ID: 1129605618

View in Genome Browser
Species Human (GRCh38)
Location 15:77023642-77023664
Sequence AAATTCAGCGTGTCCAAAAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 119}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129605618_1129605622 14 Left 1129605618 15:77023642-77023664 CCGGTTTTGGACACGCTGAATTT 0: 1
1: 0
2: 1
3: 17
4: 119
Right 1129605622 15:77023679-77023701 ATATGAGACCCAAAAGGTGAGGG 0: 1
1: 0
2: 3
3: 10
4: 183
1129605618_1129605625 19 Left 1129605618 15:77023642-77023664 CCGGTTTTGGACACGCTGAATTT 0: 1
1: 0
2: 1
3: 17
4: 119
Right 1129605625 15:77023684-77023706 AGACCCAAAAGGTGAGGGCGGGG 0: 1
1: 0
2: 1
3: 13
4: 213
1129605618_1129605624 18 Left 1129605618 15:77023642-77023664 CCGGTTTTGGACACGCTGAATTT 0: 1
1: 0
2: 1
3: 17
4: 119
Right 1129605624 15:77023683-77023705 GAGACCCAAAAGGTGAGGGCGGG 0: 1
1: 0
2: 1
3: 21
4: 279
1129605618_1129605628 25 Left 1129605618 15:77023642-77023664 CCGGTTTTGGACACGCTGAATTT 0: 1
1: 0
2: 1
3: 17
4: 119
Right 1129605628 15:77023690-77023712 AAAAGGTGAGGGCGGGGAAGTGG 0: 1
1: 0
2: 3
3: 75
4: 853
1129605618_1129605620 8 Left 1129605618 15:77023642-77023664 CCGGTTTTGGACACGCTGAATTT 0: 1
1: 0
2: 1
3: 17
4: 119
Right 1129605620 15:77023673-77023695 TGTCAGATATGAGACCCAAAAGG 0: 1
1: 0
2: 2
3: 13
4: 166
1129605618_1129605623 17 Left 1129605618 15:77023642-77023664 CCGGTTTTGGACACGCTGAATTT 0: 1
1: 0
2: 1
3: 17
4: 119
Right 1129605623 15:77023682-77023704 TGAGACCCAAAAGGTGAGGGCGG 0: 1
1: 0
2: 2
3: 21
4: 273
1129605618_1129605621 13 Left 1129605618 15:77023642-77023664 CCGGTTTTGGACACGCTGAATTT 0: 1
1: 0
2: 1
3: 17
4: 119
Right 1129605621 15:77023678-77023700 GATATGAGACCCAAAAGGTGAGG 0: 1
1: 0
2: 1
3: 7
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129605618 Original CRISPR AAATTCAGCGTGTCCAAAAC CGG (reversed) Intronic
902459402 1:16561508-16561530 CAATTCTGCGTTTCCAAGACTGG - Intergenic
904462215 1:30686837-30686859 AAATCCTGTGTGTCCAAATCTGG + Intergenic
904528097 1:31149714-31149736 AAAATCAGCCTGTGCAACACAGG - Intergenic
905272400 1:36795739-36795761 AAATTCTGCATGTCCACAAAGGG + Exonic
906167471 1:43697587-43697609 AAATTTAGCTAGTCCACAACTGG - Intronic
912062854 1:105695528-105695550 AAGTTCATCTTGTCCAAAAGTGG + Intergenic
918299630 1:183191308-183191330 AAATTCTGGGTGTTCTAAACTGG + Intronic
920447832 1:206033213-206033235 AAATTCAGAGAGTACAAAATAGG - Intergenic
921595217 1:217047304-217047326 AAATTTGGCATGTCCAAAACTGG + Intronic
922438180 1:225627242-225627264 AAATACCACGTGTCCAAATCAGG - Intronic
923678501 1:236100382-236100404 AAATTCAGCACTTCCAAAACTGG + Intergenic
924118829 1:240775810-240775832 AAATTCAGTCAGTCAAAAACTGG - Exonic
1062795874 10:344828-344850 GACTTCAGCGTGTCCACAACTGG - Exonic
1067332650 10:45336006-45336028 ACATTCATCATGTCCAAAGCTGG + Intergenic
1067896616 10:50188194-50188216 AAATACAAAGTGTCCAAAGCAGG + Intronic
1067952356 10:50753839-50753861 AAATACAAAGTGTCCAAAGCAGG - Intronic
1074096762 10:110320030-110320052 AAATTCAACATATTCAAAACGGG - Intergenic
1078759974 11:14243965-14243987 AAACTCATCATGTCCAAAATGGG + Intronic
1080144881 11:28969507-28969529 AAATTCAGCATGTTCAACATAGG + Intergenic
1082665714 11:55972955-55972977 ACATTCAGCTTGTCCCAACCTGG - Intergenic
1090434562 11:126676077-126676099 AAATTCAGTATGTCCCAAACTGG - Intronic
1090904732 11:131065367-131065389 CAACTCAGTGTGTGCAAAACTGG + Intergenic
1091553157 12:1552172-1552194 AAAGTCAGCAGGTCCAAAAATGG - Intronic
1093152525 12:15639743-15639765 AAATACAGATTGTCCAAAGCTGG - Intronic
1093351638 12:18109586-18109608 AAATTTAACATGTCTAAAACTGG - Intronic
1093811820 12:23501061-23501083 TAATACAATGTGTCCAAAACAGG - Intergenic
1094558665 12:31528715-31528737 AAAATCAGTATGTTCAAAACTGG - Intronic
1094561653 12:31560194-31560216 AAACTCAGAATGTCCAAAAATGG + Intronic
1095518869 12:43038078-43038100 AAAATCAACGTGTTCAAAACTGG + Intergenic
1096638990 12:52979330-52979352 AAATTTAACCTGTTCAAAACTGG + Intergenic
1096909539 12:54968523-54968545 AAATTCTCTCTGTCCAAAACAGG + Intronic
1098611054 12:72458649-72458671 AAACTCAGTATGTCCAAAGCAGG + Intronic
1101668950 12:106848761-106848783 AAATTTAGCGGGTCCTAAGCAGG - Intronic
1101835526 12:108292367-108292389 AACTTCAGCCTGTCCACACCTGG - Exonic
1106674168 13:31940111-31940133 AAACTCAGCATGTATAAAACTGG - Intergenic
1107761945 13:43688792-43688814 GAACTCAGCTTGTCTAAAACTGG - Intronic
1109495791 13:63170130-63170152 AAATTGAAAGTGTCTAAAACAGG + Intergenic
1120279078 14:82416324-82416346 AAATTAAAGGTATCCAAAACAGG - Intergenic
1121619767 14:95337986-95338008 AAATTCAACTCGTCCCAAACTGG + Intergenic
1122185149 14:99986724-99986746 CAATTCAGCATGTCTACAACTGG + Intronic
1124351912 15:28962012-28962034 AAATTCATCATCTTCAAAACTGG - Intronic
1124357937 15:29011314-29011336 AAATACAACGTATCCAAAAATGG - Intronic
1129605618 15:77023642-77023664 AAATTCAGCGTGTCCAAAACCGG - Intronic
1130202643 15:81846426-81846448 AAAAGCAGTGTGTCCAAAGCTGG - Intergenic
1135706175 16:24677091-24677113 AAATTCAACATGTCCAACTCTGG + Intergenic
1136775037 16:32867372-32867394 AGACTCAGCTTGTCCAAAATGGG - Intergenic
1136895581 16:33994140-33994162 AGACTCAGCTTGTCCAAAATGGG + Intergenic
1203077455 16_KI270728v1_random:1129481-1129503 AGACTCAGCTTGTCCAAAATGGG - Intergenic
1144330205 17:14216364-14216386 AAATTTAGCTTGTCAAAAAAGGG + Intergenic
1151380474 17:73722208-73722230 AAATTCAGCTGGTCCAGAAGGGG - Intergenic
1157141465 18:45111513-45111535 AAATCCAGTGTCTCAAAAACTGG + Intergenic
1158321203 18:56266778-56266800 AAATTCAACTCATCCAAAACAGG - Intergenic
1162109540 19:8392576-8392598 AAGTTCAGCTTTTCCCAAACTGG + Intronic
1164269624 19:23660086-23660108 AAATTCAGTCTGTCCAAAATGGG + Intronic
1202675647 1_KI270711v1_random:3692-3714 CAATTCTGCGTTTCCAAGACTGG - Intergenic
926390788 2:12390462-12390484 AAACTCAGAATTTCCAAAACTGG - Intergenic
929125457 2:38519316-38519338 AAGTTCAGTGTTTCCCAAACTGG + Intergenic
930180652 2:48352624-48352646 AAATTCAGTGTGTCCGAAATTGG + Intronic
932475872 2:72005449-72005471 AAAGTCAGGGGGTCCAAGACGGG - Intergenic
939863613 2:147447410-147447432 AAATTCAGCCAGTTCAAAGCAGG + Intergenic
941366230 2:164614814-164614836 AAGTTCAGCATGTCCAAAGTGGG + Intronic
943324448 2:186481125-186481147 AAATTCAGCAGAGCCAAAACTGG + Intergenic
943844705 2:192630541-192630563 AAATTCAACATGTTCAAATCTGG - Intergenic
945984007 2:216340017-216340039 AAATTCAGCTTCTCCAACCCAGG - Intronic
1170426803 20:16243243-16243265 AAACTCAGCGTTTCCAAACATGG - Intergenic
1170437627 20:16346628-16346650 AACTTCAGCATCTTCAAAACAGG + Intronic
1175790457 20:61737268-61737290 AAATCCATCTTGTCCAGAACAGG + Intronic
1178378139 21:32085213-32085235 TAATTCACCTTGTCCAAAAGAGG + Intergenic
1182019994 22:27073649-27073671 AACTTCAGCGAGTCTAAAAATGG + Intergenic
951713462 3:25611050-25611072 AAACTCAGCATGTCTGAAACTGG - Intronic
951855248 3:27188800-27188822 AAATTCAGCCTGACAAAACCTGG - Intronic
952001966 3:28796416-28796438 AAATTCACCTTGTCCAAAACTGG - Intergenic
955476098 3:59337782-59337804 AAATGCAGTGTTTCCAAAAGTGG + Intergenic
957697805 3:83665375-83665397 AAAATCAGCGTGACTGAAACAGG - Intergenic
957931522 3:86884564-86884586 AAACTTAGCATGTCCAAATCTGG - Intergenic
959641187 3:108638230-108638252 TAATCCAGCATGTCCAAAACTGG + Intronic
961395252 3:126582712-126582734 AAATTAAACCTGTCCAAAAACGG + Intronic
963990666 3:151649726-151649748 AAATTCAACATGTCTGAAACAGG + Intergenic
965218366 3:165894227-165894249 AAACTCAGTATGTCCAAAATCGG + Intergenic
965729026 3:171750543-171750565 AAGTTCAGCGGATCCCAAACAGG + Intronic
965781136 3:172287288-172287310 AAACTCAGCATGTCCAAGAATGG - Intronic
966617038 3:181924773-181924795 AAAATCAGCATATTCAAAACTGG + Intergenic
966693960 3:182770190-182770212 AAATACAGTGTGTCAATAACAGG - Intergenic
970430626 4:15985918-15985940 AAAGTAAGCGTGTCCATAAGTGG - Intronic
972891282 4:43559236-43559258 AAATGCAGAGTTTGCAAAACTGG + Intergenic
975292969 4:72698470-72698492 AAATTCTACAGGTCCAAAACAGG - Intergenic
976685177 4:87806307-87806329 AAATTCTGCTTATCCAAAATAGG - Intronic
977303091 4:95290515-95290537 AGATTCAGTGTTTCCTAAACAGG + Intronic
980598196 4:134983699-134983721 AAATTAAGTGTGACTAAAACTGG + Intergenic
990727104 5:58768142-58768164 AAAGTCAGCATGTTCAAGACAGG - Intronic
990729228 5:58790134-58790156 AAACTCAGCATGTCCAAAATAGG + Intronic
993184801 5:84603743-84603765 GAATTTAGCATTTCCAAAACAGG + Intergenic
994826284 5:104716962-104716984 AATTTCCTGGTGTCCAAAACTGG + Intergenic
995447026 5:112255846-112255868 AAATTCAACATGTTCAAAACGGG + Intronic
996191658 5:120550786-120550808 AAATTCAGTGTGCCTAAAGCAGG + Intronic
997409255 5:133678598-133678620 AAAATGAGCATGTCCAAAACTGG - Intergenic
999934084 5:156466194-156466216 AAATTCAGTGTTTCCTTAACTGG + Intronic
1002056626 5:176601572-176601594 AAACTCAGCTTGTCCAAAAACGG - Intronic
1004363023 6:14987701-14987723 AACATCAGCGTGTCCCAACCAGG + Intergenic
1004402937 6:15305434-15305456 AAATTTAGCGTGGCGAAAACTGG - Intronic
1006911175 6:37564638-37564660 AAACGCAGCGTGTTCCAAACTGG + Intergenic
1009541727 6:64968642-64968664 AAATTCTGCTTGTCAAAAGCTGG + Intronic
1011859587 6:91738073-91738095 AAATTCAGAGTAACCAAAAATGG - Intergenic
1013191756 6:107809704-107809726 GAACTCAACGTTTCCAAAACTGG - Intronic
1013781512 6:113733654-113733676 AGAGTCAGCATGTCCAGAACAGG + Intergenic
1014574421 6:123052803-123052825 AAATTTAACGTGTTCAAAATTGG - Intronic
1016515986 6:144893475-144893497 AAATTCAGCCTGGAGAAAACAGG + Intergenic
1017105743 6:150886019-150886041 AAATTGAGCATGTTTAAAACAGG - Intronic
1018089599 6:160334168-160334190 AATTTCAACATGTCTAAAACTGG + Intergenic
1021800020 7:24295776-24295798 AAGTTCAGTATGTCCAAAATTGG + Intergenic
1023059359 7:36313549-36313571 TAGTTCAACTTGTCCAAAACGGG - Intergenic
1023594882 7:41818286-41818308 AAATTCTGAGTGTCTAAAATAGG - Intergenic
1030333162 7:108294810-108294832 AAACTAAGCATGTCCAAAAAAGG - Intronic
1030663245 7:112245923-112245945 AATGTCAGAGTATCCAAAACTGG + Intronic
1035177209 7:157060041-157060063 AAATTCACCCTGTCCCAAACTGG + Intergenic
1037449287 8:19000666-19000688 AAATTCCCTGTCTCCAAAACAGG + Intronic
1042687506 8:71458767-71458789 AAACTCAACGTGTACAAAATTGG - Intronic
1043490669 8:80745847-80745869 AAAGACAGTGTGTACAAAACAGG + Intronic
1045065695 8:98441978-98442000 AAATTCAACATGTCCAATTCTGG + Intronic
1046416978 8:113929355-113929377 AAATTCAGTGTCTAAAAAACTGG + Intergenic
1047037527 8:120955885-120955907 ACATTCAGTCTGTCCAGAACTGG + Intergenic
1051730782 9:20140626-20140648 AAATTCAGGGGGTGCAGAACAGG - Intergenic
1052144597 9:25033086-25033108 AAATACAGTGAGTCCCAAACAGG + Intergenic
1052937802 9:34107599-34107621 AAATTTAACGTGGCCAATACAGG + Intronic
1058070071 9:100592663-100592685 CAATTCAGTGTGTCCACAACAGG - Intergenic
1059976621 9:119724694-119724716 AAACTCAGCATGTCCCAAAGTGG + Intergenic
1060245355 9:121941455-121941477 AAAGTCAACCTGTCTAAAACTGG + Intronic
1186622738 X:11258450-11258472 ATTTTCACCATGTCCAAAACTGG - Intronic
1186627362 X:11308948-11308970 AAATTCAGAGTCTTCAAACCAGG - Intronic
1186629636 X:11335185-11335207 AAATTCAGCTTGTCCCCAAATGG + Intronic
1186930778 X:14387239-14387261 AAATTCTACTTGTACAAAACTGG + Intergenic
1188532378 X:31156427-31156449 AAAGGCAGCGTGTCAAAAAGTGG - Intronic
1189755775 X:44270023-44270045 AAATGCTGAGTGTCCAAACCAGG - Intronic
1190447065 X:50536668-50536690 AAATTCAACATCTGCAAAACTGG - Intergenic
1195513307 X:105742829-105742851 AAATTTAGCTTGTCCCAAACAGG + Intronic
1196821593 X:119705587-119705609 AAACTCAACATGTCCCAAACTGG - Intergenic
1199735124 X:150678935-150678957 ACATTCAGCATATCCCAAACTGG - Intergenic
1200104902 X:153706688-153706710 AGACTCAGCTTGTCCAAAACGGG + Intronic