ID: 1129600678

View in Genome Browser
Species Human (GRCh38)
Location 15:76996487-76996509
Sequence CAGAGCGTCCTCTTCGGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 74}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129600678_1129600693 28 Left 1129600678 15:76996487-76996509 CCAACCCCGAAGAGGACGCTCTG 0: 1
1: 0
2: 0
3: 2
4: 74
Right 1129600693 15:76996538-76996560 CCAACAGCCCTGCCCTCCCCGGG 0: 1
1: 1
2: 9
3: 85
4: 688
1129600678_1129600691 27 Left 1129600678 15:76996487-76996509 CCAACCCCGAAGAGGACGCTCTG 0: 1
1: 0
2: 0
3: 2
4: 74
Right 1129600691 15:76996537-76996559 GCCAACAGCCCTGCCCTCCCCGG 0: 1
1: 1
2: 9
3: 83
4: 590
1129600678_1129600684 -6 Left 1129600678 15:76996487-76996509 CCAACCCCGAAGAGGACGCTCTG 0: 1
1: 0
2: 0
3: 2
4: 74
Right 1129600684 15:76996504-76996526 GCTCTGGCCCTCGGCTCAGCCGG 0: 1
1: 0
2: 1
3: 21
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129600678 Original CRISPR CAGAGCGTCCTCTTCGGGGT TGG (reversed) Intronic
901771079 1:11530680-11530702 CAGAGGGTCCTGTGTGGGGTGGG + Intronic
901827859 1:11874319-11874341 CAGTGCGTCCTCTCCTGGGACGG - Intergenic
906155409 1:43611296-43611318 CAGAGAAGCCTCTTCGGGGATGG + Intronic
907005974 1:50913932-50913954 CAGAGCATCTTCTTCCTGGTAGG - Intronic
914921590 1:151851092-151851114 CAGACCGACTTCTTCTGGGTTGG + Exonic
915913262 1:159927351-159927373 CAGAGTGGCCTGTTCGGGGTGGG + Exonic
919204044 1:194397219-194397241 CACAGCATCCTCATCAGGGTTGG + Intergenic
1062956879 10:1546357-1546379 CAGACCGGCCTCCACGGGGTGGG + Intronic
1066215204 10:33279715-33279737 CAGAGCGTGGTCTTAGTGGTAGG - Intronic
1067025942 10:42844307-42844329 TACAGCGTCCTCTTCGGTGAGGG + Intergenic
1071841663 10:89477879-89477901 CAGAGGGACTTCATCGGGGTGGG - Intronic
1077015317 11:396700-396722 CAGATCGTCCCCCTCGGGCTGGG - Intronic
1081586030 11:44384506-44384528 CAGACCGGGCTCTTCTGGGTGGG + Intergenic
1083280879 11:61626763-61626785 CAGAGCAATCTCTTCGAGGTTGG - Intergenic
1084088933 11:66867723-66867745 TAGAGCGTCCTGTTAGGGATGGG - Intronic
1087886569 11:103489613-103489635 CAGGGAGTCCACTTCTGGGTGGG + Intergenic
1089153924 11:116386063-116386085 CAGTGCGTCCTCTTAGGTTTAGG - Intergenic
1101589130 12:106110891-106110913 CACAGCCTCCTCTTGAGGGTTGG + Intronic
1102150268 12:110684830-110684852 CAGAGCGACCACTTCTGGGAAGG - Intronic
1102212866 12:111139531-111139553 AAGAGCCTCCTCTGAGGGGTTGG - Intronic
1104823408 12:131692204-131692226 CCAAGCCTCCTCTCCGGGGTTGG + Intergenic
1113459861 13:110474227-110474249 CAGAGAAGCCTCTTCGGGCTGGG - Intronic
1113662805 13:112118613-112118635 CAGAGCGGCCTTTTCGTGGCTGG + Intergenic
1119524024 14:75307968-75307990 AAGAGCGCCCTCTTCTGGCTCGG - Intergenic
1122556828 14:102585140-102585162 CAGAGCTTACAATTCGGGGTGGG + Intergenic
1123426556 15:20175638-20175660 TAGAGCGTCCTCTTCAGTGAGGG + Intergenic
1123535787 15:21182165-21182187 TAGAGCGTCCTCTTCAGTGAGGG + Intergenic
1129600678 15:76996487-76996509 CAGAGCGTCCTCTTCGGGGTTGG - Intronic
1129769629 15:78194716-78194738 CAGCGCCTCCTCTGTGGGGTGGG + Exonic
1138501142 16:57445783-57445805 CAGAGCGTTCTCTTGAGGGCAGG - Intronic
1203119266 16_KI270728v1_random:1522350-1522372 TAGAGCGTCCTCTTTGGTGAGGG - Intergenic
1144007398 17:11113687-11113709 GAGAACGTCCTCTACGGTGTTGG - Intergenic
1144338593 17:14295073-14295095 CAGAGCGCTCTCTTCCGGGCGGG - Intergenic
1146723935 17:35142313-35142335 CAGAGCGCCGTCTCCGTGGTCGG + Exonic
1152083883 17:78205593-78205615 CTGAGCGTCCTCCCTGGGGTGGG - Exonic
1153745388 18:8173677-8173699 CAGAGAGTCTGCTTCTGGGTAGG + Intronic
1160665588 19:326528-326550 AAGAGAGTCCTCCTCGGTGTCGG + Exonic
1161046619 19:2138360-2138382 CATGGGGTCCTCTTCTGGGTGGG - Intronic
1163847829 19:19647208-19647230 CAGAGCGTCCTCTACCTGGAGGG - Exonic
1165708091 19:37990491-37990513 CAGAGCGCTCTCTTCTGGCTGGG + Intronic
1168289983 19:55352913-55352935 GACAGCGGCCTCTGCGGGGTGGG + Intronic
926311289 2:11677831-11677853 CAGAGCGCCTTGTTCGGGATGGG + Intronic
935526219 2:104171347-104171369 CATGGCGTCCTGTTCAGGGTTGG - Intergenic
942133136 2:172900074-172900096 GAGTGAGTCCTCTTCGGAGTGGG - Intronic
949040845 2:241849454-241849476 CAGGGCGTCCACAGCGGGGTGGG - Intergenic
1173100550 20:40084066-40084088 CAGACACTCCTCTTCTGGGTTGG - Intergenic
1177870124 21:26561942-26561964 TATAGAGTCCTCTTCGGAGTTGG - Intronic
1184100310 22:42338490-42338512 CTGAGCGAGCTCTTCGGGATTGG - Intronic
1184257867 22:43297230-43297252 CTCAGCTTCCTCTTTGGGGTAGG + Intronic
1184611572 22:45607280-45607302 CAGAACGCCCTCCTCGGGTTTGG - Intergenic
1184717116 22:46288594-46288616 CAGAGGGGCCTTCTCGGGGTGGG + Intronic
952451855 3:33440329-33440351 CAGAGCGGCGTCGGCGGGGTTGG - Exonic
952834803 3:37593743-37593765 CATAGAGTCCTCTTCTGTGTTGG + Intronic
954414455 3:50386282-50386304 CAGAGCATCCTAGTAGGGGTTGG + Intronic
967907388 3:194512988-194513010 CAGAGGGTGCACTTGGGGGTAGG - Intergenic
972284232 4:37632934-37632956 CAGAGCCTTCTCTTCAGGGTTGG - Intronic
972427420 4:38947021-38947043 CAGAGCCTTCTCTTCTTGGTTGG - Intergenic
976084658 4:81395095-81395117 CAAAGCTTCCTTTTCTGGGTTGG + Intergenic
976866291 4:89731406-89731428 AACAGCGTCCTGTCCGGGGTGGG + Intronic
977583017 4:98745553-98745575 CAGAGCGCCCTCTTGGGGAGTGG - Intergenic
978366695 4:107990105-107990127 CAGAGCTTCCACCTCAGGGTGGG - Intronic
985663548 5:1169556-1169578 CAGAGGGTCCTCTGGGGGTTGGG - Intergenic
1003107624 6:3227986-3228008 CAGCGCGTCCTGACCGGGGTGGG + Intronic
1005386910 6:25294108-25294130 CAGGACGTCCTCTTAGAGGTAGG + Intronic
1007576758 6:42929965-42929987 CAGAGCTTCCTTTTGGGGGCCGG + Intronic
1018868000 6:167760236-167760258 CAGAGGGACCTGTTCGGTGTGGG + Intergenic
1033059473 7:138091804-138091826 CTGAGTGTCCTCTCCAGGGTTGG - Exonic
1036396712 8:8376951-8376973 CCGATGGTCCTCTTCCGGGTGGG + Exonic
1036546825 8:9779386-9779408 CAGAGGGGCCATTTCGGGGTAGG - Exonic
1037932803 8:22892615-22892637 CAGAGCCTCATGTTTGGGGTTGG + Intronic
1038869610 8:31479951-31479973 CAGGGAGTCCGCTTCTGGGTGGG - Intergenic
1040484463 8:47856816-47856838 CAGAGCCTCCCATTCAGGGTTGG + Intronic
1045882431 8:107057263-107057285 CAGAGAGTTCTCATCTGGGTAGG + Intergenic
1048221585 8:132546973-132546995 CAGAGCCTGCTGTTCTGGGTTGG - Intergenic
1056795869 9:89658550-89658572 CAGAGCCTCCTCAGCGGGGAGGG - Intergenic
1060551516 9:124487691-124487713 CAGGGCGTCCCCCTCGGGGGCGG - Intronic
1062186012 9:135218914-135218936 CAGAGCTTCCTCTTCCAGGCAGG + Intergenic