ID: 1129597927

View in Genome Browser
Species Human (GRCh38)
Location 15:76979384-76979406
Sequence CAGCTCGGACAACTTGGCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 4, 2: 11, 3: 15, 4: 73}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129597922_1129597927 -8 Left 1129597922 15:76979369-76979391 CCGCAGGGCGGCCTCCAGCTCGG 0: 1
1: 0
2: 2
3: 22
4: 209
Right 1129597927 15:76979384-76979406 CAGCTCGGACAACTTGGCATTGG 0: 1
1: 4
2: 11
3: 15
4: 73
1129597919_1129597927 5 Left 1129597919 15:76979356-76979378 CCTGCTTGGCCTGCCGCAGGGCG 0: 1
1: 3
2: 17
3: 46
4: 276
Right 1129597927 15:76979384-76979406 CAGCTCGGACAACTTGGCATTGG 0: 1
1: 4
2: 11
3: 15
4: 73
1129597915_1129597927 16 Left 1129597915 15:76979345-76979367 CCGCACCATGTCCTGCTTGGCCT 0: 1
1: 2
2: 17
3: 50
4: 309
Right 1129597927 15:76979384-76979406 CAGCTCGGACAACTTGGCATTGG 0: 1
1: 4
2: 11
3: 15
4: 73
1129597916_1129597927 11 Left 1129597916 15:76979350-76979372 CCATGTCCTGCTTGGCCTGCCGC 0: 1
1: 3
2: 24
3: 43
4: 301
Right 1129597927 15:76979384-76979406 CAGCTCGGACAACTTGGCATTGG 0: 1
1: 4
2: 11
3: 15
4: 73
1129597921_1129597927 -4 Left 1129597921 15:76979365-76979387 CCTGCCGCAGGGCGGCCTCCAGC 0: 1
1: 12
2: 16
3: 44
4: 283
Right 1129597927 15:76979384-76979406 CAGCTCGGACAACTTGGCATTGG 0: 1
1: 4
2: 11
3: 15
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129597927 Original CRISPR CAGCTCGGACAACTTGGCAT TGG Intergenic
904433279 1:30478897-30478919 CAGCAGGGACAACGTGGGATGGG + Intergenic
906223701 1:44103709-44103731 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
909232283 1:73105878-73105900 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
915619812 1:157074298-157074320 CAGCTCGGACAACTTGGCGTTGG - Intergenic
917365327 1:174225341-174225363 CAACTGGGACATCTTGGGATTGG + Intronic
923211602 1:231808654-231808676 CAGGTCAGACAACTAGGCATTGG - Intronic
923270206 1:232348406-232348428 CAGCTGGGACGTCTTGGCAATGG + Intergenic
923641615 1:235767396-235767418 CAGCTATGAGAACTTGGCAAAGG - Intronic
1063714539 10:8514070-8514092 CAGCTCAGACACCTTGGTGTTGG + Intergenic
1067690268 10:48497294-48497316 CAGCTCTGTCTCCTTGGCATGGG + Intronic
1074637084 10:115331985-115332007 CAGCACAGAGAACTTGGCAGTGG - Intronic
1077730330 11:4723118-4723140 CAGCTCGGACAGCTTGGAGTTGG + Intronic
1078932434 11:15922576-15922598 AAGCTCTGACAACCTGGCAGAGG - Intergenic
1081254218 11:40872116-40872138 GAGATCTGACAACTAGGCATCGG + Intronic
1086609438 11:88736893-88736915 CAGCACGGGAAACTTAGCATAGG - Intronic
1088619916 11:111671337-111671359 CAGCTCCACCAGCTTGGCATTGG + Intronic
1089599225 11:119603238-119603260 CAGCTCCGACAGCTCGGCGTTGG + Intergenic
1090920674 11:131203624-131203646 CAGCTCTGAGAAGTTGCCATGGG - Intergenic
1093237155 12:16624842-16624864 CATCTCAGACCAATTGGCATGGG - Intergenic
1095810344 12:46367936-46367958 CAGCTTGGACAACATAACATAGG + Intronic
1096485027 12:51974249-51974271 TAGCTCTGACCTCTTGGCATGGG - Intronic
1096603399 12:52746721-52746743 GAGCTCTGCCAACTTGGCCTGGG + Intergenic
1096626435 12:52898813-52898835 CAGCTCGGACAACTTGGCGTTGG + Exonic
1098264703 12:68706675-68706697 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1106759134 13:32850571-32850593 CAACTGAGACAACTTCGCATGGG - Intergenic
1115951625 14:38728077-38728099 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
1115964684 14:38874602-38874624 AAGTTGGAACAACTTGGCATAGG + Intergenic
1116326902 14:43541259-43541281 CAGCTCGGACAGCTTGGCCTTGG + Intergenic
1125841030 15:42801347-42801369 CAGCTCAGACAGCTTGGCATTGG + Intronic
1126467319 15:48972950-48972972 CAGCTCGGACAGCTTAGTCTTGG - Intergenic
1126877533 15:53060419-53060441 CAGTTCTGACCACTTGGCCTCGG + Intergenic
1128842243 15:70859758-70859780 CAGCTCGGACAGCTTGGCGTTGG - Intronic
1129597927 15:76979384-76979406 CAGCTCGGACAACTTGGCATTGG + Intergenic
1129672732 15:77616160-77616182 CACCTCAGACAGCCTGGCATTGG + Intronic
1133823267 16:9255854-9255876 CAGCTCTGCCACCTTGGAATTGG + Intergenic
1137726718 16:50661617-50661639 CAGCTAGAAAAACTTGGCTTTGG + Intergenic
1140521643 16:75586957-75586979 CAGCTCTGCCCACTTGGCAATGG - Intergenic
1140753718 16:78048831-78048853 CAGCTTGGACAGCTTGGCGTTGG + Intronic
1146186524 17:30727921-30727943 CTGCCCACACAACTTGGCATCGG + Intergenic
1147350063 17:39835346-39835368 CAGCTTGGACCCCCTGGCATTGG + Intronic
1151880001 17:76889125-76889147 CAGCTCGGTGTACCTGGCATGGG - Intronic
1155304863 18:24469177-24469199 CAGTTGGGACAACTTGCCTTGGG - Intronic
1157063555 18:44321169-44321191 CAGCTCGGACAGCTTGGTGTTGG + Intergenic
1159589834 18:70321777-70321799 CAGGTAGGACAGGTTGGCATAGG + Intronic
927511114 2:23644327-23644349 CAACTCTGACAACTGGGCAGCGG + Intronic
928099536 2:28427969-28427991 AAGCTTGGACAACTGGACATTGG + Intergenic
928225754 2:29446606-29446628 CAGCTTGGAGATCTTGGCAGTGG - Intronic
931438651 2:62271119-62271141 CAGCTAGGATACATTGGCATGGG + Intergenic
932224968 2:70032323-70032345 CTGCTCAGACACCTTGGCTTAGG + Intergenic
942558646 2:177198147-177198169 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
943064431 2:183071424-183071446 CAGCTCAGACAGCTTGGCGCTGG + Intergenic
944763445 2:202840715-202840737 CAGCTCGGAGAGCTTGGCATTGG + Intronic
946320879 2:218953774-218953796 CAGCTCAGACAGCTTGGTGTTGG + Intergenic
949069448 2:242015265-242015287 CAGCTCAGTCATCTTAGCATGGG + Intergenic
1169355166 20:4899332-4899354 CAGCTTGGACAACTGGGTAGGGG + Intronic
1171992190 20:31705072-31705094 CAGGTAGGACAAGTTGGCTTTGG + Intronic
1172079249 20:32326300-32326322 CAGCTTGGACAACGAGCCATGGG + Intronic
1175440811 20:58989895-58989917 CAGCACGGACATCATGGCCTGGG - Exonic
1178240570 21:30894895-30894917 CAGCTTGGACAACTTCACAGTGG - Intergenic
1185252821 22:49814325-49814347 CACCTCGCACCACCTGGCATGGG - Intronic
950882483 3:16334551-16334573 CAGCTCAGAGAACTGGGCAATGG + Intronic
952611544 3:35216086-35216108 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
955353498 3:58211210-58211232 CAGCTCTGACATCTAGTCATCGG + Exonic
955839480 3:63096756-63096778 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
958113848 3:89188783-89188805 CAGCTCTGATAAATTGTCATGGG - Intronic
961235154 3:125359954-125359976 CAGCTGGCACAACTGGGCCTGGG + Intronic
962712816 3:138101865-138101887 CAGCTCGGACAGCTTGGCGTTGG + Intronic
964506414 3:157404920-157404942 CAGAAAGGACAACTGGGCATTGG - Intronic
964802249 3:160568869-160568891 CAGCTTGGAGAGCTTGGCATTGG - Intergenic
968492715 4:898942-898964 CAGCTCTGATAACAGGGCATGGG + Intronic
968626985 4:1630172-1630194 CAGCTCCGACAGCTTGGAAGGGG - Intronic
969619159 4:8270255-8270277 CAGCGCGCACACGTTGGCATAGG - Exonic
977928671 4:102729106-102729128 CAGCTTGGACAGCTTGGCGTTGG + Intronic
978853271 4:113363859-113363881 CAGCTCAGAGCACTTTGCATGGG - Intronic
982013471 4:151129304-151129326 CAGCTCTGCCAATTTGGGATGGG + Intronic
985789511 5:1917807-1917829 CAGCTCGGAACACCTGGCAGTGG - Intergenic
990108138 5:52289818-52289840 CAGATGGTTCAACTTGGCATGGG + Intergenic
990900488 5:60743939-60743961 CAGCTCAGACAGCTTGGCGTTGG + Intergenic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
997588698 5:135059986-135060008 CAGTTTGGACATCATGGCATTGG + Intronic
998887174 5:146706559-146706581 CAGCTCGGACAGCTTAGCGTTGG + Intronic
1004817457 6:19327820-19327842 CTCCACTGACAACTTGGCATCGG - Intergenic
1005159505 6:22842866-22842888 CAGCTGTGACAAATTAGCATAGG + Intergenic
1005315506 6:24599398-24599420 CAGCTTGGACAGCTTGGCATTGG - Intronic
1012253720 6:97008521-97008543 CAGCTCAGAGAGTTTGGCATGGG - Intronic
1015539190 6:134297356-134297378 CAGCTCAGACAGCTTGGCGTTGG + Intronic
1018317263 6:162569322-162569344 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1022477031 7:30717899-30717921 CAGCTAGGAAATCTTGGAATAGG + Intronic
1023289658 7:38656239-38656261 CAGCTCAGACAGCTTGGCTTTGG - Intergenic
1027171949 7:75878930-75878952 CGGATTGGACAACTTGGCATGGG + Exonic
1029453957 7:100657902-100657924 CAGCTCTGACAACTTGGGGTAGG + Intergenic
1030267530 7:107635571-107635593 CAGCTCAGACAACTTTGGGTGGG + Intergenic
1033977166 7:147116513-147116535 CAGCTGGGACAACCTGCCCTGGG + Intronic
1041781144 8:61579265-61579287 CAGCTCGGACAACTTGGCGTTGG - Intronic
1042271541 8:66961502-66961524 CAGCTTGGACAGCTTGGTGTCGG + Exonic
1052144989 9:25037515-25037537 CAGCCCAGACAAGATGGCATAGG - Intergenic
1052606881 9:30715366-30715388 CTGCTTGGGCAGCTTGGCATTGG + Intergenic
1055604071 9:77949614-77949636 CAGCTCTGGAAAATTGGCATAGG + Intronic
1056958483 9:91101515-91101537 CATCTGGGACAACTGGGCAGGGG - Intergenic
1057943653 9:99306205-99306227 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
1060027390 9:120184762-120184784 CACCTTGGACAACTTGCCTTTGG - Intergenic
1062419720 9:136474373-136474395 CAGCTCCGAAAACATGGCTTTGG + Exonic
1189893782 X:45632671-45632693 CAGCTCGGACAACTTGGCCTTGG + Intergenic
1191220765 X:57985727-57985749 CAGCTGGGAAAGCTTGGCATTGG - Intergenic