 14:105455912-105455934 CTGTGCTGGAGCCCGGCCTGTGG + Intronic
1123036722 14:105474703-105474725 CCGGGCTGGGGGCCGCCTGGGGG - Intronic
1125546690 15:40511541-40511563 CGGAGCTTGGGGCCGCGCTGGGG - Intergenic
1126793745 15:52243551-52243573 CTGAGCTGGAGGCTGAACTGTGG - Intronic
1126800443 15:52293212-52293234 GGGAGCTGGAAGCCACCCTGTGG - Intronic
1128459696 15:67857368-67857390 CTCAGCTGGAGGCCTCGCTGGGG + Intergenic
1129321982 15:74780594-74780616 CCCAGCTGGAGCCAGCCCTTTGG - Intergenic
1129597922 15:76979369-76979391 CCGAGCTGGAGGCCGCCCTGCGG - Intergenic
1129784567 15:78300651-78300673 CCATTATGGAGGCCGCCCTGTGG + Intergenic
1131979563 15:97981619-97981641 CCGAGCTAGGGGCCTCTCTGAGG - Intergenic
1132111619 15:99105819-99105841 GCGAGCTGGAGGAGGCGCTGCGG + Exonic
1132583232 16:694739-694761 CCGAGGCGGAGGGCACCCTGGGG + Intronic
1132747433 16:1442879-1442901 CCGAGCAAGAGGCCGGCCTCAGG - Exonic
1132749893 16:1452691-1452713 GCCTCCTGGAGGCCGCCCTGTGG + Intronic
1132803405 16:1764959-1764981 CCGAGCTTGAGGCTACCCGGTGG - Intronic
1132892302 16:2210322-2210344 CAGAGCTGGAGGCTGTGCTGGGG - Intronic
1133885556 16:9824340-9824362 CCGAGCAGGCGGCTGCCATGAGG - Intronic
1135984760 16:27175962-27175984 CCTAGGTGGAGGCCACCATGTGG + Intergenic
1136618181 16:31411021-31411043 CCCAGCCAGAGGCAGCCCTGTGG - Intronic
1137730605 16:50686899-50686921 CCAGGCTGGAGGCTGCTCTGTGG + Intergenic
1138506283 16:57479873-57479895 CCGAGGTGGAGGCGGCAGTGAGG + Intronic
1139582310 16:67880818-67880840 CCGAGCTGGGGGCCGAGCTCGGG - Exonic
1141598225 16:85110274-85110296 CCGAGCTGCGGGCCACCATGAGG - Exonic
1141978380 16:87533737-87533759 CTGAAGTGGAGGCCGTCCTGTGG - Intergenic
1142120835 16:88386018-88386040 CCCAGATGGAGGCCGCCATAGGG + Intergenic
1142156099 16:88533476-88533498 CCGGGCTGGAGCCCGGCGTGGGG - Exonic
1142906764 17:3048884-3048906 CGCAGCTGGATGTCGCCCTGTGG - Intergenic
1144599481 17:16599755-16599777 CTGAGTTGGAGACAGCCCTGGGG + Intergenic
1145881845 17:28357765-28357787 CCGAGCTTGAGGCCGCGCTGGGG + Exonic
1146057292 17:29587918-29587940 CCGAGCTGCAGGCAGGTCTGGGG - Intronic
1147159834 17:38563319-38563341 ACGAGCTGGAGGACGTCCGGTGG - Exonic
1148125227 17:45233261-45233283 GGGAGCTGGAGACCTCCCTGAGG + Exonic
1148158765 17:45438003-45438025 CTGGGCTGGAGGTTGCCCTGTGG + Intronic
1148495006 17:48048370-48048392 CCGAGCTCTAGGCCGGCCGGCGG + Exonic
1148865085 17:50624189-50624211 CCAGGCTGGAGGCTCCCCTGAGG - Intronic
1150013792 17:61532770-61532792 CCGAGCTGGAGGCCAAACTGTGG - Intergenic
1152032483 17:77852973-77852995 GCGAGGAGGAGGGCGCCCTGTGG + Intergenic
1152420702 17:80191492-80191514 CCGAGCTGGAGGCCAGGCAGGGG + Intronic
1152726146 17:81947359-81947381 CCGGGTTGGAGGACGCCCAGCGG + Intergenic
1156275227 18:35577724-35577746 GCGAGGTGAAGGCAGCCCTGGGG - Intergenic
1156308805 18:35904413-35904435 CCGATCTGGAGGCGGTCCAGTGG + Intergenic
1160495012 18:79368114-79368136 GTGAGCTGGAGGGCGCCATGGGG + Intronic
1160743602 19:699482-699504 CCGAGCTCCTGGCAGCCCTGAGG + Intergenic
1160866184 19:1257176-1257198 CCAAGCCGGAGGCCTCGCTGGGG - Exonic
1161179198 19:2867892-2867914 CTGGGCTGGAGTCCGGCCTGCGG - Intronic
1161219921 19:3113769-3113791 CGGTGCTGGAGCCCGGCCTGTGG + Intronic
1161428490 19:4217394-4217416 CGGAGCTGGAGGCGGCCCTGGGG + Exonic
1162127209 19:8506097-8506119 GGGAGGTGGAGGGCGCCCTGCGG - Intergenic
1162379157 19:10321572-10321594 CCAGGCTGGAGGGCGCCCAGGGG + Exonic
1163282351 19:16325433-16325455 CCGAGCTGGATGCGCCGCTGGGG + Exonic
1163850981 19:19663505-19663527 ACGAGCTGGTGGCTGCCGTGTGG - Exonic
1164575658 19:29404014-29404036 CAGAGCTGGAGGCACTCCTGGGG - Intergenic
1165282252 19:34807389-34807411 CTGGGCTGGAGGCTGCCATGTGG - Intergenic
1166095200 19:40534108-40534130 CCGAACTGGCGGCCTCCGTGCGG + Exonic
1166792204 19:45405020-45405042 CCGAGCTGGAGGAAGCCCCCAGG - Intronic
1166873885 19:45885874-45885896 CCGAGCCGGAGGCCGGACCGTGG - Exonic
1168354194 19:55691849-55691871 CCGAGGTGGGGGCAGCCGTGGGG - Exonic
924962192 2:45687-45709 CCGAGGTGGTGGAGGCCCTGGGG - Exonic
927157072 2:20226521-20226543 CCGAGCTCGAGGAGTCCCTGTGG + Intergenic
927900223 2:26813656-26813678 CAGAGCTGGAGGTCACCCCGGGG - Intergenic
929614225 2:43295875-43295897 CCCAGATGGTGGCCTCCCTGGGG - Intronic
929778548 2:44943203-44943225 CCGAGCTGGCGGCAGGGCTGAGG - Intronic
930071599 2:47370052-47370074 CGGCCCTGGAGGCCTCCCTGCGG - Intronic
934574027 2:95389357-95389379 AGGAGCTGGAGGCCGCGGTGGGG - Intergenic
938310786 2:130287085-130287107 CAGAGTTGGAGGCCAGCCTGCGG + Intergenic
943328327 2:186528229-186528251 CCGAGTTCGAGGCCAGCCTGGGG - Intergenic
947119451 2:226799945-226799967 CGGAGCTGGCGGCCGCGCAGGGG - Intergenic
948640232 2:239371061-239371083 CCCAGCTGGGGCCTGCCCTGTGG - Intronic
948807436 2:240459111-240459133 CCGAGCTGGAGACCGCGCTCCGG + Exonic
1169405275 20:5316756-5316778 CCGCGCTGGACTCCGCCCCGGGG + Intergenic
1170617987 20:17969294-17969316 CAGAGCTGGTGGCGGCGCTGAGG - Intronic
1171498768 20:25577195-25577217 CCGGGCTGCAGCCCGCCCTCTGG + Intronic
1172042693 20:32057144-32057166 TGGAGCTGGGGGCTGCCCTGGGG + Intronic
1172117428 20:32581287-32581309 CCCAGCTGCAGGAGGCCCTGTGG + Intronic
1172966066 20:38836137-38836159 CCCTGCTGGAGGCCTCGCTGAGG + Exonic
1174287668 20:49483942-49483964 CCCAGGAGGCGGCCGCCCTGGGG - Intergenic
1174573014 20:51516789-51516811 TCCAACTGGAGGCCACCCTGTGG - Exonic
1175963227 20:62647530-62647552 CCCAGCTCCAGGCCTCCCTGGGG + Intronic
1176128242 20:63485446-63485468 CCCACCTGGAGGGGGCCCTGTGG + Intergenic
1180201950 21:46229425-46229447 GGGGGCGGGAGGCCGCCCTGAGG + Intergenic
1180614586 22:17119464-17119486 CCCAGCTGGGAGCCTCCCTGAGG + Exonic
1181996530 22:26887186-26887208 GCGAGCTGGACGCCACCATGGGG - Intergenic
1183733118 22:39629330-39629352 CCCCGCTGAAGGCCGCTCTGTGG + Intronic
1184366793 22:44056920-44056942 CCGAGCTGGGGGCTGAGCTGGGG + Intronic
1185122845 22:48982783-48982805 GGGAGCTGGAGGCAGGCCTGGGG + Intergenic
1185151288 22:49165064-49165086 CCGAGCTGGAGTCCGTCTGGTGG - Intergenic
1185203485 22:49523020-49523042 CACAGCTGAAGGCCGTCCTGGGG + Intronic
1185380714 22:50506448-50506470 CCGTGCTGGTGGCCCCGCTGAGG - Exonic
950868959 3:16212654-16212676 TCGACCAGGAGGCCACCCTGAGG + Exonic
953238408 3:41126284-41126306 TTGAGCTGGAGGCCTCCCAGAGG + Intergenic
953930169 3:47002005-47002027 CCAAGCTGGAGGCTGCACTGGGG + Exonic
955105795 3:55896375-55896397 CCCAGCTGGAAGATGCCCTGTGG + Intronic
961683060 3:128611825-128611847 CAGAGATGGAGGCTGACCTGAGG - Intergenic
961831996 3:129627626-129627648 GCGGGGTGGAGGCAGCCCTGCGG + Intergenic
962317431 3:134367581-134367603 CCCAGATGGAGGCCGTGCTGAGG - Exonic
966473950 3:180322925-180322947 GGGTGCTGGAGGCCGGCCTGGGG + Intergenic
967959435 3:194908677-194908699 CAGAGCTGGAGGGAGCTCTGGGG - Intergenic
968229107 3:196994198-196994220 CAGAGCTGCAGGCCGTCCTCAGG - Intronic
968504949 4:967347-967369 CCCTGCAGGAGGCCGCACTGCGG - Exonic
968519584 4:1029495-1029517 CTGGCCTGGGGGCCGCCCTGAGG - Intergenic
968572235 4:1347731-1347753 CCTTGCTGGAGGCTGCCCTGCGG + Exonic
969206163 4:5647866-5647888 CAGAGTTGGAGAACGCCCTGTGG + Intronic
969605726 4:8201404-8201426 CGGGGCTGGAGGCTGGCCTGGGG + Intronic
973271724 4:48269419-48269441 CCAGGCCTGAGGCCGCCCTGCGG - Intronic
973317639 4:48779346-48779368 CGGAGCCGGAGCCAGCCCTGCGG - Intronic
978583073 4:110251540-110251562 CCCAACTGGAGGCCACCCTCAGG - Intergenic
985661610 5:1160006-1160028 CAGACCTGGAGGCCCTCCTGGGG + Intergenic
987230126 5:15885257-15885279 CCGTGCTGGAACCTGCCCTGTGG - Intronic
987235367 5:15936747-15936769 CCAAGCTGGAGTCCCGCCTGCGG + Exonic
989146732 5:38257773-38257795 CCCAGCTGGGCGCCGCCCAGGGG + Intergenic
989459566 5:41682020-41682042 CTGAGCTGGATGCCTCACTGTGG - Intergenic
991407751 5:66318397-66318419 CCAAGCTGGAGGGCGACCTATGG + Intergenic
992449070 5:76859458-76859480 CAGAGCTGGATGCGGTCCTGAGG - Intronic
997030405 5:130120983-130121005 CCCAGATGGAGGAAGCCCTGTGG - Intronic
999368087 5:151035808-151035830 CAGAGCTGGGGGTCGCCATGGGG + Intronic
1001941332 5:175741823-175741845 CCCAGCGGGAGGCTGCCCTGAGG + Intergenic
1002709988 5:181189613-181189635 CTGTGCTGGAGGCGGCCCGGGGG - Intergenic
1002896554 6:1383340-1383362 ACGAGGAGGAGGCTGCCCTGGGG + Intergenic
1006340393 6:33443450-33443472 CCGAGGTGGAGAGCCCCCTGGGG + Exonic
1016286092 6:142474599-142474621 CGGCGCTGGGCGCCGCCCTGCGG - Intergenic
1019014957 6:168873481-168873503 CCGAGCTGGCGGCCGGCCGCTGG + Intergenic
1019424122 7:965458-965480 CCGACCTGGGGGCGTCCCTGAGG - Intronic
1019542123 7:1556199-1556221 CCCAACTGGAGGCCCCACTGTGG + Exonic
1020210386 7:6154238-6154260 AGGAGCTGGCGGCCGCTCTGCGG - Exonic
1023000288 7:35801344-35801366 CCGAGCTAGGGAACGCCCTGAGG + Intronic
1023834066 7:44058287-44058309 CAGAGGTGGAGGCTGGCCTGGGG + Intronic
1023834652 7:44061036-44061058 CCAAGCCGGAGGGAGCCCTGAGG - Exonic
1024580032 7:50793593-50793615 CCGCGCTGGCGGCCGCCGAGCGG - Intergenic
1027071477 7:75162787-75162809 CAGAGCTGGAGTCCTCCCAGGGG + Intergenic
1029386803 7:100248739-100248761 CGGAGCTGGAAGCCATCCTGGGG - Intronic
1032395445 7:131586222-131586244 CCAAGCTGGAGCCCTTCCTGGGG - Intergenic
1032455516 7:132070576-132070598 CCAAGCTGGAGGGATCCCTGAGG + Intergenic
1032668854 7:134065433-134065455 CTCAGCTGGAGGCCGCACAGAGG - Exonic
1034400044 7:150856319-150856341 CCAAGCTGGAGGCTGTCCTGGGG - Intronic
1034437077 7:151067819-151067841 CAGAGCCGGAGGCAGCCCTGGGG - Intronic
1035130890 7:156651988-156652010 CCAAGGAGGAGGCCGCCATGAGG - Intronic
1036757067 8:11477604-11477626 CCAAGCTGGAGACAGCCCTGTGG - Intergenic
1037788945 8:21919858-21919880 CCGAGCCGGCTGGCGCCCTGTGG - Intronic
1038229258 8:25685386-25685408 CCGAGATGGAGGCCACCCATGGG - Intergenic
1038275094 8:26114786-26114808 AAGAGCTGGAGGCCTCCCTGGGG + Intergenic
1038850370 8:31269515-31269537 CCGAGCTGGTGGCCTGGCTGAGG + Intergenic
1044927539 8:97222284-97222306 CCTAGCTGGAGTCAGCTCTGGGG + Intergenic
1049005074 8:139849887-139849909 CCGACCTGAAGGAGGCCCTGAGG + Intronic
1049291929 8:141807974-141807996 CCCAGCTGGAGGCTGCACAGAGG - Intergenic
1051911316 9:22155490-22155512 CCTACCTGGAGCCCGCCCTAGGG + Intergenic
1053309893 9:37011226-37011248 CCGGGCTGGAGGTGGCCCTGGGG - Intronic
1057266729 9:93622277-93622299 CCGAGCCTGAGGTCACCCTGAGG + Intronic
1060423785 9:123488035-123488057 CCCAGCAGGAGGACACCCTGTGG - Intronic
1060558130 9:124520292-124520314 CCGAGCCGGAGCCTGACCTGTGG - Exonic
1060599690 9:124869552-124869574 GGGAGCTGGAGGCTGACCTGAGG - Intronic
1060965740 9:127711534-127711556 CAAGGCAGGAGGCCGCCCTGGGG + Intronic
1061884914 9:133586554-133586576 CCCAGCTGGAGAGCCCCCTGGGG + Intergenic
1061985418 9:134127569-134127591 CCCAGATGGAGCCCTCCCTGAGG + Intergenic
1062232992 9:135493036-135493058 CCTCGCTGGAGCCCGCCTTGGGG - Intergenic
1062579425 9:137222793-137222815 GCGGGGTGGAGGCGGCCCTGAGG + Intergenic
1185789491 X:2918076-2918098 CCGAAGTGGACGCCGCCCTGAGG - Exonic
1186220456 X:7344279-7344301 CTGTGCTGGAGGCTGCCCTGTGG + Intronic
1197649959 X:129053714-129053736 CTGAGATGGAGGCCTTCCTGGGG + Intergenic
1199847619 X:151702441-151702463 CCAAGCTGGTGGCCTCACTGGGG - Exonic
1199996133 X:153028012-153028034 CCACTCTGGAGGCCGCCTTGAGG - Intergenic
1201285242 Y:12373795-12373817 CTGAAGTGGACGCCGCCCTGAGG + Intergenic