ID: 1129612218

View in Genome Browser
Species Human (GRCh38)
Location 15:77070419-77070441
Sequence CCGCGGGGACGCTGCGGAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 1, 2: 3, 3: 17, 4: 186}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129612218_1129612230 13 Left 1129612218 15:77070419-77070441 CCGGCTCCGCAGCGTCCCCGCGG 0: 1
1: 1
2: 3
3: 17
4: 186
Right 1129612230 15:77070455-77070477 GGGACGGCCACTCGTCTGCGAGG 0: 1
1: 0
2: 0
3: 0
4: 40
1129612218_1129612222 -8 Left 1129612218 15:77070419-77070441 CCGGCTCCGCAGCGTCCCCGCGG 0: 1
1: 1
2: 3
3: 17
4: 186
Right 1129612222 15:77070434-77070456 CCCCGCGGATCTGCCCGCCTCGG 0: 1
1: 0
2: 7
3: 218
4: 7535
1129612218_1129612224 -7 Left 1129612218 15:77070419-77070441 CCGGCTCCGCAGCGTCCCCGCGG 0: 1
1: 1
2: 3
3: 17
4: 186
Right 1129612224 15:77070435-77070457 CCCGCGGATCTGCCCGCCTCGGG 0: 1
1: 0
2: 0
3: 14
4: 237
1129612218_1129612226 -3 Left 1129612218 15:77070419-77070441 CCGGCTCCGCAGCGTCCCCGCGG 0: 1
1: 1
2: 3
3: 17
4: 186
Right 1129612226 15:77070439-77070461 CGGATCTGCCCGCCTCGGGACGG 0: 1
1: 0
2: 0
3: 7
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129612218 Original CRISPR CCGCGGGGACGCTGCGGAGC CGG (reversed) Intronic