ID: 1129609627

View in Genome Browser
Species Human (GRCh38)
Location 15:77042983-77043005
Sequence CTGTGGGTCAGGCTGGCAAA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 226}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129609627_1129609641 18 Left 1129609627 15:77042983-77043005 CCCTTTGCCAGCCTGACCCACAG 0: 1
1: 0
2: 1
3: 21
4: 226
Right 1129609641 15:77043024-77043046 ACAAGGCTAGAGGAGGAAGATGG 0: 1
1: 1
2: 6
3: 74
4: 682
1129609627_1129609635 -8 Left 1129609627 15:77042983-77043005 CCCTTTGCCAGCCTGACCCACAG 0: 1
1: 0
2: 1
3: 21
4: 226
Right 1129609635 15:77042998-77043020 ACCCACAGTGGGCTCTGAAGGGG 0: 1
1: 0
2: 2
3: 24
4: 192
1129609627_1129609634 -9 Left 1129609627 15:77042983-77043005 CCCTTTGCCAGCCTGACCCACAG 0: 1
1: 0
2: 1
3: 21
4: 226
Right 1129609634 15:77042997-77043019 GACCCACAGTGGGCTCTGAAGGG 0: 1
1: 0
2: 2
3: 19
4: 180
1129609627_1129609638 1 Left 1129609627 15:77042983-77043005 CCCTTTGCCAGCCTGACCCACAG 0: 1
1: 0
2: 1
3: 21
4: 226
Right 1129609638 15:77043007-77043029 GGGCTCTGAAGGGGCTAACAAGG 0: 1
1: 0
2: 1
3: 15
4: 150
1129609627_1129609639 8 Left 1129609627 15:77042983-77043005 CCCTTTGCCAGCCTGACCCACAG 0: 1
1: 0
2: 1
3: 21
4: 226
Right 1129609639 15:77043014-77043036 GAAGGGGCTAACAAGGCTAGAGG 0: 1
1: 0
2: 0
3: 7
4: 97
1129609627_1129609633 -10 Left 1129609627 15:77042983-77043005 CCCTTTGCCAGCCTGACCCACAG 0: 1
1: 0
2: 1
3: 21
4: 226
Right 1129609633 15:77042996-77043018 TGACCCACAGTGGGCTCTGAAGG 0: 1
1: 0
2: 2
3: 25
4: 227
1129609627_1129609640 11 Left 1129609627 15:77042983-77043005 CCCTTTGCCAGCCTGACCCACAG 0: 1
1: 0
2: 1
3: 21
4: 226
Right 1129609640 15:77043017-77043039 GGGGCTAACAAGGCTAGAGGAGG 0: 1
1: 0
2: 2
3: 7
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129609627 Original CRISPR CTGTGGGTCAGGCTGGCAAA GGG (reversed) Exonic
900561642 1:3309970-3309992 CTGTGGGTCAGGCTCGCATGGGG - Intronic
901337545 1:8464297-8464319 CTGTGGGTGAGGGTGGGCAAGGG - Intronic
901436475 1:9250077-9250099 CTGTGGTTCAGACTGGAAAGAGG + Intronic
901775390 1:11557113-11557135 GGGTGGGTCTGGCAGGCAAAAGG - Intergenic
902414590 1:16231399-16231421 CTGTGGGGGAGGCTGGGACATGG - Intergenic
903547379 1:24134570-24134592 TTGGGTTTCAGGCTGGCAAAGGG + Intronic
904197544 1:28796959-28796981 CTCTGGGTCTGGTAGGCAAATGG + Intergenic
904456440 1:30651065-30651087 CTGTGGGTCTGGGTGCCAAGTGG - Intergenic
905464171 1:38140143-38140165 ATGTGGCTCAGGGTGGCTAAGGG + Intergenic
906129547 1:43448000-43448022 GGGTGGGGCAGGCTGGGAAATGG - Intronic
907250599 1:53135818-53135840 TTGTGGGCGAGGCAGGCAAATGG + Intronic
907389884 1:54151404-54151426 CTGTGGGTAGGGCTGGGAGAAGG - Intronic
909781103 1:79548811-79548833 CTTTGGGAAAGGCTGGAAAAAGG - Intergenic
911533583 1:99075091-99075113 CTGTGGGGCGGCCTGGCAGAGGG - Intergenic
912754774 1:112314911-112314933 ATGTGGGGCAAGCTGGCAGACGG - Intergenic
912814448 1:112817897-112817919 CTGTGGGTCAGGCCCTCACAGGG - Intergenic
913379320 1:118191431-118191453 CTGAGGGTTAGGCTGGAAAAAGG - Intergenic
915264745 1:154708913-154708935 TTGTGGATCAGGCAGGCGAAGGG - Intronic
915426295 1:155829985-155830007 CTGTGGGCCAGGCTGGAGTACGG + Intronic
916209281 1:162346608-162346630 CTGTGGTTCATCCTGGGAAAAGG + Intronic
919817102 1:201448528-201448550 CTGTGGCTCAGGCTGGAAGCTGG - Intergenic
920085108 1:203409580-203409602 CTGTGGGAGAGGCTGCTAAATGG - Intergenic
920563707 1:206957621-206957643 CTGTTGGTGAAGCTGGAAAATGG - Intergenic
921133432 1:212239244-212239266 CTCAGGGTCAGACAGGCAAAGGG + Intergenic
921407828 1:214800053-214800075 CTGTGGGTCATGAGGGCAGAAGG + Intergenic
922067437 1:222157898-222157920 CTGAGGGCCTGGCAGGCAAAGGG - Intergenic
922173833 1:223179322-223179344 CTGTGGCTCAGGCTGACCATAGG + Intergenic
922901039 1:229136929-229136951 CTGTGGGCCAGGCTCCCAACTGG + Intergenic
924070842 1:240276660-240276682 ATGAGGGTCATGGTGGCAAATGG - Intronic
1067170482 10:43902255-43902277 CTGTGAGGGAGGCTGGAAAATGG - Intergenic
1067269365 10:44775892-44775914 CTGTGGGATAGGCTGACAAGGGG - Intergenic
1069827406 10:71262568-71262590 CTGTGTGCCAGGCTGGCACTGGG + Intronic
1069971761 10:72176856-72176878 GTTTGTGCCAGGCTGGCAAATGG - Intronic
1070353065 10:75611864-75611886 CTGTGTATCAGGCCTGCAAAAGG + Intronic
1074403065 10:113157731-113157753 CTGTGGGTCAGGTTTGACAATGG + Intronic
1076127944 10:127990984-127991006 CTGAGGGCCATTCTGGCAAATGG + Intronic
1076279907 10:129237679-129237701 CAGTGGGTCAGCCTAGCAGAGGG - Intergenic
1076399846 10:130175189-130175211 CTGAGAGTCAGGCTGGAAACAGG - Intronic
1077362688 11:2147699-2147721 CTGTGGGGCAGGCTGGGCAGGGG + Exonic
1078441453 11:11371976-11371998 CTGTGGGTCTGGCTAGCACCTGG + Intronic
1079661738 11:23046194-23046216 CTGAAGGTGAGGCAGGCAAATGG - Intergenic
1079958824 11:26897026-26897048 CTGAGGGACAGGGTGGCCAAGGG + Intergenic
1080816536 11:35763143-35763165 ATGTGGGAAATGCTGGCAAAGGG + Intronic
1083441085 11:62676989-62677011 CTTTAGGTCAGGCTGCCAGATGG - Exonic
1084482028 11:69427560-69427582 CTGGGTGTCAGGCAGGAAAAGGG - Intergenic
1084676500 11:70638458-70638480 CCGGGGGTCAGGCTGGCCCAGGG - Intronic
1084942860 11:72623188-72623210 CTGTGGGTGAGTCAGGCTAATGG - Intronic
1087537266 11:99465166-99465188 GTGTGGGTCAGGTTGGAAACTGG + Intronic
1088717121 11:112558681-112558703 CTGTGGGTCAGGAAGCCAAGTGG + Intergenic
1089045116 11:115494905-115494927 CTCTGGGCCAGGTTGGCAAGTGG - Intronic
1089065383 11:115658786-115658808 GTTTGGGTGAGGGTGGCAAAGGG - Intergenic
1090977997 11:131692231-131692253 CTCTGGGTGATGCTGGCACAGGG + Intronic
1091284312 11:134399572-134399594 CTGCTGGGCAGCCTGGCAAAAGG - Intronic
1092287068 12:7134782-7134804 CTATGGGTCAGGGTGCCAAGAGG - Intronic
1094579654 12:31722714-31722736 CTGGGTGGCAGTCTGGCAAAAGG + Intronic
1095698293 12:45165050-45165072 CTGGTGTTCAGGCTGGCAACAGG - Intergenic
1095991414 12:48037122-48037144 CTTTGGGTCTGGCTAGGAAAGGG - Intergenic
1096073085 12:48786723-48786745 CTTTTGGTCAGGCTGGCATTTGG + Intronic
1096801883 12:54115789-54115811 CTGGGGGTGAGGATGTCAAACGG + Intergenic
1097168253 12:57097067-57097089 CTGGGGGTGAGGCTGGTCAAAGG + Exonic
1097336016 12:58384089-58384111 CTGGGGGTGTGGCTGGCACAGGG - Intergenic
1100998448 12:100329695-100329717 CTGTGGGTCAGGCCAGAACATGG + Intronic
1101760682 12:107656262-107656284 CTGTGGCTCAGGCTGGAGTACGG - Intronic
1102491070 12:113289894-113289916 AGGTGGGTCAGGCTGGCCAGGGG + Intronic
1103573123 12:121857905-121857927 CTGTGGTTGAGGCTGGAATAAGG - Intronic
1104006374 12:124895633-124895655 CTGTGGGTAAGGCTGGGAATTGG + Intergenic
1104935289 12:132361137-132361159 CTGGGGGTCAGGCTGGGCCAGGG + Intergenic
1106882590 13:34148253-34148275 CTGTGGGAGAGGGTGGCACATGG - Intergenic
1107405658 13:40110380-40110402 ATTTGGATCAGGGTGGCAAAAGG + Intergenic
1107555891 13:41516441-41516463 CTGAGAGTCAGGCTGGCGCAGGG + Intergenic
1109999963 13:70183952-70183974 CTTTGGGTTAGGCTGATAAAAGG - Intergenic
1113125892 13:106979151-106979173 CAGTAGGTCTGGCTGGGAAATGG + Intergenic
1113789755 13:113022081-113022103 CTGTGGCTCAGGCTGGCCTCTGG + Intronic
1113882309 13:113634136-113634158 CTCTGTGTCCGGCTGGCAGACGG + Intronic
1114355256 14:21900657-21900679 CTGTGGGTCAGGCTAGAAAAGGG - Intergenic
1114658269 14:24329095-24329117 CCGTGGCTCAGGTGGGCAAAAGG + Exonic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1118752716 14:68818209-68818231 AGGTGGGCCAGGCTGACAAATGG + Intergenic
1119175816 14:72567016-72567038 CTGAGCGTCAGGCTGACAAGAGG + Intergenic
1119404453 14:74388897-74388919 CTGTGGGTGTGGCTGCCAGATGG - Intergenic
1119675525 14:76550759-76550781 ATCTGAGTCAGGCTGGGAAAAGG - Intergenic
1119888605 14:78165431-78165453 CTGTGCGGAGGGCTGGCAAAAGG + Intergenic
1120388918 14:83881088-83881110 CTGTAGGCCAGGCTGTGAAAGGG - Intergenic
1122691228 14:103532996-103533018 GAGTGGGTCAGGCTGGCCAGGGG + Intronic
1124513996 15:30350666-30350688 CAGTGGGTCAGCCAGGCAGATGG - Intergenic
1124728925 15:32180099-32180121 CAGTGGGTCAGCCAGGCAGATGG + Intergenic
1125620364 15:41055979-41056001 CTGTTGCCCAGGCTGGCATACGG + Intronic
1126100831 15:45117284-45117306 TTCTGGGTCACGCTGGCAACCGG + Exonic
1126108324 15:45161554-45161576 CTGAGGGTCAGCCAGGCAAGGGG - Intronic
1127396049 15:58544718-58544740 CTGTGGGTAGGGCTGGAGAACGG + Intronic
1128046247 15:64620075-64620097 CTGTGGAACAGGTTGGCAATAGG + Intronic
1129205975 15:74037197-74037219 CTGAGGGTGAGGCTGGGACAAGG - Intronic
1129525701 15:76212732-76212754 CTGTGGGCAAGGCTGGCAGAGGG - Intronic
1129609627 15:77042983-77043005 CTGTGGGTCAGGCTGGCAAAGGG - Exonic
1129879300 15:78996464-78996486 CTCTGGATCAGCCTGGCAGAAGG + Intronic
1132756496 16:1487836-1487858 CTGTGGCTCAGGCAGTCAACCGG - Exonic
1134060220 16:11195006-11195028 CTGGGGGTCAGGCTGGGATAGGG + Intergenic
1135355199 16:21763221-21763243 CTCTGGGTCAGGCTGTCTAAGGG + Intergenic
1135453683 16:22579363-22579385 CTCTGGGTCAGGCTGTCTAAGGG + Intergenic
1135465294 16:22679741-22679763 CAGTGGGTCAGGTAGGCAAGTGG - Intergenic
1136010852 16:27362763-27362785 CTCTGGGTCGGGCTGGCAGGAGG - Exonic
1138133965 16:54505339-54505361 TTGTGAGTGAAGCTGGCAAAAGG + Intergenic
1138936305 16:61728720-61728742 CTAATGGTCAGGCTGGAAAACGG - Intronic
1143514163 17:7411153-7411175 CTGTGTGCCAGGCTGGCTCAGGG + Intronic
1144118303 17:12123431-12123453 CTGTGGGTCAGTCTAGCCAAAGG + Intronic
1144650461 17:17003792-17003814 CTGTGGGTGAGGGTGTCAATTGG - Intergenic
1145063995 17:19749685-19749707 CTGTGGGCCAGGCTGGCTGTGGG + Intergenic
1146807325 17:35875405-35875427 CTCTGAGTGAGGCTGGGAAAGGG - Intronic
1151724355 17:75875845-75875867 CTGTGCGAGAGGCTGGCAGAGGG + Intronic
1151964867 17:77426005-77426027 CAGTGGGTCAGGATGGCCAGAGG + Intronic
1151968678 17:77445750-77445772 CTGTGGGATAGGCTGGCCAATGG + Intronic
1152255574 17:79237498-79237520 CTGTGGGTGAGACAGGCAGATGG - Intronic
1152292138 17:79445967-79445989 CTGGGGGTGATGCTGGCACATGG + Intronic
1152749603 17:82056557-82056579 GTGGGGGTCAGGCTGGCACACGG + Intronic
1153376926 18:4391349-4391371 CCGTGGGTCAAACTGGCCAAAGG - Intronic
1156108271 18:33691969-33691991 CTGAGGGTCAGGGAGGAAAAAGG + Intronic
1156484785 18:37457790-37457812 TTGGGGGTCAGGCTTGAAAATGG - Intronic
1160777353 19:862270-862292 CTGTGGGTTAGGGTGGGAATAGG + Intronic
1162788928 19:13053194-13053216 ATGGGGGTCAGGCTGGCTGAGGG + Intronic
1163535114 19:17872413-17872435 CTGTGGGTCGGGCTGGCTCGGGG + Exonic
1163761220 19:19137793-19137815 CTGGGGGTCAGGCTGGTGCAGGG - Intronic
1164821997 19:31257596-31257618 CTGTTGGTCAGGCTGGCCCCAGG + Intergenic
1167238189 19:48327432-48327454 CTGTGGGAAGGGCTGGGAAAAGG - Intronic
1167600030 19:50449459-50449481 CTGTGGCCCAGGCTGGAAACTGG + Intronic
1167966942 19:53155771-53155793 CTGTGAGTGAGGCTGGTACATGG + Intronic
926684432 2:15687889-15687911 ATGTGGGTCAGGCTGGCCACGGG + Intergenic
927186088 2:20483687-20483709 CTGTGGCTGAGGCTGGCTGAGGG - Intergenic
930613648 2:53571004-53571026 CTGTGGCTGAGGCTGGCATGTGG - Intronic
932229185 2:70068453-70068475 CTGTGAGTCTGGCTGGAGAACGG + Intergenic
934661025 2:96143792-96143814 CAGTGGGGCAGGCAGGCAGAGGG + Exonic
935059599 2:99595917-99595939 CTTTGGGGCAGACTGGCACAGGG + Intronic
935540747 2:104345277-104345299 TTGCTGGTCTGGCTGGCAAAAGG + Intergenic
936029628 2:109060719-109060741 CTGAGGCCCAGGGTGGCAAATGG - Intergenic
936688983 2:114863536-114863558 TTGTTGGTCAGGATGGCAATTGG - Intronic
937960773 2:127456429-127456451 CTGTGCGTCAGGCAGGCTAGAGG + Intronic
942248041 2:174025372-174025394 CTGTGGGCCAGGATTGCATAGGG - Intergenic
942920869 2:181372131-181372153 ATGTGTGTGAGGCTGCCAAATGG + Intergenic
943043384 2:182829507-182829529 CTGTGGGACAACTTGGCAAAAGG - Intergenic
944449619 2:199827785-199827807 CAGTGGCTTAGGCTTGCAAAAGG - Intronic
948523641 2:238557683-238557705 CTCTGGGTCAGGCAGGAAAGTGG + Intergenic
1168946841 20:1767903-1767925 CTGGGTGACAGGCTGGCAAGAGG - Intergenic
1169950791 20:11041131-11041153 CTGTAGGCCAGGCTGCCACATGG - Intergenic
1170378816 20:15733243-15733265 CTCTTGGTTAGCCTGGCAAAAGG + Intronic
1171412510 20:24956699-24956721 CTGAGAGCCAGGCGGGCAAAAGG + Intronic
1171794828 20:29558677-29558699 CTGGGGGTGAGGATGTCAAACGG - Intergenic
1171853628 20:30325588-30325610 CTGGGGGTGAGGATGTCAAACGG + Intergenic
1172975960 20:38906114-38906136 CTGTGGGGGAGGCCGGCACAGGG + Intronic
1173363095 20:42361802-42361824 CTGTGGGTCAGGAATGCAAGAGG - Intronic
1173977259 20:47196414-47196436 CTGTGGTTCATTCTGGCAAGAGG + Intergenic
1174277925 20:49417154-49417176 CTGTAGGTGATGCTGGCAAAAGG + Intronic
1175160214 20:57002729-57002751 CTGAGGCTCACGCTGGAAAAGGG - Intergenic
1179162796 21:38911672-38911694 CATTGGGACAGGCTGCCAAAAGG - Intergenic
1179607662 21:42527659-42527681 CTGTGGGTCAGGCTGCCTCCAGG + Intronic
1179730675 21:43365648-43365670 CTGAGGGTCAGGCTGGCCCTGGG + Intergenic
1180070356 21:45432757-45432779 CTGTGGGTCAGGGTGGGACATGG + Intronic
1181636692 22:24177914-24177936 GTGTGGGTGAGGATGGCATAGGG + Intronic
1182023828 22:27101850-27101872 CTGGGAGTCAGCCTGGAAAAGGG + Intergenic
1184245260 22:43232560-43232582 CGGGGAGTCAGGCTGGGAAAGGG - Intronic
1184678711 22:46057932-46057954 TTGTGGGTCATGCTGGGAAGTGG - Intronic
952958765 3:38576794-38576816 GTGTGGGACAGGGTGGGAAAGGG + Intronic
953228393 3:41042081-41042103 CTGTGTGGCAGGCTGGCATGTGG - Intergenic
954527464 3:51284683-51284705 CTCTGGCTCAGGCTGCTAAATGG - Intronic
954787994 3:53109062-53109084 ATGAGGGTGAGGTTGGCAAAGGG - Intronic
960504186 3:118472864-118472886 CTGTGTATCAGGATGGCAAATGG + Intergenic
961087059 3:124077171-124077193 CGCTGGGTCAGGCTGGCCAGAGG + Intergenic
962475317 3:135750248-135750270 CTGTGGCACAGGCTGACCAAGGG - Intergenic
962877920 3:139550113-139550135 ATGTGGCTCAGCATGGCAAATGG + Intergenic
963933974 3:151033942-151033964 CTGTGGATCAGGTTTGCAGAGGG - Intergenic
966657178 3:182372767-182372789 CTGTGTGAAAGGCTGTCAAAAGG - Intergenic
966969734 3:185032545-185032567 CTCTGGGTCAGGCTGAGAATAGG + Intronic
967693506 3:192504604-192504626 CTGTGGATCAGGCTGGCCACAGG + Intronic
969675301 4:8611231-8611253 TGGTGGGTCAGGCAGGCGAAGGG - Intronic
969682241 4:8649781-8649803 CTGTGGGGCAGGCGGGCAGCGGG - Intergenic
972231334 4:37075772-37075794 CTGTGAGCCAGGCTAGCTAAAGG - Intergenic
977605885 4:98984664-98984686 CTGAGGGACAGCCTGGCAAGGGG - Intergenic
979217594 4:118183863-118183885 ATGTGCGTCAGGCTGGGAAAAGG + Intronic
981011373 4:139928668-139928690 CTGTGTGTCTGGGTGGGAAATGG + Intronic
981654251 4:147093908-147093930 CTGTGGGCCAGCCTTGCAGAAGG + Intergenic
984702074 4:182825064-182825086 CTGGGGGCCAGGGTGGCAGAGGG - Intergenic
985732515 5:1557237-1557259 CTGTGGCCCAGGCTGGTAACGGG + Intergenic
985878511 5:2619330-2619352 CCGTGGTCCAGGCTGACAAAGGG - Intergenic
985880587 5:2636149-2636171 CTGTGGCCCAGGCAGGAAAATGG + Intergenic
986295954 5:6438841-6438863 CTATGGGTGAGGGAGGCAAAGGG - Intergenic
986345772 5:6833831-6833853 CTGTGGCTCATGGTGGCACATGG - Intergenic
987117882 5:14740526-14740548 CACAGGGACAGGCTGGCAAAAGG + Intronic
988260718 5:28883142-28883164 CTCTGGGTCAGGCTGCCCAGTGG - Intergenic
989090277 5:37723384-37723406 CTGTGGATCAGTCTAGCACATGG - Intronic
990368786 5:55095888-55095910 CAGTGGGGCAGGGTGGGAAAGGG - Intergenic
990630329 5:57661812-57661834 CTCTGAGTCAGGAAGGCAAAGGG + Intergenic
991991957 5:72348467-72348489 CTCTGGGTCACACTGGCAACAGG - Intronic
992210440 5:74474437-74474459 CTGTTTGCCAGGCTGGGAAATGG + Intergenic
992434540 5:76742675-76742697 CTCTGGGTCTGGCTGAAAAATGG + Intergenic
996119450 5:119654312-119654334 CTGTGTGTCAGGTTGGCAAGAGG + Intergenic
997600455 5:135135048-135135070 CTGGGGGTCCCCCTGGCAAATGG + Intronic
998374252 5:141680869-141680891 CTGTGGGTCAGAGTGGGATAGGG + Intronic
998541319 5:142984144-142984166 CTGTGGTTCAGGCAGGGAGAAGG + Intronic
1004342226 6:14817780-14817802 CTGTGGGTCAAGGTCTCAAATGG + Intergenic
1007912745 6:45532407-45532429 GTGTGGGTCAGGGAGGGAAAGGG + Intronic
1016872037 6:148827165-148827187 CTTTGGGGTACGCTGGCAAATGG + Intronic
1019677367 7:2322359-2322381 CTGTGGCCCAGGCTGGAATACGG - Intronic
1020095009 7:5363264-5363286 CTGTTGCTCAGGCTGGCATGCGG - Intronic
1021142726 7:17047676-17047698 TTGTGGGTCAGGGAGGCAGAAGG - Intergenic
1022225270 7:28356481-28356503 CTGTGGGCCAGCCTGGGTAAAGG - Intronic
1022293209 7:29023116-29023138 CAGTAGGCCAGGCTGGCAAGTGG - Intronic
1024198410 7:47082467-47082489 CAGTGGGGCCGGGTGGCAAAGGG + Intergenic
1027351633 7:77317544-77317566 CTGTGGGTCAGGTAAGGAAAAGG - Intronic
1031821877 7:126512407-126512429 GTGTGGCTCAGACTGGCATACGG - Intronic
1032309853 7:130774793-130774815 CTGTTGCTCAGGCTGGAATATGG - Intergenic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034298339 7:149993662-149993684 CTGTGGGTGGGGATTGCAAAGGG - Intergenic
1034807675 7:154103120-154103142 CTGTGGGTGGGGATTGCAAAGGG + Intronic
1036741750 8:11368897-11368919 CTGTGGCTCAGGCTGGAGTATGG - Intergenic
1038210624 8:25516313-25516335 CTGTGGCTCAGGCTGTCAAGAGG + Intergenic
1042672746 8:71282526-71282548 CTGTGTGTGGCGCTGGCAAAAGG - Intronic
1044609087 8:94074411-94074433 CTCTCAGTCAGACTGGCAAATGG + Intergenic
1047154563 8:122302480-122302502 GTGTGGGTAAGGATTGCAAAAGG - Intergenic
1049017042 8:139927939-139927961 CTGTGGGACAGACTGCAAAAGGG + Intronic
1049281977 8:141754114-141754136 CTGTGGGTGAGGCGGGAGAATGG - Intergenic
1049689221 8:143951450-143951472 CTGTCCATCAGGCGGGCAAACGG + Intronic
1049793703 8:144485842-144485864 CAGGGGTTCAGGCTGGGAAAGGG - Intronic
1050456139 9:5836324-5836346 CTGAGGCTCAGGCTAGCAGAAGG + Intergenic
1053791432 9:41688885-41688907 CTGGGGGTGAGGATGTCAAACGG + Intergenic
1054473509 9:65557005-65557027 CTGGGGGTGAGGATGCCAAACGG - Intergenic
1054657760 9:67680242-67680264 CTGGGGGTGAGGATGTCAAACGG - Intergenic
1057929253 9:99179376-99179398 ATGTGGGACAGGGTGGCAACAGG - Intergenic
1058969986 9:110072325-110072347 CTGTGGCTAAGGGTGGCAAGGGG + Intronic
1059330024 9:113528991-113529013 CTGCGGGTCAGCCTGGCCCAAGG - Intronic
1060557879 9:124518561-124518583 CTGTGTGTCAGGATGAGAAACGG - Exonic
1060778985 9:126398016-126398038 CTGGGGCTCTGGCTGGGAAAGGG - Intronic
1060826476 9:126690737-126690759 CTGAGGGTCAGGGTGGCAAGAGG + Intronic
1060934136 9:127506037-127506059 CTGTGGGCCAGGCGGGCAGGAGG + Exonic
1061149396 9:128820367-128820389 CTGTGGCTCAGACTGGGAAAAGG + Exonic
1061185193 9:129048941-129048963 CTATGAGCCAGGCTGGCACAGGG + Intronic
1185689395 X:2140706-2140728 CAGTGGGAGAGGCTGGAAAAAGG + Intergenic
1187415757 X:19092133-19092155 CTGTGGATTGGGCTGGCAGAGGG - Intronic
1187474823 X:19601639-19601661 CTGTGGGTGAGGCTGGAGAGGGG + Intronic
1189239792 X:39516381-39516403 CGGTGTGTCAGGATGCCAAATGG - Intergenic
1189821101 X:44871285-44871307 CTGTGGCTCACGCCTGCAAAGGG - Intergenic
1196045191 X:111249486-111249508 CTGTATGTCTGGCTGGCAAAAGG - Intronic
1196193343 X:112816060-112816082 CAGAAGGTCAGGCTGGAAAAGGG - Intronic
1197225175 X:123949786-123949808 CTGTGTGGCTGGCTGGCAGAAGG + Intergenic
1197861849 X:130979551-130979573 CTCTGGGTGAGGTGGGCAAAAGG - Intergenic
1197864958 X:131007990-131008012 CTGTGGGGTTGGCTGGCACAGGG - Intergenic
1198544888 X:137680852-137680874 TTCTGGGCCAGGATGGCAAAAGG - Intergenic
1200059609 X:153478411-153478433 CTGTGGGTCAGGATGACATGAGG - Intronic
1200181765 X:154155212-154155234 GAGTGGGTCAGGGGGGCAAATGG - Intronic
1200187414 X:154192326-154192348 GAGTGGGTCAGGGGGGCAAATGG - Intergenic
1200193063 X:154229466-154229488 GAGTGGGTCAGGGGGGCAAATGG - Intronic
1200198818 X:154267270-154267292 GAGTGGGTCAGGGGGGCAAATGG - Intronic