ID: 1129606254

View in Genome Browser
Species Human (GRCh38)
Location 15:77026486-77026508
Sequence GTGGTATGGCCAGGACACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 152}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129606254_1129606262 16 Left 1129606254 15:77026486-77026508 CCTGGGTGTCCTGGCCATACCAC 0: 1
1: 0
2: 1
3: 24
4: 152
Right 1129606262 15:77026525-77026547 TCAGTTTCCCTCTCACAGGATGG 0: 1
1: 0
2: 1
3: 16
4: 209
1129606254_1129606260 12 Left 1129606254 15:77026486-77026508 CCTGGGTGTCCTGGCCATACCAC 0: 1
1: 0
2: 1
3: 24
4: 152
Right 1129606260 15:77026521-77026543 TGCCTCAGTTTCCCTCTCACAGG 0: 1
1: 0
2: 7
3: 57
4: 360
1129606254_1129606263 17 Left 1129606254 15:77026486-77026508 CCTGGGTGTCCTGGCCATACCAC 0: 1
1: 0
2: 1
3: 24
4: 152
Right 1129606263 15:77026526-77026548 CAGTTTCCCTCTCACAGGATGGG 0: 1
1: 0
2: 2
3: 15
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129606254 Original CRISPR GTGGTATGGCCAGGACACCC AGG (reversed) Intronic
900341466 1:2191313-2191335 GTGGTGTGGACAGGCCAGCCCGG + Intronic
900956467 1:5889115-5889137 GTGTTACGGCCAGCACCCCCAGG + Intronic
902739604 1:18426757-18426779 TTGGTCTGACCAGTACACCCAGG - Intergenic
907440426 1:54475090-54475112 GGGGTGGGGCCAGGACACTCAGG + Intergenic
908654412 1:66372733-66372755 GTGGTAGGGCCAGCCCACCATGG + Exonic
910260831 1:85292403-85292425 ATGGTAAGGTCGGGACACCCTGG - Intergenic
912439387 1:109687253-109687275 GTGGTATAGGAAGGACCCCCAGG - Intronic
912442695 1:109711693-109711715 GTGGTATAGGAAGGACCCCCAGG - Intergenic
913335803 1:117708264-117708286 GGGCTGGGGCCAGGACACCCGGG + Intergenic
915141784 1:153772513-153772535 GGGGCAGGGGCAGGACACCCGGG + Intronic
920057941 1:203206244-203206266 TGGGAATGGCAAGGACACCCTGG + Intergenic
1063370992 10:5523209-5523231 ATGGGCTGGCCAGGACTCCCTGG - Intergenic
1064350900 10:14575553-14575575 GTGTGATGGCCTGGACACCAAGG + Intronic
1066183047 10:32981803-32981825 CTGGTAGGGCCAGGACCCCAGGG + Intronic
1069177078 10:65304927-65304949 GTGGTTTTGCCATGATACCCAGG + Intergenic
1069712949 10:70501371-70501393 CTGGTCTGGCCAGGACATCATGG + Intronic
1070593777 10:77818553-77818575 GTGCCAAGGCCAGGGCACCCAGG - Intronic
1071397869 10:85240667-85240689 GTGGTAGGGCCAGGCTACCTGGG + Intergenic
1074216247 10:111387211-111387233 ATGGTATGGCCAGGGCAATCAGG + Intergenic
1075580987 10:123618328-123618350 CTGGAAAGGCTAGGACACCCTGG + Intergenic
1075651866 10:124132572-124132594 GTGGAAAGGCCTGGTCACCCAGG + Intergenic
1076083012 10:127600453-127600475 GTGCTATGGCAAGGACGCTCAGG - Intergenic
1076466062 10:130682396-130682418 GTGGTCAGGTCAGGACACCTTGG + Intergenic
1076660922 10:132055737-132055759 GTGGTTGAGCCAGGACACCACGG - Intergenic
1076896152 10:133313347-133313369 GTGGTGTGGCAAGGACAACTGGG - Intronic
1077051480 11:568759-568781 GTGGTATGGCCCGGGCTCGCGGG + Intergenic
1077244420 11:1529275-1529297 GAGGTATGGGGAGCACACCCCGG - Intergenic
1080845179 11:36020742-36020764 GTGGGCTGGCCAGGATACCCAGG + Intronic
1084189084 11:67490834-67490856 GTGGAATGCCCAGGAGGCCCAGG + Exonic
1089340300 11:117752823-117752845 GTGGTGCGGCGAGGACACCCAGG + Intronic
1089404499 11:118186429-118186451 GTGGTTTGTCCATTACACCCAGG - Intergenic
1089679327 11:120110595-120110617 CTGGTGTGGCAGGGACACCCGGG - Intergenic
1091026486 11:132146305-132146327 GCGGTTTAGCCAGGCCACCCGGG - Exonic
1091079958 11:132657274-132657296 GCGGTTTAGCCAGGCCACCCGGG + Exonic
1091921896 12:4311254-4311276 GTATTAGGGCCAGGACACCTAGG + Intergenic
1095103420 12:38205061-38205083 GTGGTATGCCCAGGGGACCTGGG - Intergenic
1097191382 12:57221163-57221185 GTGGGGTGGACAGGACAGCCTGG - Intronic
1100997056 12:100312925-100312947 GTGGTTTGGCCATGTTACCCAGG - Intronic
1101396028 12:104348522-104348544 GTGGTAAGCACAGGACACGCAGG - Exonic
1101917723 12:108908892-108908914 CTGGGATGGGCATGACACCCAGG + Intergenic
1102197920 12:111037293-111037315 GTGGTATGGCCTGGGGACACGGG - Intronic
1102247117 12:111362719-111362741 GTGCTATGGCCAGGAGATCCGGG - Exonic
1103236748 12:119379317-119379339 GTTTTGTGGCCTGGACACCCAGG + Intronic
1104414928 12:128590121-128590143 GGGCTAGGGCCAGGACACTCTGG + Intronic
1105831607 13:24167176-24167198 GCGTGATGGCCAGGACACTCTGG - Intronic
1105944581 13:25178283-25178305 GTTTTATGGCCAGGGGACCCAGG + Intergenic
1113539479 13:111095165-111095187 GTGGACTGGCCAGCACCCCCTGG - Intergenic
1115914394 14:38295068-38295090 ATGGTATAGTCAGGACATCCAGG + Intergenic
1123998222 15:25733620-25733642 GTGGCAAGCCCAGAACACCCCGG + Intronic
1126125500 15:45292024-45292046 CTGGTAAGGCAAGCACACCCAGG - Intergenic
1129600800 15:76996930-76996952 GGGGTAGGGCCTGGAAACCCAGG + Intronic
1129606254 15:77026486-77026508 GTGGTATGGCCAGGACACCCAGG - Intronic
1130562532 15:84969803-84969825 GTGGCATAGCCAGGACCCCTGGG - Intergenic
1134405665 16:13956560-13956582 GTGGTGTGTCCAGGAGACCTAGG + Intergenic
1134744201 16:16574719-16574741 GGGATATGGACAGGACACCCAGG + Intergenic
1135001282 16:18779031-18779053 GAGATATGGACAGGACACCCAGG - Intergenic
1136073694 16:27804279-27804301 GTGGAATAGCCAGGAGACCAGGG - Intronic
1138491467 16:57379547-57379569 GTGGTGTGGCCGGGACAATCTGG + Intronic
1138863204 16:60785008-60785030 GTGGTATGGCCAAGAGAATCTGG + Intergenic
1139965329 16:70742119-70742141 GTGACAGGGCCAGGACACCCAGG - Intronic
1142235820 16:88922080-88922102 GTGTCGTGGCCAGGACATCCCGG + Intronic
1142260311 16:89039725-89039747 CTGATCTGGCCAGGAGACCCAGG - Intergenic
1142403065 16:89871163-89871185 GTGGTAGGGCCAGGAGAGGCAGG - Exonic
1143614240 17:8039902-8039924 GTGGTCTGCCCAGGACACCTTGG - Exonic
1146990795 17:37270189-37270211 GTTGCATGGCCACCACACCCTGG - Intronic
1148089269 17:45013129-45013151 GGGGTGGGGCCAGGATACCCAGG - Intergenic
1148700384 17:49583279-49583301 GTGGTACTGCCAGGAGAACCGGG + Intronic
1149911810 17:60573744-60573766 GTGGTCTGGCCAGGGCAACCAGG - Intronic
1150506706 17:65706332-65706354 GGGGTGTGCTCAGGACACCCTGG + Intronic
1150842176 17:68619076-68619098 GTGAAATGGCCAGAACACCCAGG + Intergenic
1156471968 18:37382921-37382943 CTGGAATGACCAGGCCACCCAGG - Intronic
1157200630 18:45656328-45656350 GTGATAAGGCCAGAACACCTTGG + Intronic
1157761979 18:50272199-50272221 GTGGTATGGGCAGGAGATCTGGG - Intronic
1158884740 18:61816217-61816239 GTGGAATGGCGATGACAGCCAGG + Exonic
1159016691 18:63106566-63106588 GTGATCTGGCCATGACCCCCAGG - Intergenic
1160681348 19:412965-412987 ATGGAAGGGCCAGGACACCCCGG - Intergenic
1160681387 19:413114-413136 GTGGAGGGGCCAGGACGCCCCGG - Intergenic
1160708284 19:539953-539975 CTGGGATGGCCAGGCCCCCCAGG + Intronic
1162456199 19:10786511-10786533 GTGGCATGGGCAGGATACCAGGG - Intronic
1163641404 19:18464473-18464495 GTTGTATGGCCAGGGAGCCCGGG - Intronic
1163815819 19:19463802-19463824 GTGGTCCAGCCAGGGCACCCGGG - Intronic
1165008451 19:32825050-32825072 GTGATCAGGCCAGGCCACCCCGG + Intronic
925058328 2:872149-872171 TTGGCATGGGCAGGACAGCCAGG + Intergenic
925539591 2:4952308-4952330 GGGCTATTGCCAGGACATCCAGG + Intergenic
928419634 2:31128314-31128336 GAGGCATGGCCAGGACACCCCGG + Intronic
929449476 2:42027261-42027283 GTGATCCAGCCAGGACACCCTGG + Intergenic
929765742 2:44842845-44842867 GGGGTATTGCCTGGACACCAAGG + Intergenic
929861099 2:45677868-45677890 ATGGAAAGGCCAGGACACCACGG + Intronic
930673966 2:54180157-54180179 GTGGTACGCCCAGGACAGCATGG - Intronic
932403684 2:71499854-71499876 GGGGTGTGGCCAGGACCCACGGG + Intronic
934119401 2:88825463-88825485 GTGGTGGGACCAGGAGACCCCGG - Intergenic
936162868 2:110097986-110098008 GTGGTGGGACCAGGAGACCCCGG - Intronic
936267628 2:111022672-111022694 GAGGTGTGGGCAGGACCCCCAGG + Intronic
937323892 2:120977620-120977642 GTGGCGAGGCCAGGACACTCAGG - Intronic
947923390 2:233899231-233899253 TGGGTATGGCTAGGACACCCAGG + Intergenic
948980417 2:241491642-241491664 GTGGTCTGCCCTGGACACGCTGG - Exonic
1168892322 20:1303004-1303026 GTGGTTTGGGCAGGATGCCCTGG + Intronic
1169000070 20:2162188-2162210 GTGTTATGGCAAGGACACACAGG + Intronic
1170714037 20:18816983-18817005 ATGGTATGAGCAGGACTCCCAGG - Intronic
1171755208 20:29100877-29100899 GTGCTGTGGCCAGGACACAGGGG + Intergenic
1171787480 20:29482016-29482038 GTGCTATGGCCAGGACACAGAGG - Intergenic
1173502727 20:43565725-43565747 GTGGCAGGGCCTGGGCACCCTGG + Intronic
1176843168 21:13856548-13856570 GTGCTTTTGCCTGGACACCCAGG + Intergenic
1179261109 21:39758662-39758684 GTAGTCTGACCAGGAGACCCAGG - Intronic
1179576104 21:42309559-42309581 GTGGTCTGTTCAGGACACCTGGG + Intergenic
1180412242 22:12624746-12624768 GTGCTATGGCCAGGACACAGGGG + Intergenic
1182440688 22:30362223-30362245 GTGGTATGACCTGGTCACCTGGG - Intronic
1183409513 22:37646758-37646780 GTGGGCAGGGCAGGACACCCTGG - Intronic
1183456006 22:37923772-37923794 GTGGATGGGCCAGGACACACAGG - Intronic
1184060416 22:42077980-42078002 CTGGTATGGCCAGGAGATCGTGG + Exonic
1184598097 22:45526394-45526416 GAGGGATGGCCTGGACACCTTGG - Intronic
1184942897 22:47782006-47782028 GTGGTATGGGCAGGAAACCATGG + Intergenic
1185136081 22:49073455-49073477 GTGGCAGGACCAGGCCACCCAGG + Intergenic
1185301122 22:50081707-50081729 GAGCTAGGGCCAGGACAGCCAGG + Intronic
1185348506 22:50321175-50321197 AAGGTATGGCCGGGCCACCCTGG + Intronic
950396998 3:12741224-12741246 ATGGTATGGGAAGGACGCCCAGG - Intronic
950644344 3:14368203-14368225 CTGGCATGGCCAGGAGGCCCAGG - Intergenic
953209141 3:40858837-40858859 GTGGCATAACCAGGACACCAGGG + Intergenic
953366582 3:42350707-42350729 GTGGTTTGCCCAGGACAGTCGGG + Intergenic
954156590 3:48688362-48688384 GCTGTATGGCGAGGACACCGTGG - Exonic
954952832 3:54490352-54490374 CTGGTATGGCCCGGAGAGCCAGG - Intronic
955705903 3:61727392-61727414 GTGGTATGCCCAGCTCAGCCTGG + Intronic
956170814 3:66432133-66432155 GTGGAATGCTCAGGCCACCCTGG - Intronic
957618684 3:82567108-82567130 GAGGTAGGGCCAGGCCAGCCTGG + Intergenic
960639083 3:119809985-119810007 GTGGTATGGCCCGGAGCCCCAGG + Intronic
960883443 3:122369939-122369961 GTGGTTTCGCCATGTCACCCAGG + Intronic
961752141 3:129103005-129103027 GTGAGATGGCCGGGACCCCCAGG - Intronic
961953769 3:130778511-130778533 GTGGCATGGCCAGTAGCCCCAGG + Intergenic
966856339 3:184196473-184196495 GTGGTCTGGCCAGGAGAAACAGG - Intronic
968359403 3:198136834-198136856 GCGGTCTGGCCTGGGCACCCTGG - Intergenic
968447324 4:658342-658364 GTGGTGGGGGCAGGTCACCCAGG + Intronic
968447344 4:658408-658430 GTGGCAGGGGCAGGTCACCCAGG + Intronic
968624080 4:1618702-1618724 GGGGTATGGCCAGGAAAACGTGG + Intronic
972755263 4:42040208-42040230 GTGGTATGTTTAGGGCACCCAGG + Intronic
973908351 4:55552989-55553011 GTGGTATAGCAAGGATACCGAGG + Intergenic
975468991 4:74743252-74743274 CTGCTATGCCCAGGACAGCCTGG + Intergenic
977222404 4:94353761-94353783 GTGGCAAGTCCAGGAGACCCAGG + Intergenic
985438653 4:189961255-189961277 GTGCTATGGCCAGGACACAGGGG + Intronic
986173794 5:5334700-5334722 GTGGCCCTGCCAGGACACCCAGG - Intergenic
996611989 5:125393307-125393329 GTGGTATGGCCAGAAAACAGAGG + Intergenic
999798180 5:155007534-155007556 CTGGAATGACCAGGACACCTAGG + Intergenic
1001032347 5:168272069-168272091 ATGGTATGGCAAGGACACTGGGG + Intergenic
1001752909 5:174145222-174145244 GTGGTGGGTCCAGGACACCATGG + Intronic
1007401657 6:41606028-41606050 GTGGACTGGGCAGGACACCTGGG + Intergenic
1007756019 6:44100213-44100235 GTGGTATGACCTGGAGAGCCTGG - Intergenic
1008069427 6:47084680-47084702 GTGATATGGCCAGGTCACATGGG + Intergenic
1008271292 6:49493605-49493627 GTAGTATGGCCAGTTCACACAGG - Intergenic
1008673781 6:53798117-53798139 GTGGGATGGAAAGGACACCACGG + Intronic
1013284994 6:108673480-108673502 AAGGTATGACCAGGACACACAGG - Intronic
1017456792 6:154607894-154607916 GTGGTATGGCCATGACATGTGGG - Intergenic
1017768038 6:157623026-157623048 GAGGCATGGCCAGGATCCCCGGG + Intronic
1020087073 7:5316232-5316254 GTGTTAGAGCCAGGCCACCCGGG + Intronic
1023848083 7:44134524-44134546 GTTGTGTGGCAGGGACACCCAGG + Intergenic
1026682560 7:72478536-72478558 GTGGCATGTCCTGGTCACCCAGG - Intergenic
1029205617 7:98867836-98867858 CAGGGATGGCCAGGACATCCAGG + Intronic
1038865701 8:31436765-31436787 GAGGTCTGGCCAGGAGACCCTGG - Intergenic
1040521636 8:48181386-48181408 GTGGTATGGCCAAGGAACACAGG + Intergenic
1048561872 8:135547696-135547718 GTGGTATTGCCAGGAATTCCTGG + Intronic
1049573881 8:143381763-143381785 GAGGTGGGGACAGGACACCCTGG - Intronic
1052221548 9:26029883-26029905 GTATTATGGCCAGGAGGCCCAGG - Intergenic
1053473221 9:38361556-38361578 AGGGTCTGGGCAGGACACCCAGG - Intergenic
1053747660 9:41216527-41216549 GTGCTATGGCCAGGACACAGGGG + Intergenic
1053897421 9:42756730-42756752 GTGAAATGGCCAGCAGACCCAGG + Intergenic
1054338728 9:63833997-63834019 GTGCTATGACCAGGACACAGGGG - Intergenic
1054479624 9:65648845-65648867 GTGCTATGGCCAGGACACAGGGG - Intergenic
1058989684 9:110242760-110242782 GTGGCAGGGCCAGGTCAGCCAGG - Intergenic
1062514738 9:136926945-136926967 TCGGTGTGGCCAGGACCCCCCGG - Intronic
1062744090 9:138200548-138200570 GCGGTCTGGCCTGGGCACCCTGG - Intergenic
1202783794 9_KI270718v1_random:27298-27320 GTGCTATGGCCAGGACACAGGGG + Intergenic
1202803284 9_KI270720v1_random:22292-22314 GTGCTATGGCCAGGACACAGGGG - Intergenic
1203448076 Un_GL000219v1:79499-79521 GTGCTATGGCCAGGACACAGGGG - Intergenic
1189092492 X:38101252-38101274 GTGATATGGACAGGATACACAGG + Intronic
1190114856 X:47619759-47619781 GTGGTCTGGCCAGGAGCCGCGGG + Exonic
1190320415 X:49176495-49176517 GGGGCGTGGCCAGGGCACCCGGG + Intronic
1190937500 X:55009703-55009725 GTGCTATGACCAGGAAACCTGGG + Intronic
1198090280 X:133322103-133322125 GTGGACTGGCCAGGATACACGGG - Intronic
1198482379 X:137052682-137052704 GGGGGATGGTCAGGACACCCAGG - Intergenic
1200789951 Y:7290916-7290938 GTGATGTGGCCAGGAGACCAGGG - Intergenic