ID: 1129604728

View in Genome Browser
Species Human (GRCh38)
Location 15:77019312-77019334
Sequence CCTTTCAAGAAGTTGGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 245}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129604728_1129604733 2 Left 1129604728 15:77019312-77019334 CCGGCCTCCAACTTCTTGAAAGG 0: 1
1: 0
2: 4
3: 21
4: 245
Right 1129604733 15:77019337-77019359 TCTGCAGAGTCCTCCTGCCGAGG 0: 1
1: 0
2: 1
3: 14
4: 191
1129604728_1129604735 4 Left 1129604728 15:77019312-77019334 CCGGCCTCCAACTTCTTGAAAGG 0: 1
1: 0
2: 4
3: 21
4: 245
Right 1129604735 15:77019339-77019361 TGCAGAGTCCTCCTGCCGAGGGG 0: 1
1: 0
2: 1
3: 18
4: 135
1129604728_1129604734 3 Left 1129604728 15:77019312-77019334 CCGGCCTCCAACTTCTTGAAAGG 0: 1
1: 0
2: 4
3: 21
4: 245
Right 1129604734 15:77019338-77019360 CTGCAGAGTCCTCCTGCCGAGGG 0: 1
1: 0
2: 0
3: 16
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129604728 Original CRISPR CCTTTCAAGAAGTTGGAGGC CGG (reversed) Intronic
900956854 1:5891582-5891604 CACTTCAAGAAGATGAAGGCAGG - Intronic
901498655 1:9637817-9637839 CCTGTAAAGAAGTTCTAGGCTGG + Intergenic
902898450 1:19496086-19496108 ACTTTCAAGATGCTGAAGGCTGG - Intergenic
902934979 1:19758582-19758604 CATTTCAAGGACTTGGTGGCAGG + Intronic
906285558 1:44585401-44585423 CTGTTCCAGAAGTTGGAGGGAGG - Intronic
907613694 1:55901320-55901342 CCTTTAAAGAATTTTCAGGCTGG + Intergenic
908732757 1:67243457-67243479 CCTGTCAAGGGGTAGGAGGCTGG - Intronic
909220007 1:72945737-72945759 CCTTTCAAGAAGTTGGATTTAGG + Intergenic
909395695 1:75168739-75168761 GCTTTCAAGTAGTTAGAGCCTGG + Intergenic
910363396 1:86437717-86437739 CTGTTCAAGAATATGGAGGCTGG + Intronic
910649960 1:89556080-89556102 CCTTTCCAGAAGTTGATGGTGGG - Intronic
913093623 1:115496507-115496529 ACTTCCAATAAGCTGGAGGCGGG - Intergenic
915453141 1:156020735-156020757 CCTTGCAAGAGGCGGGAGGCGGG - Intronic
916418227 1:164612117-164612139 TAGTTCAAGAAGGTGGAGGCGGG + Intronic
917598807 1:176555509-176555531 CCTATCAACAAGTTGGATGAGGG + Exonic
917655490 1:177121661-177121683 GCCTTAAAGAAGTTGGAGGAAGG - Intronic
920173598 1:204086599-204086621 CCTTTCTAGAAGTTGAAGGCAGG - Intronic
921151806 1:212408744-212408766 CCATCCAAGAAGTTGAAGTCAGG + Intronic
921325638 1:213984381-213984403 CCTTACAAGAATTTGGATCCAGG - Intronic
923493092 1:234501638-234501660 CCTTTCAAGCAAATGGAGCCAGG + Intergenic
924036911 1:239946935-239946957 CCTTTCAAAATGTTTGAGCCTGG + Intergenic
1064400003 10:15013320-15013342 CCTTTCCAGAACTCTGAGGCTGG + Intergenic
1064614771 10:17141454-17141476 CCTTAAAAGCAGCTGGAGGCTGG - Intergenic
1066207498 10:33204156-33204178 CCATACAAGATGTTGGTGGCTGG + Intronic
1066714006 10:38266827-38266849 CCTGTCAAGGGGTTGGGGGCTGG + Intergenic
1067712592 10:48661879-48661901 CATTTCAAGAAGTGGGAAGCAGG - Intergenic
1069228177 10:65970383-65970405 CCTATCATGAAGTTGTAAGCTGG - Intronic
1069432701 10:68351741-68351763 CTTTTCAAGAAGATGGGGCCGGG - Intronic
1069699226 10:70408936-70408958 GATTTCTAGAAGTTTGAGGCAGG - Intronic
1076353419 10:129834175-129834197 CCTTCCAAGTGGCTGGAGGCTGG - Intergenic
1076372236 10:129963314-129963336 TCTTTCTAGAAGCGGGAGGCAGG - Intronic
1077628276 11:3792820-3792842 CCTTTAAAAAGGTTTGAGGCCGG + Intronic
1079610628 11:22428638-22428660 CCTGTCAAGGGGTGGGAGGCAGG + Intergenic
1081681851 11:45011958-45011980 CCTGTCAAGGAGTGGTAGGCTGG - Intergenic
1083486646 11:62987177-62987199 CCTTAAAAGATGTTGCAGGCTGG + Intergenic
1083823824 11:65187245-65187267 ACTTTCAAGAAGTTGGTGAAGGG + Exonic
1084062418 11:66685132-66685154 CTCTTCAAGAGCTTGGAGGCTGG + Intergenic
1085013477 11:73157501-73157523 CCTTGCAAGGATTGGGAGGCAGG + Intergenic
1085061829 11:73454485-73454507 CCTATCAAGAGGTTGGTGTCAGG - Intronic
1085205437 11:74729242-74729264 TCTTTTAAGAAATAGGAGGCAGG + Intronic
1087485362 11:98753838-98753860 CCTGTCAAGGGGTAGGAGGCTGG + Intergenic
1088701512 11:112417139-112417161 CCTCTCATGATGTTGGAGGCAGG - Intergenic
1088745131 11:112798625-112798647 CCTTGCATGAAGTGGGGGGCAGG + Intergenic
1090245134 11:125210739-125210761 CTTTCCCAGAAGTAGGAGGCGGG - Intronic
1092299837 12:7236882-7236904 CCTTTCAAGGATTGGAAGGCAGG - Intergenic
1092435218 12:8441941-8441963 CCTTTCCAGAACTCTGAGGCTGG + Intergenic
1093699436 12:22202229-22202251 CGTTTTAAGAAGTTGGGGTCAGG - Intronic
1094073339 12:26444476-26444498 CCTGGCATGGAGTTGGAGGCAGG - Intronic
1094664876 12:32509753-32509775 CCTTTCAAGGAGCTGGACCCTGG + Intronic
1095271663 12:40225551-40225573 CCTTGAAATAACTTGGAGGCTGG - Exonic
1097277497 12:57823386-57823408 CATCTCAACAAGTTGGCGGCAGG + Exonic
1100573029 12:95860528-95860550 CCTGTCAAGAAGTTGGAGATGGG - Intronic
1100960808 12:99960929-99960951 TCTTTAAAGAAGTTAGGGGCTGG + Intronic
1101890704 12:108712274-108712296 CCTTTTAAGAAGATGGAGGCCGG + Intronic
1102040583 12:109798285-109798307 CCATTCAACAGGTTTGAGGCTGG + Intronic
1103113617 12:118305606-118305628 CATGTCAAAAAGTTGGCGGCTGG + Intronic
1103163206 12:118748152-118748174 CCTTTGAAGAACATGGAGGTTGG + Intergenic
1103512444 12:121484519-121484541 CTTTTAACGAAGATGGAGGCCGG + Intronic
1103773830 12:123350428-123350450 CCTTTAAAGATGGTGGAGCCAGG - Exonic
1104268094 12:127256399-127256421 GGTTTAAAGAGGTTGGAGGCTGG - Intergenic
1108233087 13:48370811-48370833 CCTTCCTAGAGGTTGGGGGCTGG + Intronic
1108972454 13:56393990-56394012 CCTTTCGAGAAGGTAGACGCAGG - Intergenic
1110288691 13:73779302-73779324 CCTTTCTAGAAGTTGGAGGTTGG - Intronic
1111135042 13:84030230-84030252 CATTTTAAGAAATTGCAGGCCGG - Intergenic
1111978224 13:94989869-94989891 CCACTCAAGAAGTTGGAGTGGGG - Intergenic
1114232834 14:20799711-20799733 CCTTTTAAGCATTTTGAGGCAGG - Intergenic
1115282965 14:31685422-31685444 CCATTCAAGAATTTGGGGGCTGG + Intronic
1115563180 14:34601515-34601537 CCTCTTAAGAAGTAGGAGCCAGG - Intronic
1115887412 14:37988448-37988470 CCTTTTAAGAATTTTGAGGCTGG + Intronic
1119393162 14:74305033-74305055 ACTTTTAAGAAGTAGCAGGCTGG + Intronic
1120769192 14:88360204-88360226 CTTAGCAAGATGTTGGAGGCAGG - Intergenic
1121795239 14:96729067-96729089 CCTTTCTAGAAATTAGAAGCAGG - Intergenic
1123786356 15:23678792-23678814 CCTGTCGAGAGGTGGGAGGCTGG - Intergenic
1124392063 15:29268787-29268809 CCTTTCAAGAGGATGGAGCTGGG + Exonic
1125113534 15:36062270-36062292 GCTTTTAACAAGTTGTAGGCTGG + Intergenic
1126865002 15:52926840-52926862 CCTTTCATGCAGTTGCAGTCAGG + Intergenic
1126906089 15:53367304-53367326 CCTTGAATGAAGGTGGAGGCTGG - Intergenic
1129604728 15:77019312-77019334 CCTTTCAAGAAGTTGGAGGCCGG - Intronic
1130153595 15:81331182-81331204 CCTTTTAAGCAGTCGGTGGCCGG + Intergenic
1131527273 15:93162466-93162488 CCTTTTAAGTAGTCGGTGGCCGG + Intergenic
1131534290 15:93221690-93221712 CCTTTTAAGCAGTCGGTGGCTGG + Intergenic
1131866935 15:96721373-96721395 ATTTGCAAGAAGTGGGAGGCAGG + Intergenic
1134365592 16:13574934-13574956 CCTTTCTAGAAGTTTGAGTTGGG - Intergenic
1136406276 16:30049534-30049556 CCTCTCCCGAAGTTGGAAGCTGG - Intronic
1136597688 16:31262819-31262841 CCTTTCCAGAAGAAGGGGGCTGG + Intronic
1137372672 16:47923051-47923073 CCTTTCCAGAGGATGGAGGATGG - Intergenic
1137427095 16:48388903-48388925 TTTTTCAAGAAGTTAGAGCCGGG + Intronic
1139068861 16:63355782-63355804 GCTTTCTAGAAGGTGGAGCCAGG + Intergenic
1139667392 16:68467211-68467233 CCTTTCAAGAAGTTTGTGAGGGG - Intergenic
1140213098 16:72986207-72986229 CCCTTCCTGAAGTTGGGGGCAGG - Intronic
1140530589 16:75662430-75662452 CCTTCCCAGAAGTTGGAGGGTGG + Intronic
1140536756 16:75716717-75716739 CCTCTCCAGAAGTTGGAGGGTGG + Intronic
1141308537 16:82890372-82890394 CCTTCCAAGAAGGCTGAGGCTGG - Intronic
1142718199 17:1759065-1759087 CTTTTAAAGAAGTCGGGGGCCGG + Intergenic
1143999611 17:11040725-11040747 CGTTTCTGGAGGTTGGAGGCTGG + Intergenic
1146887975 17:36485143-36485165 CCTGGGCAGAAGTTGGAGGCTGG + Intergenic
1148122823 17:45222523-45222545 CCTGTGAAGAAGTTGGGAGCGGG + Intronic
1148255599 17:46128854-46128876 CCTTTGAAGAACTTTGAGGAGGG + Intronic
1149681720 17:58512280-58512302 TCATTAAAAAAGTTGGAGGCCGG - Intronic
1150744290 17:67803843-67803865 CCATTCAAGAATTTGCAGCCCGG - Intergenic
1150953180 17:69824864-69824886 CCATTTTAGAAGTTGGAGGAGGG + Intergenic
1151596727 17:75082522-75082544 CCCTTCCAGAGGTTGGAGGTTGG + Intergenic
1203172632 17_GL000205v2_random:163185-163207 CCTTTCAGGAAGCTGGTGTCTGG - Intergenic
1203173092 17_GL000205v2_random:169595-169617 CCTTTCAGGAAGCTGGTGTCTGG + Intergenic
1154372724 18:13779286-13779308 CCATTGAAGTAGTTGGAGGTTGG + Intergenic
1157069443 18:44388874-44388896 ACTTTCATGATGTTGGGGGCAGG - Intergenic
1157375328 18:47158662-47158684 CTTTTAAAGAATTTGGGGGCTGG + Intronic
1157828051 18:50830551-50830573 CCCTTAAAGAAGTTGCAAGCTGG + Intergenic
1157941893 18:51938156-51938178 CCTGTCAGGAAGGTGGAGGGAGG - Intergenic
1158035741 18:53027738-53027760 CTGTAAAAGAAGTTGGAGGCTGG - Intronic
1159190313 18:65033134-65033156 CTTTTCAGGAGGTTGGAGGGAGG - Intergenic
1160186707 18:76681570-76681592 CCTTTGAAGAACTTGAAGCCGGG - Intergenic
1160743930 19:701591-701613 CATTTCAAGAAATAGGAAGCAGG - Intergenic
1161363369 19:3864032-3864054 AGTTTCAGGAAGTGGGAGGCGGG - Intronic
1162781408 19:13008767-13008789 CCCAGCAAGAAGCTGGAGGCTGG + Intronic
1165398835 19:35584644-35584666 CTTTTCAGGAAGTTGGGGGTGGG - Intergenic
1165651801 19:37497726-37497748 CCTATAAAGACTTTGGAGGCAGG + Intergenic
1165861314 19:38910999-38911021 GATTTCAAGAAGCAGGAGGCTGG - Exonic
1166138477 19:40791927-40791949 CCTGTCAAGAAGTTTGGGGCCGG - Intronic
1168366813 19:55795264-55795286 CCTTTCAAGAAGGTGGAAGACGG - Intronic
924982062 2:232590-232612 CCTTTCAGGGGGTTGGGGGCTGG - Intronic
926179552 2:10629136-10629158 CCCTTCAAGATGTTGGAGGCTGG - Intronic
926748417 2:16179354-16179376 CCTTTAAAAAAGCAGGAGGCCGG - Intergenic
927137849 2:20110456-20110478 TCTTTCATGAAGTTGCAGTCTGG + Intergenic
928690025 2:33789655-33789677 ACATTCAAGAAGTGAGAGGCAGG - Intergenic
929866026 2:45717968-45717990 CCCCTCAAGAAGCTGGTGGCTGG + Intronic
931171165 2:59805047-59805069 CCTTTCAACGAGTTGCAAGCGGG - Intergenic
936384566 2:112017413-112017435 CCTTTCAAGGAGTTTGAGACTGG + Intronic
937522312 2:122726615-122726637 CCTTTCCTGAGGTTGGAGGGTGG + Intergenic
939355348 2:141094454-141094476 CATTTCAAAAATTTGGAAGCCGG - Intronic
941082961 2:161083530-161083552 ACTTTCATGAAGTATGAGGCAGG - Intergenic
942545488 2:177059124-177059146 GCTTTCAAGTAGTTAAAGGCAGG - Intergenic
943150113 2:184100578-184100600 CCTTACAAGAAGTATGCGGCCGG - Intergenic
943188721 2:184648369-184648391 CCTATCAAGAAGTTGTTAGCTGG - Intronic
947768674 2:232653909-232653931 CATTTAAAGAAGTTGGGGCCAGG + Intronic
948473245 2:238199909-238199931 ACTTTAAAAAAATTGGAGGCTGG - Intronic
1168937442 20:1678208-1678230 CCTTATAAGAAGGAGGAGGCAGG - Intergenic
1169755023 20:9034693-9034715 CTTTTGAAGAACTTGGCGGCTGG + Intergenic
1170495716 20:16923020-16923042 CCTCTCAAGTAGTTTGAGGCTGG + Intergenic
1171465038 20:25321402-25321424 CCTTTCAGGAAGCTGGTGGGAGG + Intronic
1171987369 20:31670046-31670068 ACTTCCCTGAAGTTGGAGGCTGG + Intronic
1173358749 20:42320443-42320465 CCTTTCAGAAAGTTGAAGTCAGG + Intronic
1173386108 20:42589493-42589515 GCTTTGAAGAAGATGGATGCAGG - Intronic
1173427330 20:42954513-42954535 CCTTTCTGGAACTTGTAGGCTGG - Intronic
1173573654 20:44095921-44095943 CCTTTCAGGAAGCTGTAGGAGGG + Intergenic
1176291059 21:5044908-5044930 ACTGTCAGGAAGATGGAGGCTGG - Intergenic
1176328626 21:5524973-5524995 CCTTTCAGGAAGCTGGTGTCTGG - Intergenic
1176329075 21:5531237-5531259 CCTTTCAGGAAGCTGGTGTCTGG + Intergenic
1176398682 21:6289714-6289736 CCTTTCAGGAAGCTGGTGTCTGG - Intergenic
1176399131 21:6295978-6296000 CCTTTCAGGAAGCTGGTGTCTGG + Intergenic
1176438026 21:6693126-6693148 CCTTTCAGGAAGCTGGTGTCTGG - Intergenic
1176438475 21:6699390-6699412 CCTTTCAGGAAGCTGGTGTCTGG + Intergenic
1176462288 21:7020196-7020218 CCTTTCAGGAAGCTGGTGTCTGG - Intergenic
1176462737 21:7026460-7026482 CCTTTCAGGAAGCTGGTGTCTGG + Intergenic
1176485849 21:7401974-7401996 CCTTTCAGGAAGCTGGTGTCTGG - Intergenic
1176486298 21:7408238-7408260 CCTTTCAGGAAGCTGGTGTCTGG + Intergenic
1177749055 21:25257063-25257085 ACTGTCAAGAAGTTCCAGGCTGG + Intergenic
1177897504 21:26872081-26872103 GCTATCTAGAAGTTGGAGCCAGG + Intergenic
1178475421 21:32933385-32933407 ACCTTCAAGAAGTGGGTGGCGGG - Intergenic
1179866196 21:44218733-44218755 ACTGTCAGGAAGATGGAGGCTGG + Intergenic
1182035458 22:27195079-27195101 GCATCCAAGATGTTGGAGGCTGG - Intergenic
1183566093 22:38616367-38616389 TCTTTCAAGAAGTTCTGGGCTGG + Intronic
1183868179 22:40720739-40720761 CCTTATAAGAAGTGGGAGGCCGG - Intergenic
1184119948 22:42443721-42443743 CCATTCCAGGACTTGGAGGCAGG + Intergenic
1185367090 22:50441710-50441732 CCTGTGAGGAGGTTGGAGGCTGG + Intronic
949553381 3:5131199-5131221 GCTTTCAAGAAAATGGTGGCCGG - Intronic
953169403 3:40493764-40493786 CCTTCCCAGAGGTTGGAGGTTGG - Intergenic
955836881 3:63065535-63065557 CATTTCTAGAAATTCGAGGCTGG + Intergenic
955982951 3:64545601-64545623 CCTGTCATGGAGTTGGGGGCAGG + Intronic
956061581 3:65353425-65353447 CATTTCATCAAGTTGGAGTCAGG + Intergenic
958960719 3:100506999-100507021 CATTGGCAGAAGTTGGAGGCTGG + Intronic
960269721 3:115660506-115660528 ACTTTCATAAAGTTGGAGTCAGG + Intronic
961272373 3:125698869-125698891 CCTTTCCAGAACTCTGAGGCTGG - Intergenic
961278148 3:125743728-125743750 CCTTTCCAGAACTCTGAGGCCGG - Intergenic
964008674 3:151862792-151862814 CCTTTCAAGGCCTTGAAGGCTGG - Intergenic
965486512 3:169284930-169284952 CCTTTCAGGAAGTGGGAGAGGGG + Intronic
965677489 3:171213146-171213168 CCCTTCAACAAGTTGAGGGCTGG - Intronic
967224166 3:187275110-187275132 CCCTTCAGCAACTTGGAGGCTGG + Intronic
967588684 3:191246307-191246329 GCTTTCAAGAACTAGTAGGCCGG + Intronic
968196335 3:196710540-196710562 CATCTCAAAAAGATGGAGGCAGG + Intronic
970230952 4:13910578-13910600 ATTTTCATGAAGTTGCAGGCAGG + Intergenic
971941145 4:33217216-33217238 CCTTTGGATACGTTGGAGGCCGG - Intergenic
972477146 4:39461197-39461219 ACTCTGAAGAAGTTGGATGCTGG - Intronic
972868176 4:43260364-43260386 CCTTTCAGGGAGTTGGGGGAAGG - Intergenic
975821892 4:78279235-78279257 ACGTTCAAGAAATTGGAGTCTGG + Intronic
977235799 4:94505944-94505966 CCTTCCTAGAGGTTGGAGGTGGG + Intronic
977931648 4:102756466-102756488 CCTGTCATGAGGTTGGGGGCTGG + Intronic
979487405 4:121284189-121284211 CCTGTCAAGAGGTTTTAGGCAGG - Intergenic
980335953 4:131473703-131473725 CCTATCAGGGAGTTGGGGGCAGG - Intergenic
980889045 4:138794705-138794727 CCTCTCTAGAAGAGGGAGGCAGG - Intergenic
983465782 4:168087742-168087764 TCTTTCTAGAAGTTGAAAGCTGG - Intergenic
983497628 4:168461109-168461131 CCTTCCCAGAGGTTGGTGGCTGG + Intronic
983860119 4:172695649-172695671 CTCTTCAAGAAATTGTAGGCTGG + Intronic
984942541 4:184946270-184946292 CTTTTTCAGAAGATGGAGGCTGG - Intergenic
984949669 4:184997656-184997678 CCTGTCAAGAGGTGGGAGGCTGG - Intergenic
987545296 5:19305135-19305157 CCTTTCAAGCTGTAGGAGGAGGG - Intergenic
988634274 5:32965792-32965814 TCTTTCATGAAGTTGCAGCCAGG + Intergenic
988730408 5:33967156-33967178 CCTTTCAGCAAGTTCCAGGCAGG - Intronic
989101662 5:37829153-37829175 TCTTTCTAGAACTTGGAGACTGG + Intronic
989813404 5:45706180-45706202 CCCAGCAAGAAGTTGGAGGGAGG - Intergenic
990525123 5:56617847-56617869 TCTTTCATGAAGTTGCAGGCAGG - Intergenic
992565299 5:77990243-77990265 ACTTTGGAGAAGTCGGAGGCAGG - Intergenic
993559889 5:89392922-89392944 CCTTGCAAGAAGATTGAGGCTGG + Intergenic
994184440 5:96802819-96802841 CCTTATAAGAAGATGGAGACTGG + Intronic
995902964 5:117091674-117091696 CCTTGCCAGAAGTTTAAGGCAGG - Intergenic
996358286 5:122620110-122620132 CCTTTCCTGAAGATGGAGGACGG + Intergenic
996574623 5:124967579-124967601 CCTTTCCTGAAGATGGAGGACGG + Intergenic
997259606 5:132455840-132455862 CCTGACCAGAGGTTGGAGGCTGG + Intronic
999232045 5:150067264-150067286 CCTCACAAGAAGCTGGAGGCAGG - Intronic
999424783 5:151477762-151477784 CCTTCCAAGAAGGAAGAGGCAGG + Intronic
1000454084 5:161427456-161427478 CCTGTCAAGGTGATGGAGGCAGG + Intronic
1001131101 5:169064194-169064216 CCTTTCAGGAAGTCAGAGGTGGG - Intronic
1001724411 5:173884998-173885020 CCTTCAGAGAAGTTGTAGGCTGG - Intergenic
1003758402 6:9148581-9148603 CCCTTGAATAAGTGGGAGGCTGG + Intergenic
1004506673 6:16252536-16252558 CCCTTAAAGAAGGTGGAGGGAGG - Intronic
1007061307 6:38943033-38943055 CATTTCATGAAATTGGAGTCAGG + Intronic
1007233588 6:40371683-40371705 TCTTTCAAGAAGTTGAAGAGTGG - Intergenic
1008075798 6:47144431-47144453 CCTTTAGAGAATTTCGAGGCTGG - Intergenic
1010815055 6:80348402-80348424 TGTTTCTAGAAGTTGGAGGCCGG - Intergenic
1013683411 6:112550759-112550781 CCTGTCAAGGGGTGGGAGGCTGG - Intergenic
1014103617 6:117538936-117538958 TATTTCAAGAACTTGGAGGTAGG - Intronic
1014601167 6:123414607-123414629 CCAATCAAGAACTTGGAAGCAGG + Intronic
1016972705 6:149779339-149779361 CCTTTTAAGCAGTTTGTGGCAGG - Intronic
1016986318 6:149898313-149898335 CCTTTCTAGAATTTCGTGGCTGG - Intergenic
1017777748 6:157692585-157692607 CCTCTCAGGAGGTTGGAGGTTGG - Intergenic
1018177023 6:161186131-161186153 CCTCCCAAGAAGTGGGGGGCTGG - Intronic
1019849404 7:3539214-3539236 CCTATCAAGGAGTTGGAGCATGG + Intronic
1021064249 7:16154123-16154145 CATTACAAGGAGTGGGAGGCAGG - Intronic
1021986915 7:26106173-26106195 TCACTCAAGAAGTTGGAGACTGG - Intergenic
1022352484 7:29578910-29578932 CCATACAAGAAGTTTGTGGCAGG + Intergenic
1022851674 7:34269327-34269349 CCTTTGTAGAACCTGGAGGCAGG - Intergenic
1023013673 7:35944632-35944654 CCTATCAAGAGGCTGGTGGCAGG + Intergenic
1024077457 7:45829202-45829224 CCTATCAAGAGGCTGGTGGCAGG - Intergenic
1025126952 7:56352201-56352223 CCTATCAAGAGGCTGGTGGCAGG + Intergenic
1025781510 7:64605928-64605950 CCTTTTAAGTATTTTGAGGCGGG + Intergenic
1026678058 7:72445014-72445036 GCTTTCAAGAAGCTGTACGCAGG - Intronic
1028116681 7:87004990-87005012 CCTTTCAAGGAGTAGGAGAAGGG + Intronic
1029985950 7:104923415-104923437 TCTTTCATGAAGTTGCAGCCAGG - Intergenic
1031917336 7:127575708-127575730 CCTCTCCAGAAGTTGGGTGCTGG + Intergenic
1034338416 7:150337901-150337923 CCTTCCACTAAGTTGCAGGCTGG - Exonic
1034870214 7:154676781-154676803 CCTTTTAAGCATTTTGAGGCAGG + Intronic
1037960823 8:23096758-23096780 CCTTTTAAGCAGTTTGTGGCAGG + Intronic
1039578621 8:38645807-38645829 CCTGTCTAGAAGCAGGAGGCTGG + Intergenic
1042359676 8:67868445-67868467 TCTTTCAAAAAATTGGAGGAGGG - Intergenic
1045488117 8:102649735-102649757 GGTTTCAAGAATATGGAGGCTGG - Exonic
1045630419 8:104113428-104113450 CCTTTAAAGAAGTTATAGGCAGG - Intronic
1046982978 8:120356787-120356809 TCTTTCAAGAAATGAGAGGCAGG - Intronic
1047174030 8:122523497-122523519 CCTCTGAAGAAGTTGCAAGCGGG - Intergenic
1047191470 8:122682726-122682748 ACTTTAAAGAATTTGGAGGCCGG + Intergenic
1048052112 8:130828106-130828128 CCCATCAGGCAGTTGGAGGCTGG - Intronic
1050069565 9:1796190-1796212 GCTGTCAAGAGGTTGGAGGGTGG + Intergenic
1055260784 9:74430567-74430589 GCTTCCAAGAAGTTGGTGGTAGG - Intergenic
1056878682 9:90366486-90366508 CCTTTTAAGAATTTGTAGCCAGG + Intergenic
1057467536 9:95329339-95329361 GCTATCAAGAATTTGAAGGCTGG - Intergenic
1057686952 9:97243335-97243357 CCTGTGAAGAATTTGGAGGAAGG + Intergenic
1058593087 9:106586185-106586207 TCTTTCAGAAAGTTGGGGGCAGG - Intergenic
1058781998 9:108347009-108347031 CCTTTCATGAAGCTGGATGCAGG + Intergenic
1060533597 9:124364879-124364901 CCTATCCAGATGTTGGAGGTGGG - Intronic
1060665998 9:125432563-125432585 GCTTTCAGGAAGCTGGGGGCTGG + Intergenic
1062029470 9:134355745-134355767 CCTTGCCACACGTTGGAGGCAGG + Intronic
1203433020 Un_GL000195v1:109085-109107 CCTTTCAGGAAGCTGGTGTCTGG - Intergenic
1203433483 Un_GL000195v1:115495-115517 CCTTTCAGGAAGCTGGTGTCTGG + Intergenic
1185874459 X:3691135-3691157 CCTTTTAAGCAGTTTGTGGCGGG + Intronic
1187078226 X:15957883-15957905 CCTGTCAGGGAGTTGGAGGGAGG - Intergenic
1187420739 X:19131491-19131513 CCTTACATGAAGTCTGAGGCAGG + Intergenic
1190650959 X:52568302-52568324 CCTTTTAAGTAGTTTGTGGCGGG + Intergenic
1190652261 X:52578467-52578489 CCTTTTAAGTAGTTTGTGGCGGG + Intergenic
1190826688 X:54024366-54024388 TCTTTGAAGAAGTTTTAGGCAGG - Intronic
1192327791 X:70147993-70148015 CTTTTCAAGCATTTTGAGGCTGG + Intronic
1193790737 X:85812902-85812924 CCCATCAGGCAGTTGGAGGCAGG - Intergenic
1202051885 Y:20789915-20789937 CCTTTTAAGCATTTTGAGGCAGG + Intergenic