ID: 1129599275

View in Genome Browser
Species Human (GRCh38)
Location 15:76988828-76988850
Sequence CAGAAACAGGATGAGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129599275_1129599291 22 Left 1129599275 15:76988828-76988850 CCTTCTTCCTCATCCTGTTTCTG No data
Right 1129599291 15:76988873-76988895 GCCAGCCCCACACTCTGGGGAGG No data
1129599275_1129599289 18 Left 1129599275 15:76988828-76988850 CCTTCTTCCTCATCCTGTTTCTG No data
Right 1129599289 15:76988869-76988891 CACTGCCAGCCCCACACTCTGGG No data
1129599275_1129599288 17 Left 1129599275 15:76988828-76988850 CCTTCTTCCTCATCCTGTTTCTG No data
Right 1129599288 15:76988868-76988890 TCACTGCCAGCCCCACACTCTGG No data
1129599275_1129599290 19 Left 1129599275 15:76988828-76988850 CCTTCTTCCTCATCCTGTTTCTG No data
Right 1129599290 15:76988870-76988892 ACTGCCAGCCCCACACTCTGGGG No data
1129599275_1129599279 -10 Left 1129599275 15:76988828-76988850 CCTTCTTCCTCATCCTGTTTCTG No data
Right 1129599279 15:76988841-76988863 CCTGTTTCTGCCCCAGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129599275 Original CRISPR CAGAAACAGGATGAGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr