ID: 1129603300

View in Genome Browser
Species Human (GRCh38)
Location 15:77012541-77012563
Sequence CTCAGGTACAACTTGATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 141}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129603300_1129603307 19 Left 1129603300 15:77012541-77012563 CCATCCATCAAGTTGTACCTGAG 0: 1
1: 0
2: 0
3: 14
4: 141
Right 1129603307 15:77012583-77012605 CTCACTTTGCCAACCAGTAATGG 0: 1
1: 0
2: 0
3: 6
4: 133
1129603300_1129603308 22 Left 1129603300 15:77012541-77012563 CCATCCATCAAGTTGTACCTGAG 0: 1
1: 0
2: 0
3: 14
4: 141
Right 1129603308 15:77012586-77012608 ACTTTGCCAACCAGTAATGGTGG 0: 1
1: 0
2: 0
3: 9
4: 111
1129603300_1129603309 27 Left 1129603300 15:77012541-77012563 CCATCCATCAAGTTGTACCTGAG 0: 1
1: 0
2: 0
3: 14
4: 141
Right 1129603309 15:77012591-77012613 GCCAACCAGTAATGGTGGAGAGG 0: 1
1: 0
2: 0
3: 4
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129603300 Original CRISPR CTCAGGTACAACTTGATGGA TGG (reversed) Intronic
902976852 1:20094741-20094763 CTGAGGAACAGCTTGAAGGATGG + Intergenic
906760232 1:48370332-48370354 TGCAGGTACAACTTGCAGGATGG + Intronic
920940239 1:210475248-210475270 ATAAGGTACAGCATGATGGATGG - Intronic
922984729 1:229857433-229857455 CTCAGGAACAGCCAGATGGAAGG - Intergenic
1067182643 10:44000720-44000742 CCCAGGTAAAACATGATGGCAGG + Intergenic
1071774410 10:88768936-88768958 CTCAGGTACATTTTGTTGAAAGG - Intronic
1075239097 10:120761160-120761182 CTCAGGCAAAATTTGCTGGAAGG - Intergenic
1076028760 10:127140418-127140440 CTCAGGGTCAACTTGCTGGCAGG - Intronic
1078630471 11:12998991-12999013 CTCAGGTTTAACTTGATGCACGG + Intergenic
1078932551 11:15923451-15923473 CTCTGGTTCAGCTTGATGGATGG - Intergenic
1080415908 11:32069996-32070018 TTCAGGTACAGCTTGATCCAGGG + Intronic
1085623224 11:78052838-78052860 CTCTGGGGTAACTTGATGGATGG + Intronic
1088978437 11:114837472-114837494 CTAAGGTACAACTTGTAGAAAGG + Intergenic
1090176106 11:124651164-124651186 ATCAGGAACTACTAGATGGATGG + Intronic
1091047815 11:132340469-132340491 CTCAAGGAAAACTTGAGGGATGG + Intergenic
1091162635 11:133438988-133439010 CTCAGGAACAAGTAAATGGAAGG - Intronic
1091889176 12:4039417-4039439 ATACGGTCCAACTTGATGGAGGG + Intergenic
1092466906 12:8741408-8741430 TTGAAGTATAACTTGATGGAAGG + Intronic
1092498552 12:9023059-9023081 CTCAGGTCCAATTTGCTGGATGG - Intergenic
1095449807 12:42318504-42318526 CTCAGGTACACCCTGGTGGGTGG - Intronic
1096026715 12:48371245-48371267 CTCATGTACAACATGATGGGTGG - Intergenic
1101027981 12:100632597-100632619 CTGAGGTAGAGCTTAATGGAGGG - Intergenic
1102888235 12:116537663-116537685 CTCATGGCCAACTTGATGCATGG - Intergenic
1103080408 12:118019496-118019518 GGCAGATACAACTTGATGTAGGG - Intronic
1104542330 12:129677437-129677459 CTCAGGTACAACTTTATCAGTGG + Intronic
1104814888 12:131639933-131639955 TGCAGGTACAGCTTGATGGATGG + Intergenic
1105893515 13:24699051-24699073 CTCAGGGAAGACTTTATGGAAGG + Intronic
1106925451 13:34608312-34608334 ATCATGAACAACTTGATGGGGGG - Intergenic
1107583159 13:41814388-41814410 CTAAGGGACAACTGGATGTAGGG + Intronic
1108090591 13:46845513-46845535 CTCAATTACTACTTGATTGATGG - Intronic
1109771476 13:66980145-66980167 ATAAGGAACAAGTTGATGGAAGG - Intronic
1110817772 13:79880611-79880633 GTCAGTTACTGCTTGATGGATGG - Intergenic
1111103969 13:83622068-83622090 CGCAGGAACAAATTGAAGGATGG - Intergenic
1116377496 14:44222113-44222135 CTCAGGGACAATATGATAGATGG + Intergenic
1120185038 14:81385618-81385640 GTTAGGTAGAACTTGAAGGATGG - Intronic
1121406637 14:93723072-93723094 CTCCTGAACAACTTGAGGGAGGG - Intronic
1127658579 15:61078739-61078761 CACAGGGACAATTTGAAGGAGGG + Intronic
1129603300 15:77012541-77012563 CTCAGGTACAACTTGATGGATGG - Intronic
1134493188 16:14711609-14711631 CTGAGATACAGGTTGATGGACGG + Intronic
1134498569 16:14750733-14750755 CTGAGATACAGGTTGATGGACGG + Intronic
1134525123 16:14937363-14937385 CTGAGATACAGGTTGATGGACGG + Intronic
1134547771 16:15123556-15123578 CTGAGATACAGGTTGATGGACGG - Intronic
1134582005 16:15378352-15378374 CTGAGATACAGGTTGATGGACGG - Intronic
1134712711 16:16335850-16335872 CTGAGATACAGGTTGATGGACGG + Intergenic
1134720575 16:16379165-16379187 CTGAGATACAGGTTGATGGACGG + Exonic
1134946852 16:18332720-18332742 CTGAGATACAGGTTGATGGACGG - Exonic
1134954116 16:18372843-18372865 CTGAGATACAGGTTGATGGACGG - Intergenic
1135312942 16:21419755-21419777 CTGAGATACAGGTTGATGGACGG - Intronic
1135445949 16:22519127-22519149 CTGAGATACAGGTTGATGGACGG + Intronic
1135885801 16:26306322-26306344 TTCAGGTACAGCTTGATCCAGGG + Intergenic
1136152097 16:28357486-28357508 CTGAGATACAGGTTGATGGACGG - Intronic
1136194651 16:28643697-28643719 CTGAGATACAGGTTGATGGACGG + Intronic
1136210983 16:28757796-28757818 CTGAGATACAGGTTGATGGACGG + Intronic
1136255705 16:29037754-29037776 CTGAGATACAGGTTGATGGACGG + Intergenic
1136309607 16:29398482-29398504 CTGAGATACAGGTTGATGGACGG - Intronic
1136323055 16:29500263-29500285 CTGAGATACAGGTTGATGGACGG - Intronic
1136437739 16:30240231-30240253 CTGAGATACAGGTTGATGGACGG - Intronic
1137557174 16:49477901-49477923 CTAAGGAACAACATGATGGTGGG + Intergenic
1137984150 16:53093757-53093779 GCCAGGTACAACTTGATCTAGGG + Intronic
1138048930 16:53755417-53755439 CTCAAGTACACCTCAATGGACGG - Intronic
1138350416 16:56343624-56343646 CACAGGGAAAACCTGATGGAGGG - Intronic
1139857291 16:69990862-69990884 CTGAGATACAGGTTGATGGACGG - Intergenic
1140365383 16:74377059-74377081 CTGAGATACAGGTTGATGGACGG + Intergenic
1140731157 16:77858030-77858052 GTCTGGTAAAACTTGGTGGACGG - Intronic
1141602573 16:85135390-85135412 CACAGGTACAGCTTCAGGGAGGG - Intergenic
1145120914 17:20258771-20258793 GTTAGGTACAACTTCATGAAAGG - Intronic
1148968758 17:51461237-51461259 CACCAGTACAACTTTATGGAAGG - Intergenic
1149887275 17:60352549-60352571 ATCAGGTACAAGTTTATGGAAGG + Intronic
1151516545 17:74599837-74599859 TTCAGTTACAAGTTGCTGGAGGG + Intergenic
1152266090 17:79295754-79295776 CTCAGGCACAGCTTGAGGGTGGG + Intronic
1154118740 18:11634111-11634133 CTGAGATACAGGTTGATGGACGG - Intergenic
1156127097 18:33919335-33919357 CTCAGGTAAAAATTGAGGGAAGG + Intronic
1158941175 18:62406806-62406828 CTCAGGTCCAACTAGAGGGAGGG - Intergenic
1164749101 19:30638140-30638162 CTAAGGTCAAACTTGATGAAAGG + Intronic
926433635 2:12816388-12816410 ATTAGGGACAACTTGATGAAGGG - Intergenic
927081901 2:19638723-19638745 CTCAGGTACAACTCAGTGCAAGG + Intergenic
927082207 2:19641842-19641864 CTCAGGTACAACTCAGTGTAAGG + Intergenic
927961864 2:27245506-27245528 CACAGGTACTATTTGAAGGAGGG + Intergenic
928344670 2:30480575-30480597 CTCAATTTCTACTTGATGGAGGG - Intronic
933747557 2:85582124-85582146 CTGAGGTCCAAGTTGTTGGAAGG + Intergenic
938217398 2:129531786-129531808 CTCAAGCACAACTTGTTGAAAGG + Intergenic
942244528 2:173994886-173994908 CTGATGGACCACTTGATGGAAGG + Intergenic
942468958 2:176239898-176239920 CTCAGGCACATGTAGATGGAAGG + Intergenic
943482592 2:188439891-188439913 GTCTGGTACTACTTGATGTAAGG - Intronic
944199497 2:197090963-197090985 CTCATGAACAAATTGAAGGATGG - Intronic
944279574 2:197879769-197879791 CTCATATTCAACTTGTTGGAGGG + Intronic
944328192 2:198432314-198432336 CTCAGGGACTATTTGGTGGATGG + Intronic
945994270 2:216422641-216422663 TCCAGGTACAACCTGATGGAAGG - Intronic
948704411 2:239780018-239780040 CTCAGGTTCAGCTTTCTGGAGGG + Intronic
1174390290 20:50214699-50214721 CTCAGTGACTACTGGATGGAGGG + Intergenic
1179104590 21:38387386-38387408 CTCAGGCACCACTTACTGGAGGG + Intronic
1179236155 21:39548211-39548233 CTCAGCTACAACATGAAGGATGG - Intergenic
1180861938 22:19088372-19088394 CTGAGCTACACCTTGAAGGATGG + Intronic
1183237754 22:36632375-36632397 CACAGGACCAACTTGATGGCAGG - Intronic
952202138 3:31141548-31141570 GGCAGGGACAACTTGAAGGAGGG - Intergenic
957237297 3:77610958-77610980 ATCAGGTACAAATTGATAAAGGG - Intronic
960202834 3:114858621-114858643 CTCAAATACAACTTTATGGTAGG - Intronic
960212523 3:114987847-114987869 GTCAGGTACAACATGTTGAAAGG + Intronic
960583123 3:119297169-119297191 CTCAGCTAAAACTAGTTGGATGG + Intronic
963030596 3:140970972-140970994 CTCGGTTACAGCTTGATGCAAGG + Exonic
963378819 3:144503776-144503798 CACATGGACCACTTGATGGATGG + Intergenic
963512707 3:146268840-146268862 CTTAAGTAAAAATTGATGGAGGG - Intergenic
967497700 3:190160628-190160650 CTCAGCTACAGTTTGCTGGAGGG - Intergenic
972707567 4:41560190-41560212 CTTTGGAACAACTAGATGGAGGG - Intronic
975794882 4:77996765-77996787 CTCAGGAACAATCAGATGGAAGG + Intergenic
975881164 4:78909509-78909531 ATCAGGTACAACATGAGGTAAGG - Intronic
975971761 4:80047817-80047839 CTCAGGTACAGCTGGATCCAAGG - Intronic
981171384 4:141627880-141627902 TTCTTGTACAACTTGATGAAGGG - Intergenic
981255798 4:142659566-142659588 CTCAGAAACAACATGAGGGATGG + Intronic
981300624 4:143182068-143182090 CACAAGAGCAACTTGATGGAGGG + Intergenic
982433899 4:155358631-155358653 CTCAGGCACAATTTAATGTAGGG + Intronic
986165853 5:5271013-5271035 TTCATGTTCAACTTGAAGGAGGG + Intronic
986257601 5:6113506-6113528 CTGAGGGCCACCTTGATGGACGG + Intergenic
986757589 5:10852659-10852681 TTCAGGTACAGCTTGATCCAGGG - Intergenic
992156392 5:73959105-73959127 CTAAGGTATAACTACATGGATGG + Intergenic
993101092 5:83540688-83540710 CTCAGGTAGAATTTCAAGGATGG - Exonic
995796488 5:115946589-115946611 TTCAGGTACGACTTAATGGAAGG - Intergenic
996874336 5:128224779-128224801 TTCAGGTCAAGCTTGATGGATGG - Intergenic
997731800 5:136186487-136186509 CACAGGTCCAACTTTATGGTAGG + Intronic
1000193105 5:158931838-158931860 CTCATCTACAAATTAATGGAAGG + Intronic
1001703512 5:173724456-173724478 CTCAGGAACAGCTGGAAGGAAGG + Intergenic
1003039381 6:2673044-2673066 CTCAGGTACCAGCAGATGGATGG + Intronic
1004841830 6:19596112-19596134 CTCTGGTACAAAGTGATGGTTGG + Intergenic
1005909489 6:30295709-30295731 CTCAGGTACAACTGGAACCAGGG + Intergenic
1006015588 6:31078319-31078341 CTCAGAACCAACTTCATGGAGGG - Intergenic
1008025998 6:46636602-46636624 TTCAGGTATAATTTCATGGAAGG + Intronic
1011495717 6:87935183-87935205 CTCAGTGACAACTTGAATGATGG - Intergenic
1018389739 6:163332786-163332808 CTCAGGTACAACGTGATCAAGGG + Intergenic
1019075083 6:169380499-169380521 CTCAGTTACAACGTGATTTAGGG - Intergenic
1028383671 7:90228104-90228126 CTCAGGGAGCACTTCATGGAAGG + Intronic
1030277845 7:107739006-107739028 CTGAGGGTCAACTTGATTGAAGG + Intergenic
1030962443 7:115943520-115943542 ATCAGGTACAAATTGAAGGGAGG - Intronic
1033285972 7:140040762-140040784 CTCAAGTACAAGTTTAGGGAAGG - Intronic
1033898637 7:146107966-146107988 CTCAGTTTCAACTTGCTGCATGG + Intergenic
1035370365 7:158375941-158375963 CACAGGGACAAATTGAAGGATGG - Intronic
1037685631 8:21137295-21137317 CATGGGTACAAATTGATGGAAGG - Intergenic
1040764082 8:50885501-50885523 CTAAGGAAGAACTTGATGGCAGG - Intergenic
1041083013 8:54231293-54231315 CTCAGGGAAAAGTTGAGGGAGGG - Intergenic
1045940448 8:107732534-107732556 CTGAGGTCTGACTTGATGGATGG - Intergenic
1046164045 8:110405802-110405824 CTCAGGTACAATTGGATTGAAGG - Intergenic
1047011686 8:120679415-120679437 GTCAGGTATGTCTTGATGGAGGG - Intronic
1047270811 8:123356371-123356393 CACAGGTAAAACTTGCTTGATGG - Exonic
1048528477 8:135226263-135226285 CCCAGGTACATCTGGATGGTGGG - Intergenic
1050114305 9:2247745-2247767 CTCATGTACAACTTTTTGGGAGG + Intergenic
1050655276 9:7821500-7821522 CTCAGGAACACCTAAATGGAAGG - Intronic
1050657467 9:7844850-7844872 CTCAGGTACTCCTTTATGGCAGG - Intronic
1051425869 9:16930904-16930926 CTCAGCTACATCTTTAAGGAGGG + Intergenic
1051721480 9:20041838-20041860 CTCTGGAAGAACTTGATGGGTGG - Intergenic
1054883716 9:70173028-70173050 TTCAGGCACAGCTTGATGCAGGG + Intronic
1056886671 9:90449706-90449728 TTCAGGTACAAAGTGATAGATGG + Intergenic
1057235623 9:93356633-93356655 CACAGGGACAACTTGAAGCAGGG - Intergenic
1059396734 9:114039138-114039160 CTCAGGTAGACCCTGATGGAAGG + Intronic
1192291499 X:69800809-69800831 CTCAGGTACACCTTGCTTTAAGG - Intronic
1197137120 X:123074436-123074458 CTCAGGGACAGCTTCATGCAGGG + Intergenic
1200083414 X:153590870-153590892 CTCAGGAACAAGGGGATGGAGGG + Intronic
1201540978 Y:15104145-15104167 CACAACTACCACTTGATGGAAGG - Intergenic