ID: 1129605652

View in Genome Browser
Species Human (GRCh38)
Location 15:77023779-77023801
Sequence GGGTGGTGTGCGTAAGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 136}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129605652 Original CRISPR GGGTGGTGTGCGTAAGGGCT GGG Intronic
901492917 1:9605758-9605780 GGGTGGTGTGAGCAGGAGCTGGG + Intronic
901760657 1:11469128-11469150 GAGTGGTGTGGGGAAGGGCTGGG + Intergenic
903177606 1:21590200-21590222 GGGTGGTCTGGGCAAGGGCCAGG - Intergenic
904337338 1:29806586-29806608 AGGTGGTGTGGAGAAGGGCTGGG + Intergenic
904953904 1:34266996-34267018 AGGTGGTGTGTGTAGGGGGTGGG + Intergenic
905176158 1:36136784-36136806 GGGTGGAGGGAGGAAGGGCTGGG - Exonic
905973082 1:42155631-42155653 GGGTGGTGGGCTGAAGGGCGAGG - Exonic
910392303 1:86757593-86757615 TGGTGGTGCTGGTAAGGGCTTGG - Intergenic
913451742 1:118997520-118997542 GGGTGGGGTGGGAAAGAGCTAGG - Intergenic
916464903 1:165064071-165064093 GGATGGTGTACCTCAGGGCTTGG + Intergenic
916560897 1:165933542-165933564 GGGAGGTGTGTGGTAGGGCTAGG + Intergenic
920747013 1:208638402-208638424 GGGTGGTGTGCAGAGGGACTGGG - Intergenic
921302689 1:213765674-213765696 GGGTAGAGTGGGTAAGGACTTGG - Intergenic
1064030602 10:11880454-11880476 GGGTGCTGTGCGTGATGGCCAGG - Intergenic
1065519831 10:26560995-26561017 GGGGTGTGTGTGTGAGGGCTGGG - Intronic
1067527488 10:47047295-47047317 GGGTGGTGTGCGGGATGGATGGG + Intergenic
1075179258 10:120195717-120195739 GGGTGGTGTGCTTGAGCACTGGG + Intergenic
1075186491 10:120263622-120263644 TGGTGGAGTGGGTGAGGGCTAGG + Intergenic
1075604172 10:123792483-123792505 GGGTGGTGGGCGGAATGTCTGGG - Intronic
1075742504 10:124704456-124704478 GTGTGGTGGGGGTAAGGGGTGGG + Intronic
1076224739 10:128764985-128765007 TGGTGCTGGGGGTAAGGGCTGGG + Intergenic
1077059252 11:610532-610554 GGGTGGGATGCTTGAGGGCTGGG - Exonic
1077442857 11:2576794-2576816 GGGTGGTGTCAGGAAGAGCTGGG + Intronic
1077536677 11:3127968-3127990 GGGTGGGGAGGGGAAGGGCTGGG - Intronic
1081375929 11:42358450-42358472 AGGTGGTGTGCCTATGGGTTAGG - Intergenic
1081807771 11:45899756-45899778 GGGTGGGGTGGGCAAGGGATGGG - Intronic
1083620158 11:64045229-64045251 GGGTGGTGGGCGAAGGGGCCCGG + Intronic
1083764740 11:64836395-64836417 GGGTGAGGTGGGTGAGGGCTGGG - Intronic
1085270212 11:75265803-75265825 GTGTGGTGGGCATGAGGGCTTGG - Exonic
1090539143 11:127681058-127681080 GGGTGGTGTGAGTGAGGGATAGG - Intergenic
1091906928 12:4196835-4196857 GGGTGGTGTGGGATGGGGCTGGG - Intergenic
1095985551 12:47997310-47997332 GGGGGGTGGGTGTAAGGGATAGG - Intronic
1096575279 12:52548939-52548961 GGGTGGGGTGGGGTAGGGCTGGG - Intronic
1097899524 12:64858860-64858882 GGGAGGTGTGCAGAGGGGCTGGG + Intronic
1100593146 12:96048104-96048126 GGGAGGTTTGCGGAAGTGCTCGG - Intergenic
1101965099 12:109276971-109276993 GGGTGGTGTCAGGAAGTGCTTGG - Intergenic
1103785887 12:123432689-123432711 GCGTGGTGTGCACAGGGGCTGGG - Intronic
1104893970 12:132152931-132152953 GGGTGGTGTGTGTGGGGGGTGGG + Intergenic
1107430755 13:40338229-40338251 GGGTGGTGAGGGTCAGGGCCTGG + Intergenic
1109338366 13:61022060-61022082 TGGTAGTGGGAGTAAGGGCTGGG - Intergenic
1113072860 13:106438516-106438538 GGGTGGTGTGAGCTACGGCTGGG - Intergenic
1113208118 13:107941445-107941467 GGGTGGTGTGCTCAAGTCCTGGG - Intergenic
1118822511 14:69354501-69354523 GGAGGGTGTGCTGAAGGGCTAGG - Exonic
1119859751 14:77927618-77927640 GGGTGCTGTGAGTAAGGGGGCGG + Intronic
1122770846 14:104097048-104097070 GGGTGGTGGGGGTGAGGGGTGGG - Intronic
1126178639 15:45763306-45763328 GGGTGCTGTGGCCAAGGGCTTGG - Intergenic
1126685094 15:51241546-51241568 GGGTGGGGTGAGTAAGTGGTGGG - Intronic
1129394425 15:75236277-75236299 GGGTGGCCTGTGGAAGGGCTTGG - Intergenic
1129605652 15:77023779-77023801 GGGTGGTGTGCGTAAGGGCTGGG + Intronic
1130569157 15:85025218-85025240 GGGTAGTGGGAGTAAGGGTTGGG - Intronic
1131260433 15:90884765-90884787 GGGTGGTGGGTGGAAGGGCCTGG + Intronic
1133315522 16:4881319-4881341 GGGTGATGTGCAGAAGAGCTTGG + Exonic
1138113254 16:54340825-54340847 GGGTGGGGTAAGAAAGGGCTGGG - Intergenic
1138376823 16:56569937-56569959 TGGTGGTGTGGGTGAGAGCTGGG - Intergenic
1141210433 16:81974164-81974186 GGGTGGTGTGGGGAAGGGAAAGG + Intergenic
1142143952 16:88484953-88484975 GGGTGGAGTGCCTCAGGGCCTGG - Intronic
1143432225 17:6895534-6895556 GGGAGGTGGGGGTAATGGCTGGG - Intronic
1147841497 17:43375046-43375068 GGCTGGGGTACGTAAGGCCTAGG + Intergenic
1150651117 17:67010791-67010813 GGGTGGTGTGGGAGAGGGCCAGG + Intronic
1151797138 17:76353834-76353856 GTGTGGGGTGCGCAAGGGCACGG - Exonic
1152252760 17:79220276-79220298 GGTTGGTGGGGGTAGGGGCTTGG + Intronic
1152415940 17:80161940-80161962 CCGTGGTTTGCGTAATGGCTAGG - Intergenic
1156479408 18:37426660-37426682 GGGTGCGGTGCGGGAGGGCTGGG + Intronic
1160122872 18:76146179-76146201 GGGAGATGTGGGTGAGGGCTGGG + Intergenic
1160246852 18:77166071-77166093 GGGTGGAGTTTGTAAGAGCTGGG + Intergenic
1160943711 19:1631623-1631645 GGGCGGTCTGCGGAAGGGCATGG + Intronic
1160944509 19:1635124-1635146 TGGTGGTGTGCCTGAGGGTTTGG - Intronic
1161490437 19:4558167-4558189 GAGGGGTGTGAGCAAGGGCTGGG + Intronic
1166764216 19:45243351-45243373 GGGTGGTGTGCAAAAGGCCTGGG + Intronic
1167278862 19:48554594-48554616 GGGCGGGGTGGGTGAGGGCTGGG - Intronic
1167587821 19:50384661-50384683 GGGTGGTGCACGTGCGGGCTTGG + Intronic
1167888713 19:52522787-52522809 GGGTGTTGTTCTTAAGGGCGGGG + Intergenic
1167915851 19:52739722-52739744 GGGTGTTGTTCTTAAGGGCGGGG - Intergenic
1168097299 19:54123051-54123073 GGCAGGTGTGCGTGAGGGCGGGG + Intronic
1168468095 19:56620171-56620193 GGCTGGGGTGCGGGAGGGCTGGG + Intronic
925258662 2:2511098-2511120 GGGTGGTGTGAGTGATGGGTTGG + Intergenic
926534602 2:14095227-14095249 GTGTGGTGTATGTTAGGGCTTGG + Intergenic
927652450 2:24920480-24920502 GGGCGGTGGGCGGCAGGGCTGGG + Intergenic
929590479 2:43142657-43142679 GAGTGCTGTGGGTAAGGGGTGGG - Intergenic
931590376 2:63876370-63876392 GGGTGGTGGTGGTAGGGGCTGGG + Intronic
933644407 2:84798852-84798874 GGGTGGTGTGCTTGAGTCCTGGG - Intronic
935361518 2:102250401-102250423 GGGCGGTTGGGGTAAGGGCTGGG - Intergenic
938291238 2:130151892-130151914 GGGTGATGTGCTCAATGGCTTGG + Exonic
947086622 2:226460056-226460078 GGGGGGTGGGGGTAAGGGGTGGG + Intergenic
948716440 2:239867373-239867395 GTGTGGTGTGTGTAAGTGATGGG - Intergenic
1169470191 20:5878391-5878413 AGGTGGTGTGATTCAGGGCTTGG + Intergenic
1171112806 20:22500000-22500022 GGGTGGTGTGCATAGGGACAAGG + Intergenic
1172106594 20:32520781-32520803 GGGTGGCGTGCTGGAGGGCTAGG - Intronic
1172367672 20:34362567-34362589 GGGTGGAGTGCGGATGGGATGGG - Intergenic
1174342999 20:49909647-49909669 GGGTGTGGTGGGTAAGGGCATGG - Intronic
1174399151 20:50266733-50266755 GGGTTGTGTGGTTAAGGTCTCGG - Intergenic
1174593882 20:51668092-51668114 GGGGGGGGGGCGGAAGGGCTGGG + Intronic
1180956537 22:19743806-19743828 GGGGGCTGTGGGTAGGGGCTGGG - Intergenic
1181169339 22:20999536-20999558 GGATGGTGTGAGTAGGGGCCAGG - Intronic
1181436064 22:22911672-22911694 GGGTGGAGTGAGTATGTGCTTGG + Intergenic
1181998788 22:26903605-26903627 GGGTGGGGAGGGAAAGGGCTGGG + Intergenic
1182689155 22:32144473-32144495 GGTTTGTGTGCAAAAGGGCTGGG - Intergenic
1182763554 22:32742320-32742342 GGGCTGTGTGACTAAGGGCTTGG - Intronic
951589125 3:24244071-24244093 GGGTGGTGGGGGTGAGGGATTGG + Intronic
952513345 3:34078789-34078811 GGGTGGTGTGGGGGAGAGCTGGG + Intergenic
954303122 3:49711671-49711693 GGGTGCTGTGGGTCTGGGCTGGG + Intronic
962145487 3:132835638-132835660 GGGTGGTGTGGGGGAGAGCTGGG + Intergenic
965788227 3:172359027-172359049 CGGTGGTGTGTGTTAAGGCTAGG + Intronic
968323432 3:197791512-197791534 GGGTGGTGTCCGTCAGGTCGTGG - Exonic
970721307 4:18992553-18992575 GGGAGGAGTGCGTACGGGGTTGG + Intergenic
975260544 4:72292447-72292469 GGGTGGTGTGCATTGGGGCTGGG + Intronic
975888109 4:78990160-78990182 GGGTGCTGGGCTTCAGGGCTTGG + Intergenic
981061091 4:140426878-140426900 GGGGGGCGGGCGAAAGGGCTGGG - Intronic
985590138 5:760233-760255 GGGTGCTGCGGGTTAGGGCTTGG - Intronic
988449790 5:31330359-31330381 GGGTGGTGTGGGGAGGGACTTGG - Intergenic
993935689 5:93999183-93999205 GGGTGATGTGCCAAATGGCTGGG + Intronic
996567965 5:124901439-124901461 GTGTGGTGGGGGTAAGGGATGGG - Intergenic
998846613 5:146316520-146316542 GGATCCTGTGGGTAAGGGCTGGG + Intronic
1000454977 5:161437779-161437801 GGGTGGTGTGGGTAAGGGTGAGG + Intronic
1001742196 5:174062654-174062676 GGGTGGGGTGCTGATGGGCTGGG + Intronic
1004861834 6:19811833-19811855 GGGAGGTGTGCGTGTAGGCTAGG - Intergenic
1006131339 6:31871116-31871138 GGGTGGTGTGTGGAAAGGCAGGG - Intronic
1006512760 6:34530468-34530490 TGGTGGTGTGAGGAAGGTCTGGG - Exonic
1007429897 6:41770759-41770781 GGGTGGTGGGCATGGGGGCTTGG + Exonic
1008810310 6:55488958-55488980 GGGTGGTGTGTCTAAGGGCTGGG + Intronic
1016149166 6:140717719-140717741 GGGTGGTGAGTGTAAGAGGTGGG - Intergenic
1018311802 6:162517213-162517235 GGGTGGGGTGGGGGAGGGCTGGG + Intronic
1019177076 6:170165435-170165457 GGGTGATGTGTGTGAGGGATTGG - Intergenic
1022112067 7:27238042-27238064 GTGTGGTGTGGGTGAGGGATGGG + Intergenic
1024504465 7:50150014-50150036 GGGGTGTGTGCTTAAGGGTTGGG - Intronic
1027387088 7:77669480-77669502 TGGTGTTGTGAGTAAAGGCTGGG - Intergenic
1034129628 7:148703017-148703039 GAGTGGTGCAGGTAAGGGCTAGG + Intronic
1034418065 7:150975486-150975508 GGGTGGTGTGCAGAAGTTCTAGG - Intronic
1034457229 7:151177420-151177442 TGGTGGTGTGGTTAAGGGCAAGG - Intronic
1037580074 8:20239866-20239888 GGGGGGTGTGGTGAAGGGCTGGG - Intergenic
1043512832 8:80966641-80966663 GGCAGATGTGCGTAAGGGCCTGG - Intergenic
1043755695 8:84000713-84000735 GGGTGGTGTGCTCAAGGCCTGGG + Intergenic
1049660494 8:143817661-143817683 GGCTGGTGTGAGTAGGGGCATGG + Exonic
1049689058 8:143950850-143950872 GGGTGCTGAGCGTGAGGGCGCGG + Exonic
1052095928 9:24384122-24384144 GGGTGGTGTGGTCAAGGGTTGGG - Intergenic
1052914787 9:33916487-33916509 GGGTGGGGTGCTTAGGGGATTGG - Intronic
1053353774 9:37430118-37430140 GGTGGGTGTGAGGAAGGGCTGGG + Intronic
1056765257 9:89441216-89441238 GGTTGGTATTCGTAAGGTCTGGG - Intronic
1057443365 9:95097494-95097516 GAGTGGGGTCCGGAAGGGCTGGG + Intergenic
1060281251 9:122217013-122217035 GGGTGGGGTGGGAAAGGGCTGGG + Intronic
1061145175 9:128793441-128793463 GGGTGGAGTGGCCAAGGGCTTGG + Intronic
1191889383 X:65925251-65925273 GGGTGGAGTGCCTGAGGGCAGGG - Intergenic
1192174224 X:68875758-68875780 GGCTGGGGTTCGTTAGGGCTGGG + Intergenic
1195369598 X:104159812-104159834 GGGTTGTGTGTGTAGGGGTTGGG - Intergenic
1195671362 X:107472961-107472983 GGGTGGTCTGAGTCAGGGCTGGG - Intergenic
1200148823 X:153941662-153941684 GGGTGGAGTACGGAAGGGCGGGG + Intronic