ID: 1129599258

View in Genome Browser
Species Human (GRCh38)
Location 15:76988760-76988782
Sequence GTGGGGGTGTGGCGCTCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129599258_1129599270 10 Left 1129599258 15:76988760-76988782 CCATCTGAGCGCCACACCCCCAC No data
Right 1129599270 15:76988793-76988815 CTCTGCACTTCCTCCTCAGTGGG No data
1129599258_1129599271 11 Left 1129599258 15:76988760-76988782 CCATCTGAGCGCCACACCCCCAC No data
Right 1129599271 15:76988794-76988816 TCTGCACTTCCTCCTCAGTGGGG No data
1129599258_1129599269 9 Left 1129599258 15:76988760-76988782 CCATCTGAGCGCCACACCCCCAC No data
Right 1129599269 15:76988792-76988814 GCTCTGCACTTCCTCCTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129599258 Original CRISPR GTGGGGGTGTGGCGCTCAGA TGG (reversed) Intergenic
No off target data available for this crispr