ID: 1129616912

View in Genome Browser
Species Human (GRCh38)
Location 15:77105937-77105959
Sequence CTGGGTGATGTGATGGGGAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 459
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 416}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129616903_1129616912 10 Left 1129616903 15:77105904-77105926 CCACTAATGGAATTCTCAGGAAT 0: 1
1: 0
2: 0
3: 15
4: 160
Right 1129616912 15:77105937-77105959 CTGGGTGATGTGATGGGGAAGGG 0: 1
1: 0
2: 2
3: 40
4: 416

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129616912 Original CRISPR CTGGGTGATGTGATGGGGAA GGG Exonic
900788677 1:4665770-4665792 CTGGGTGCTGTGCTGGGCACAGG + Intronic
900822484 1:4900028-4900050 GTGGCTGATGAGCTGGGGAATGG + Intergenic
900868065 1:5282853-5282875 GTGGGAGAGGTGGTGGGGAAGGG + Intergenic
901428419 1:9198101-9198123 CTGGGTGATGTGATGGGCTTAGG - Intergenic
901757274 1:11449056-11449078 CTCTGTGCTGTGATGGGGATGGG - Intergenic
902074808 1:13775856-13775878 GTGGGTGAAGGGATGGGGGAAGG - Intronic
902332380 1:15736889-15736911 CTGGGTCATGGGATGGTGGAGGG - Intronic
902611097 1:17597563-17597585 CGGGCCGATGAGATGGGGAAAGG - Intronic
902620710 1:17649265-17649287 CTGGGTGTTGTGATCAGGCAGGG - Intronic
903016165 1:20363548-20363570 GTGTGTGATGAGCTGGGGAAAGG - Intergenic
903347688 1:22697817-22697839 CTGGATGAGGTGCTGCGGAAGGG - Intergenic
903420359 1:23214635-23214657 CAGGGTGATGTGGTGGAGGAGGG - Intergenic
903593152 1:24472383-24472405 CTGGCTGTTAAGATGGGGAAGGG + Intronic
903999889 1:27332939-27332961 CTGGCTGTTGTGTAGGGGAATGG - Intronic
904381344 1:30113162-30113184 GTGGATGATGTGAGTGGGAAGGG + Intergenic
904604677 1:31691968-31691990 CTGTGGGTTGTGGTGGGGAAGGG + Intronic
905197279 1:36290128-36290150 CTACGTTATTTGATGGGGAAGGG - Intronic
905265675 1:36753020-36753042 CTGGGGGATGCCATGGGGCAGGG + Intergenic
905473766 1:38211674-38211696 GTGGGGGAGGTGATGGGGGATGG - Intergenic
905920824 1:41717545-41717567 CTGGGTGAAGTGAGGGAGCAGGG + Intronic
906026551 1:42679016-42679038 TTAAGTGATGTGATGGGCAAGGG - Intergenic
906193464 1:43914096-43914118 CTTGGCGATCTGATGGGGAGGGG - Intronic
906932013 1:50179160-50179182 GTGGGTGAGGGGGTGGGGAAAGG - Intronic
907796035 1:57718370-57718392 ATGGATGATGTGATGCTGAACGG + Intronic
908871342 1:68616553-68616575 CTGGGAGATGGTATGGGGCAGGG - Intergenic
908921674 1:69201723-69201745 ATTGGAGATGTGGTGGGGAAAGG - Intergenic
910108748 1:83659436-83659458 GTGGGTGATGTTAAGAGGAAGGG + Intergenic
911070217 1:93826392-93826414 CCAGCTGCTGTGATGGGGAAGGG - Intronic
911090788 1:94015423-94015445 CTGGGTGAGGGGTTGGGGAATGG + Intronic
912557572 1:110527264-110527286 GTGGGGTATGGGATGGGGAAGGG + Intergenic
912630052 1:111239018-111239040 CTGAGTGTTGCGAAGGGGAAAGG + Intronic
913217330 1:116631433-116631455 CTGGCAGAAGTGATGGGAAAGGG + Intronic
913687428 1:121246064-121246086 TTGGGAGTTGTAATGGGGAAAGG + Intronic
914039290 1:144033709-144033731 TTGGGAGTTGTAATGGGGAAAGG + Intergenic
914150169 1:145034227-145034249 TTGGGAGTTGTAATGGGGAAAGG - Intronic
914797237 1:150930678-150930700 CTGGGTGTGGTGGTGGGGCAGGG - Intronic
915147682 1:153805044-153805066 CAGGGAGGTGGGATGGGGAATGG - Exonic
915726672 1:158022962-158022984 CTGGGTGATGTGAGGGTCCACGG + Intronic
916912253 1:169363618-169363640 CTGGGTGGTGGGATGGTGCAGGG - Intronic
917093718 1:171379748-171379770 CAGGGTGAAGTCATGGGGCAGGG - Intergenic
918339441 1:183555911-183555933 GTGGGTGAGGAGATGGGGACAGG - Exonic
918498406 1:185165708-185165730 CAGGGGGATGGGATGGGGAGAGG - Intronic
920156584 1:203956916-203956938 CTGGCTGAGGTATTGGGGAAGGG + Intergenic
920457031 1:206109339-206109361 CTGGGGGGTGGGTTGGGGAAAGG + Intergenic
920474756 1:206264584-206264606 TTGGGAGTTGTAATGGGGAAAGG + Intronic
920506377 1:206518192-206518214 CTGGGGGAGGTGGAGGGGAAAGG + Intronic
923099420 1:230800589-230800611 CAGGGTGATGATATGGGGCAGGG - Intronic
924948411 1:248861428-248861450 CTGGGTGGTGGGCTGGGGGATGG - Intergenic
1063001981 10:1932899-1932921 CTGGGTGAAATGATGGGCTAGGG + Intergenic
1063241436 10:4174103-4174125 CTGGGTGCAGTGATGTGAAAAGG - Intergenic
1064299287 10:14108465-14108487 CTGGGGTATGTGATTGGAAATGG + Intronic
1064409196 10:15090783-15090805 CTAGGCAATGAGATGGGGAATGG - Intergenic
1065220978 10:23495649-23495671 CTGGCTCAGGTGATGGGGAGGGG + Intergenic
1065311098 10:24416676-24416698 CTGGATCATGTGATCAGGAAGGG + Intronic
1065976939 10:30849903-30849925 CAGGGTGGTGAGGTGGGGAAGGG + Exonic
1067242662 10:44509299-44509321 CTGGGTGACCTGGTGGGGAGGGG + Intergenic
1067836264 10:49643712-49643734 CTGGCTAATGGGAAGGGGAAAGG - Intronic
1068936141 10:62637460-62637482 CTGGTTGATTTGATGGAGAGTGG - Intronic
1069871658 10:71536729-71536751 ATATGTGATGTGATGGGGAAAGG + Intronic
1070271992 10:74965409-74965431 CTGGGCTATGTGATCTGGAAGGG + Intronic
1070747715 10:78944848-78944870 CTGGGTGAGGGCAGGGGGAAGGG - Intergenic
1070785120 10:79158294-79158316 CTGGGTGCTGTGCTGGGCAGGGG - Intronic
1071252456 10:83834362-83834384 CTGAGTGACTTCATGGGGAATGG + Intergenic
1071504179 10:86222821-86222843 CTTGGTGTTGTGGTGAGGAAGGG - Intronic
1073273296 10:102286035-102286057 CTGTGTATTGTGGTGGGGAAAGG - Intronic
1075462321 10:122625184-122625206 CTAAGTGATGAGATGGGGACAGG + Intronic
1075798909 10:125140381-125140403 CTGACTGATGTGATGAGGGAAGG + Intronic
1076251272 10:128985606-128985628 CTGGGTGCTGTGGTGAGGAATGG - Intergenic
1076579739 10:131499376-131499398 CTGAGTGATGTAAAGGGCAATGG - Intergenic
1077194491 11:1272402-1272424 CTGGGGGATGAGATTGGGGAGGG - Intergenic
1077288403 11:1777744-1777766 CAGGGTGATGTGGTGGGGATGGG + Intergenic
1077703346 11:4461640-4461662 CTGGCTGTTGTGCTTGGGAAGGG - Intergenic
1078447686 11:11416885-11416907 CTGGGGGAGGGGATGGGGCAGGG - Intronic
1078681138 11:13477050-13477072 TTGGGGGATGTGATAGAGAAAGG + Intergenic
1078922277 11:15841778-15841800 CTGGGTAATGTGGTGGGGAGGGG + Intergenic
1081197759 11:40181910-40181932 CTTGGAGATGTGAGAGGGAAGGG - Intronic
1081511203 11:43775098-43775120 GAGGGTTATGTGACGGGGAATGG + Intronic
1081885503 11:46492423-46492445 CTGGGCCATGTGATGGTTAAAGG - Intronic
1083938592 11:65883139-65883161 ATGGGGGAGCTGATGGGGAAGGG + Intronic
1083983130 11:66190917-66190939 GGCGGTGACGTGATGGGGAAGGG + Intronic
1083983379 11:66192654-66192676 CTGGGAGAGGTTCTGGGGAACGG - Intronic
1084373441 11:68760167-68760189 CGTGGTGATGGGATGGGTAATGG - Intronic
1084500481 11:69531972-69531994 CGGGGGGATGTGACGGGGAGAGG + Intergenic
1084611666 11:70207010-70207032 CGGGGTGCTGTGGTGGGGAGAGG + Exonic
1084905050 11:72339270-72339292 CTGGGAAATGTGATTGAGAAAGG + Intronic
1085066153 11:73497752-73497774 TTGGGTGGGGGGATGGGGAAGGG + Intronic
1086103084 11:83121814-83121836 CAGAGTAATGTGCTGGGGAAGGG + Intergenic
1087175620 11:95092435-95092457 CTGGGTGAGATAATGAGGAAGGG + Intronic
1087236378 11:95723535-95723557 CTGGGTGATGTGTTTTGGAAAGG - Intergenic
1087599274 11:100291595-100291617 CTGGGGACTGTGGTGGGGAAGGG + Intronic
1088574758 11:111259815-111259837 CTGGGTAATATGATGGGGACAGG - Intronic
1088871694 11:113895799-113895821 CTGGGTGAAGAGAGGGTGAACGG - Intergenic
1090592555 11:128288305-128288327 CTGGGTGATGGCAGTGGGAATGG - Intergenic
1091284415 11:134400078-134400100 CTGGGTGAGGTGCTGGCGAGGGG + Intronic
1092857192 12:12685222-12685244 ATGGGTGATGGGATGGGGACAGG - Intronic
1094699657 12:32856590-32856612 CTGGGGCCTGTCATGGGGAAGGG + Intronic
1096464059 12:51838507-51838529 CTGAGTCATGGGAGGGGGAAGGG - Intergenic
1096713461 12:53475661-53475683 CTGTGTGCTGTGAAGGGTAAAGG + Intronic
1097124980 12:56766805-56766827 CTGGGAGGGGTGAAGGGGAAGGG + Intronic
1097225999 12:57477055-57477077 GTGGGGGGTGTGGTGGGGAATGG + Intronic
1097334358 12:58365737-58365759 GTGGGTGAGGAGTTGGGGAAGGG + Intergenic
1099518924 12:83634730-83634752 CAGGTTGATGTGATGAGGCAAGG - Intergenic
1099616535 12:84942749-84942771 CTGGGTGGTGTGATAAGGAAAGG - Intergenic
1100985207 12:100197110-100197132 AGGGGGGATGTGATTGGGAATGG - Intergenic
1101330949 12:103757558-103757580 CTGTCTGAAGTGATGGGGGAAGG + Intronic
1102425492 12:112840936-112840958 GTGTGTGATGTGAATGGGAATGG - Intronic
1102447627 12:113015610-113015632 CTTTGTGATGTTCTGGGGAAAGG + Intergenic
1103147789 12:118610486-118610508 CTGGGTGAAGTCATGGGTCAGGG + Intergenic
1103177561 12:118877842-118877864 CTGGGTGAAGTCATGGGACAGGG - Intergenic
1103360973 12:120353371-120353393 CTGGGTAACCTGATGGGGCAAGG + Exonic
1103398637 12:120626874-120626896 CTGGGTGAACGGATGAGGAAGGG - Intergenic
1103612479 12:122132394-122132416 CTGGGGGATGGGTGGGGGAAGGG + Intronic
1103802727 12:123549838-123549860 CTGGCTAGTGTGGTGGGGAATGG - Intergenic
1106095959 13:26644087-26644109 CAGGGTGACGTGATGTGGGAAGG + Intronic
1107435149 13:40375228-40375250 CTTGGTGTGGTGATGTGGAAGGG + Intergenic
1107621228 13:42232550-42232572 GTGGGTTAATTGATGGGGAAAGG - Intronic
1107664821 13:42677841-42677863 CAGGGTGAAGTCATGGGGGAGGG + Intergenic
1107989025 13:45801075-45801097 CTGGGTGAAGTGATGGGTGGCGG + Intronic
1108179576 13:47827468-47827490 CTTGGTAAAGTGATGGGAAATGG + Intergenic
1108687711 13:52835259-52835281 CTGAGTGCTGTGATGGGGAGGGG + Intergenic
1109651832 13:65337009-65337031 TTGTGTGATGTGATGGGAAAGGG - Intergenic
1110805674 13:79751525-79751547 CAGGGTGATCTGAAAGGGAAAGG - Intergenic
1111476614 13:88757856-88757878 CTGAGGGATGTCATGGGGGAAGG - Intergenic
1112359926 13:98708180-98708202 CAGGGTTATGTGGTGGGTAAGGG - Intronic
1112535632 13:100252328-100252350 CAAGGAGATGTGATGGGGAATGG - Intronic
1113807475 13:113118175-113118197 CTGGGTGTTGAGGTGGGGAAGGG - Intronic
1114411059 14:22500893-22500915 CTGTGTTATGTCCTGGGGAAGGG + Intergenic
1116372131 14:44149717-44149739 CTGGCTGGTGGGAAGGGGAAAGG + Intergenic
1118811963 14:69281723-69281745 CTGTGTGCTGGGATGGAGAAAGG - Intronic
1118899472 14:69974357-69974379 ATGGGAGATGGGTTGGGGAAGGG + Intronic
1119092933 14:71801416-71801438 CTGTGGGATGGGATGGGGGATGG - Intergenic
1119178096 14:72584419-72584441 ATGGGTGATGTGATAGGGACTGG + Intergenic
1120350888 14:83356806-83356828 CTGTGTGTTGTGATGTGGAATGG + Intergenic
1120844573 14:89114686-89114708 CTGGGTGATATGATCAGAAACGG + Intergenic
1120860859 14:89253941-89253963 CTGGGTGGTTTGATGGGCCATGG - Intronic
1121125541 14:91404338-91404360 CTGGTGTATGTGATGGAGAAGGG + Intronic
1121745725 14:96289488-96289510 CTGTGTGAGGTGATGGAAAAGGG - Intronic
1122776299 14:104118353-104118375 CTGGGTGAGGAGGTGGGGACTGG - Intergenic
1123873724 15:24602248-24602270 CTGGGTGAGGTTGTGGAGAAAGG - Intergenic
1124653542 15:31489570-31489592 CTGGGTGATGTGCTCAGGCATGG + Intronic
1124844491 15:33277204-33277226 CTGGGTGAGGGCCTGGGGAAAGG - Intergenic
1125175914 15:36821630-36821652 GTTGGAGATGTGATGAGGAAGGG + Intergenic
1125397711 15:39268367-39268389 CTGGGTGAGGGGAAGGGGGAGGG + Intergenic
1126292743 15:47099959-47099981 CTGGGTGGTGGGCTGGGGCAGGG + Intergenic
1128582359 15:68818826-68818848 CTGGGTGTGGTGATGGGGGAGGG - Intronic
1128797963 15:70478718-70478740 CTGGGTGGTGTCTTGGGGCAAGG + Intergenic
1129390105 15:75216105-75216127 ATGAGTGGTGTGAGGGGGAAGGG - Intergenic
1129616912 15:77105937-77105959 CTGGGTGATGTGATGGGGAAGGG + Exonic
1132392190 15:101447226-101447248 CTGGGTGCCTTCATGGGGAAGGG + Intronic
1132846530 16:2003418-2003440 CTGGTGGTTGTGCTGGGGAAAGG - Intronic
1133144677 16:3775855-3775877 CTGGATGCTGTGTTGGGGATTGG - Intronic
1133278773 16:4653283-4653305 CAGGGTGAGGTGTGGGGGAAGGG + Intronic
1133978395 16:10616791-10616813 CTGGGTGACTTGAGGGTGAAGGG - Intergenic
1134757179 16:16677978-16678000 ATGGGTGTTGTGATTGGGAGAGG + Intergenic
1134762323 16:16725207-16725229 CTGGAAGTGGTGATGGGGAAGGG - Intergenic
1134983736 16:18633963-18633985 CTGGAAGTGGTGATGGGGAAGGG + Intergenic
1134988889 16:18681185-18681207 ATGGGTGTTGTGATTGGGAGAGG - Intergenic
1135393060 16:22110263-22110285 CAGCGTGATGTGATGTGGACAGG + Intronic
1137335158 16:47541137-47541159 TGTGGTGGTGTGATGGGGAAGGG - Intronic
1137352348 16:47724577-47724599 CTGGTTGATGTGGTTGAGAAAGG + Intergenic
1137403688 16:48173913-48173935 CTGGGTCATGAGGTGGGGCATGG - Intronic
1137626615 16:49912822-49912844 CTGGGTGTGGTCTTGGGGAAAGG - Intergenic
1137945440 16:52729693-52729715 CCAGTTGAGGTGATGGGGAAAGG + Intergenic
1137953684 16:52807791-52807813 CTGGTAGATGAGAGGGGGAAGGG - Intergenic
1138456591 16:57124735-57124757 CTAGGGGTGGTGATGGGGAACGG - Intronic
1138562489 16:57810209-57810231 CTGGGTGGGGAGATGGGGACAGG + Intronic
1138640061 16:58378388-58378410 CAGGGTGATGTCATGGGGCAGGG + Intronic
1139446689 16:67002576-67002598 CTGGGGGATGGTATGGGGTAAGG + Intronic
1139494035 16:67303071-67303093 GTGGGACATGTGATGGGGAGGGG + Intronic
1139937094 16:70579391-70579413 CTGAGTGATGTGGTGGTGACTGG - Intergenic
1141761090 16:86029177-86029199 CTGGGTGATGAGGTGGGGCTTGG - Intergenic
1142250782 16:88990886-88990908 CTGTGTGCTGTGTTGGGGAGCGG + Intergenic
1142854773 17:2723651-2723673 CTGGGAGCTCTGCTGGGGAAGGG - Intergenic
1143319932 17:6061606-6061628 ATGGGTGGGGTGGTGGGGAATGG + Intronic
1143402187 17:6653457-6653479 ATGGGTAATGTGATAGAGAATGG + Exonic
1143720049 17:8803099-8803121 CTGGGGACTGTGATGAGGAAGGG - Exonic
1144085792 17:11807442-11807464 ATGAGTGATGCGATAGGGAAGGG - Intronic
1144244068 17:13345871-13345893 CAGGGTGAAGAGAAGGGGAATGG + Intergenic
1144765119 17:17728422-17728444 CTGGGGGATGTGAGCAGGAATGG - Intronic
1145797465 17:27664146-27664168 CTGGGTGAGGTCATGAGCAAAGG + Intergenic
1146169485 17:30621688-30621710 CTGGGTGAGGAGTTGGGGAGCGG + Intergenic
1146170077 17:30625761-30625783 CTGGGTGAGGAGTTGGGGAGCGG - Intergenic
1146381644 17:32333890-32333912 AAGGGGGATGTGATTGGGAAGGG - Intronic
1146918732 17:36695509-36695531 CTGTGTGATAGGGTGGGGAAGGG + Intergenic
1147426986 17:40350641-40350663 TTGGGGGATGGGATGGGGGAGGG + Intronic
1150947568 17:69765300-69765322 CTGGGGGAGGGGAGGGGGAAGGG - Intergenic
1151345952 17:73501341-73501363 CTGGGGCATGTGCTGGGGACAGG - Intronic
1151482559 17:74378988-74379010 GTGGGTGACATGATGGGGACGGG + Intergenic
1151837602 17:76593512-76593534 CTGGGGGTTGTGATGGGAATTGG + Intergenic
1152309033 17:79537968-79537990 CTGGGTGCTGTGGTGGGGTTGGG + Intergenic
1152577475 17:81149231-81149253 GTGGGTGATGTGCTGGGGTCAGG - Intronic
1154330870 18:13428225-13428247 CTGGGAGGTGAGATGGGGAGTGG + Intronic
1155120356 18:22813061-22813083 CTGTGTGACCTGATGGGCAAGGG - Intronic
1155140169 18:23037779-23037801 CTGGGTGAGGTCATGGGACAGGG - Intergenic
1155615846 18:27720578-27720600 ATGGGCTATGTGGTGGGGAAGGG + Intergenic
1156857380 18:41798011-41798033 CTGGGAAATGTTATTGGGAAAGG - Intergenic
1157298735 18:46464561-46464583 CTGGGTGCTGCAATGGGAAAGGG - Intergenic
1157572142 18:48720257-48720279 CTAGGGGATGAGATGGGGACGGG + Intronic
1157870507 18:51226012-51226034 CTGGGTGGTGTGGTGGTTAATGG + Intergenic
1158494909 18:57946098-57946120 ATGTCTGTTGTGATGGGGAAGGG - Intergenic
1159696800 18:71569013-71569035 TTGGGTGAACTGATGGTGAATGG + Intergenic
1159870584 18:73756618-73756640 CTCCGTGATATGATGGTGAAGGG + Intergenic
1160087716 18:75794007-75794029 TTAGGTGTTGTGATGGAGAATGG - Intergenic
1160241953 18:77131459-77131481 CTGGGTGCTGGGGTGGGGAGGGG - Intronic
1160541815 18:79628044-79628066 CTGGGTGTTGTGGGGGTGAAAGG + Intergenic
1161117301 19:2504998-2505020 GGGGGTGAGGTGAGGGGGAAGGG - Intergenic
1161493501 19:4575401-4575423 CTGAGAGAGGTGGTGGGGAATGG + Intergenic
1162063133 19:8108938-8108960 CTGTGTCATGTGCTGGGGACTGG - Intronic
1162134325 19:8545809-8545831 CTAAGTGATGAGATGGAGAAGGG - Intronic
1162752513 19:12837622-12837644 CAGGGTGATGTGATGGACAATGG - Intronic
1162855751 19:13467197-13467219 CTGGGAGGTGGGATGGGGTAAGG + Intronic
1163551948 19:17970208-17970230 CTGATTGATGTGATGGGTGAGGG + Intronic
1164601705 19:29567168-29567190 ATGTGTGATGGCATGGGGAAGGG + Intergenic
1164765620 19:30764633-30764655 CTGTGTCATCTCATGGGGAAAGG - Intergenic
1166402861 19:42496322-42496344 CTGGAAGATGTTATGGGAAATGG + Intergenic
1166702327 19:44889240-44889262 CTGTGGGATGTGAAGGGGATGGG + Intergenic
1167026360 19:46921992-46922014 TTGGGTGCTGTCATGGGGCACGG - Exonic
1167618737 19:50549856-50549878 CTCGGGGAGGGGATGGGGAAGGG + Intronic
1167846079 19:52165601-52165623 GTGGATGATGTGATAGGGAAAGG + Intronic
1168720348 19:58551362-58551384 TTGGGAGAGGTGATGGAGAAGGG + Intergenic
925885379 2:8390643-8390665 TGGGGTGATGGGATGGGGTAGGG + Intergenic
927417176 2:22891546-22891568 CAGGGGGATATGATGGGGACAGG - Intergenic
928919547 2:36512413-36512435 CTGGCTGCTTTGAGGGGGAAGGG - Intronic
929777045 2:44936147-44936169 GGGGGTTATGTGATGGGAAATGG + Intergenic
929986562 2:46739640-46739662 CTGGGGGATGCGATGGGGTGGGG - Intronic
930877987 2:56241463-56241485 ATGGGGGATGTGGTGGGGAGGGG - Intronic
931240135 2:60445006-60445028 CTGAGTTAAGTGCTGGGGAAGGG - Intergenic
931842919 2:66173436-66173458 CTGGGTGAGGTGGGAGGGAAGGG + Intergenic
932047955 2:68368913-68368935 CAGGGTGATGGGAAAGGGAAGGG + Intronic
932304523 2:70692515-70692537 CTGGGAGAGGTGGTGGAGAAGGG - Exonic
932571320 2:72939996-72940018 CTGGGCCATGTGGTGGGGATGGG - Intergenic
932615555 2:73229010-73229032 CAGGGTGATGGTCTGGGGAAGGG - Intronic
933365721 2:81351149-81351171 CTGGGGACTGTGGTGGGGAAGGG - Intergenic
933439011 2:82286065-82286087 AGGGGTGATGTGGAGGGGAAGGG - Intergenic
934603168 2:95673933-95673955 CAGGGTCATGTAATGGGGGAGGG + Intergenic
934638670 2:96012751-96012773 CTAGGTGATTTGAGGAGGAAAGG + Intergenic
934794980 2:97092651-97092673 CTAGGTGATTTGAGGAGGAAAGG - Intronic
935800751 2:106692993-106693015 CGGGGAGTGGTGATGGGGAAAGG - Intergenic
936018788 2:108979365-108979387 CTGGGGGAAGTGGTGGGGCAGGG - Intronic
936403943 2:112186134-112186156 CTCGGTGAAGGGATAGGGAACGG + Intronic
936536551 2:113316142-113316164 CAGGGTCATGTACTGGGGAAGGG + Intergenic
937350915 2:121160805-121160827 GAAGGTGATGTGATAGGGAAAGG - Intergenic
937571609 2:123369906-123369928 CTGGGTGATATGGAGTGGAATGG - Intergenic
937682570 2:124659879-124659901 TTGAGGGAAGTGATGGGGAAAGG + Intronic
937985032 2:127634585-127634607 CTGGCTGATGACCTGGGGAAGGG - Exonic
938925660 2:136039240-136039262 CTAGGTGATGAGACTGGGAAAGG - Intergenic
939394612 2:141612735-141612757 CTGAGTGATGCGAAGGCGAAAGG - Intronic
939654983 2:144812935-144812957 CTGGGGAATGTCATGGGGAATGG + Intergenic
940092121 2:149932346-149932368 TTAAGTGATGGGATGGGGAAAGG - Intergenic
940237840 2:151529961-151529983 CTGGGTGAGCTGGTAGGGAAAGG - Intronic
940577659 2:155531838-155531860 CTGAGTGAGGTGGTGGGGGATGG + Intergenic
941762239 2:169257036-169257058 TTGGGTGATATGATGGTGTAAGG - Intronic
942333279 2:174851635-174851657 CTGGAAAATGGGATGGGGAACGG + Intronic
943467088 2:188241040-188241062 CAGGGTGAAGTGATGGGACAGGG + Intergenic
944476665 2:200113430-200113452 GTGGGTCAGGGGATGGGGAAGGG - Intergenic
945056041 2:205869772-205869794 CTGGGGGATGGGAGGAGGAAAGG + Intergenic
945663656 2:212716339-212716361 CTGGGTCATGCCATGGTGAAAGG + Intergenic
946141206 2:217692238-217692260 CTGGGTGTTGTTCTGGGGCAGGG - Intronic
946299228 2:218812431-218812453 CTGGGAGAGGGGCTGGGGAAGGG + Intronic
946772115 2:223099630-223099652 CTGGCTGCTGGGATGGGAAAAGG + Intronic
947116185 2:226773758-226773780 GGGGGAGATGTGATGGGGAGGGG - Intronic
947543117 2:230991912-230991934 CTGTGTGACGTGAAGGTGAAGGG + Intergenic
947820066 2:233063288-233063310 CTGGGTGATCTGAGGGGCCATGG - Intronic
948204473 2:236155941-236155963 CTGGGTAATGTGGGGAGGAAGGG + Intergenic
948257625 2:236579290-236579312 CTGGGACAGGTGAGGGGGAAGGG + Intronic
948671771 2:239573337-239573359 CTGGGTGATTGGATGGGGCTGGG - Intergenic
948722725 2:239911738-239911760 CTGGGGGATGGGCTGGGGGAAGG - Intronic
948745752 2:240092351-240092373 CTGGGTGGTGGGGTGGGGGAGGG - Intergenic
948862614 2:240760249-240760271 CTGGGAGAGGTGGTGGGGGATGG - Intronic
1168977637 20:1980131-1980153 CTGGGGTCTGTGATGGGGAAGGG - Exonic
1170704714 20:18734966-18734988 CCGGCTGATGTCAGGGGGAACGG - Intronic
1170779928 20:19416155-19416177 CTTGGTGAGGTGGTGGGGGATGG - Intronic
1171360613 20:24584106-24584128 CTGGGGGTTCTGATGGAGAAGGG - Intronic
1171449113 20:25223910-25223932 CTGGGTGATGTGGTGTGGGGTGG - Intronic
1172175227 20:32968127-32968149 CTGGGTGATGGAGAGGGGAAGGG + Intergenic
1172390107 20:34560100-34560122 CTGGCTGGTGGGATGGGGGAGGG + Exonic
1172773150 20:37393083-37393105 GTGGGGGGTGTGATGGGGATGGG - Intronic
1173577794 20:44124208-44124230 CTGGGAGGAGAGATGGGGAAAGG - Intronic
1174200812 20:48805281-48805303 CTGGGTGATGAGTTGGGGTGGGG - Intronic
1175083942 20:56443646-56443668 CATCGTGATGGGATGGGGAAAGG + Intronic
1175237708 20:57525572-57525594 CTGGGAGATCTGAGGGGGAATGG + Intronic
1175283468 20:57820893-57820915 AAGGGTGATGGGAAGGGGAAGGG + Intergenic
1175332654 20:58175914-58175936 CTGGGTGACGGGATGGACAAGGG + Intergenic
1175770877 20:61623360-61623382 CTTTGTGATGGGGTGGGGAAAGG - Intronic
1175924114 20:62463466-62463488 ATGGGTGATGGGCGGGGGAAGGG + Intergenic
1176112460 20:63416852-63416874 CTGGGGGATGGGGTGGGGAGGGG - Intronic
1177054662 21:16286145-16286167 TTGGGGGAAGGGATGGGGAAAGG + Intergenic
1178047652 21:28713237-28713259 CTGGGTGATGGCATGAGCAATGG - Intergenic
1178994278 21:37383811-37383833 TGGGGTGATGTGATAGGTAATGG + Intronic
1179178231 21:39023726-39023748 CAGTGTGATGTGATCAGGAAAGG + Intergenic
1180042311 21:45287157-45287179 CTGGGGGATGGGATGGGGCGGGG - Intronic
1180185830 21:46138787-46138809 CTGGGTGCTGTGACGGGGCGTGG - Intronic
1180613753 22:17114289-17114311 CTGGGAGAGGCGATGGGGCATGG - Exonic
1180655039 22:17413141-17413163 GAGGGTTATCTGATGGGGAATGG + Intronic
1180883148 22:19220909-19220931 ATTGGTCAGGTGATGGGGAAGGG + Intronic
1181380390 22:22497656-22497678 CAGGGTGAAGTTAAGGGGAATGG + Intronic
1181743944 22:24942763-24942785 CAGGGTGATATGATGGAAAAAGG + Intronic
1182397666 22:30047939-30047961 CAGAGTGATGTGATGTGTAAAGG + Intergenic
1182475993 22:30576674-30576696 CAGGGTGCTGTGATGGGGTGAGG - Exonic
1183423029 22:37723392-37723414 TTGGGTGATTCGATGGGGAGAGG - Exonic
1184252248 22:43267553-43267575 CTGTGTTAAGTGAGGGGGAAGGG - Intronic
1184323050 22:43757658-43757680 CAGGAGGATGTGATTGGGAAGGG - Intronic
1184609807 22:45595478-45595500 AAGGGTGCTGTGAAGGGGAAGGG - Intronic
1184768632 22:46585721-46585743 CTGGTCTATGGGATGGGGAAGGG + Intronic
949747402 3:7310949-7310971 AAGGCTGATGTGATGAGGAAAGG - Intronic
950104206 3:10378102-10378124 CTGGGTGCTGTGGTAGAGAAAGG + Intronic
950224675 3:11223995-11224017 CTGGAACATGTCATGGGGAAAGG - Intronic
951227978 3:20143074-20143096 CTGGGTGATGTATTGGAGATGGG + Intronic
953076430 3:39574798-39574820 CTGGGTGATGGGATGAGGCATGG + Intergenic
953469307 3:43153708-43153730 GTGGGTGATGTCATGGGGTGGGG + Intergenic
953636545 3:44669856-44669878 GTGGGTGGTGTGTTGGGGGAAGG + Intergenic
953781441 3:45874587-45874609 CAGGGTAATGTGATAGAGAATGG - Intronic
953793495 3:45966117-45966139 CTGGGAGCTGTGATAGGAAAGGG + Intronic
954007253 3:47601665-47601687 TTGGCTGATGTGATGGGCTACGG + Intronic
954394553 3:50286603-50286625 GTGGATGATGTGCTGGGGGAGGG + Intronic
954433933 3:50486014-50486036 CTGGGGAATGTGCTGGGGAGAGG - Intronic
956290069 3:67651856-67651878 CAGGGTCATGGGATGGAGAATGG - Intronic
960315749 3:116174609-116174631 CTGGTTGAAGTGAAGGAGAAGGG - Intronic
961353332 3:126317527-126317549 CAGGGAGATGTGACTGGGAAGGG + Intergenic
962353521 3:134673713-134673735 CTGGTGGAGGGGATGGGGAAGGG - Intronic
962601346 3:136993230-136993252 CTGAGTGATGTGCAGGAGAATGG - Intronic
963713081 3:148769889-148769911 CAGGGTGATGTGATGTGAGAAGG - Intergenic
963851644 3:150215963-150215985 GTGGGAGATGGGAGGGGGAAAGG + Intergenic
963926555 3:150957402-150957424 CTTGATGAAGTGGTGGGGAAGGG - Intronic
963945816 3:151144767-151144789 CTGGGACAGGTGGTGGGGAAGGG - Intronic
965453011 3:168861701-168861723 CAGGGTAATGTGAAGGGGATTGG + Intergenic
966220633 3:177547701-177547723 CTGGGTGAGGTACTGAGGAAGGG - Intergenic
966807547 3:183818837-183818859 GAGGGTGGTGTGATGGGGGAAGG + Intronic
968434323 4:576784-576806 CTGGGTAAGGAGAAGGGGAAAGG + Intergenic
969028543 4:4193338-4193360 GTGGGTGTGGTGATGGGGAAGGG - Intronic
971141969 4:23934120-23934142 GTGGGTGGTGACATGGGGAAGGG + Intergenic
973612450 4:52649051-52649073 CTGGGTGCTGTGGTGGTGAGGGG - Intronic
974352397 4:60766292-60766314 GTGGTTGATGTGATGGGAGAGGG - Intergenic
974504587 4:62752220-62752242 CTGGGGAAGGTCATGGGGAAAGG + Intergenic
976091646 4:81464590-81464612 CTGGGGGTGGTGATGGGGAGAGG - Intronic
976229580 4:82827589-82827611 ATTGGTGATGTGATGGGAACAGG + Exonic
976248128 4:83023941-83023963 CTGTGTGATGTGGGGGGCAAGGG + Intergenic
976682079 4:87768472-87768494 CTGTCTGATGTGAGGGGAAAGGG - Intergenic
977379953 4:96260088-96260110 CTGGGTGAAGTGAGGAGGATGGG + Intergenic
977718229 4:100208309-100208331 ATGAGTGAGGTGAGGGGGAAGGG + Intergenic
977984942 4:103372186-103372208 CAGGGTGAAGTCATGGGGCAGGG + Intergenic
978233240 4:106425869-106425891 AAAGGTGATGTGCTGGGGAAGGG - Intergenic
980840814 4:138258714-138258736 GTGGGTGAGGATATGGGGAAAGG + Intergenic
982292070 4:153790678-153790700 CCGGGTGCTCTGCTGGGGAAGGG + Intergenic
983076328 4:163331721-163331743 CTGGGTTAGGAGATTGGGAATGG - Intronic
985425710 4:189828463-189828485 TGGGGTGAGGTGGTGGGGAAAGG - Intergenic
987875952 5:23681389-23681411 ATGGGTGATGTGAGGAAGAATGG - Intergenic
988550239 5:32194179-32194201 CTTAGTGAATTGATGGGGAAAGG - Intergenic
988783642 5:34546037-34546059 CTGGGTGAAGTTATGGGACAGGG - Intergenic
988884945 5:35546541-35546563 GTGCTTGATGTGATGAGGAAAGG + Intergenic
991453373 5:66776864-66776886 GTGGGTGGTATGATGGGGGAAGG + Intronic
991460733 5:66855613-66855635 AAGGGTGCTGTGATGGGCAACGG + Intronic
992087890 5:73294473-73294495 TTGGGGGATGGGAAGGGGAAAGG + Intergenic
992447167 5:76844460-76844482 CTCAGTGATGTGATGGGGAAAGG + Intergenic
993691815 5:91011069-91011091 CTAGGAAATGGGATGGGGAAGGG + Intronic
994327179 5:98462062-98462084 CTGGTTGCTTTGATGGGGTAAGG + Intergenic
995195955 5:109368722-109368744 CTGAATGCAGTGATGGGGAATGG - Exonic
997597545 5:135117116-135117138 CTGTGTGATGTGCTGGGGTGGGG + Intronic
997598965 5:135126605-135126627 CTGGGTGCTGTGTTGGGAATGGG + Intronic
997633753 5:135389722-135389744 CTGGGTGACTGGATGGGGATTGG - Intronic
998093170 5:139382631-139382653 TAGGGTGAAGTGATGGGGACAGG + Intronic
998378657 5:141708506-141708528 CCGGGGGATGGGATGGGGAGTGG - Intergenic
998552471 5:143090673-143090695 CTGGGTTAGCTGATGGGGGAGGG + Intronic
999138980 5:149344902-149344924 CTGGGAGGAGTGATGGGCAATGG + Intergenic
999713700 5:154341909-154341931 CTGGCTCATGGGATGGGGAAAGG - Intronic
999784973 5:154882700-154882722 CTGGCTGTTGTGCTTGGGAAGGG - Intergenic
999871512 5:155756444-155756466 TTGGGGGATGTGATGGGAAGAGG - Intergenic
1000062428 5:157669167-157669189 CTGGGTGCTGGGATTGGGGAGGG + Intronic
1000981153 5:167818614-167818636 CTGAGTGCTGTGATGTGGGAAGG - Intronic
1002569979 5:180134726-180134748 CTGGGTGAAGAGATGGGGACAGG - Intronic
1002636935 5:180613189-180613211 CGGGGTGACTTGATGGGGAAGGG - Intronic
1003327231 6:5101112-5101134 GGGGGTTATGTGGTGGGGAAGGG - Intergenic
1006531379 6:34657873-34657895 CTGGCTAAGGTGATGGGAAAGGG + Intronic
1006670170 6:35725490-35725512 CTGGGTGATGGGAGAGAGAAAGG + Intronic
1006865195 6:37203747-37203769 ATGAATGATGTGATGGAGAATGG - Intergenic
1007168450 6:39845592-39845614 CTGGGTGAAGCGGTGGGGAGTGG - Intronic
1010022540 6:71177497-71177519 ATGGGTCATGGGATGGGGAAAGG - Intergenic
1016197721 6:141366442-141366464 CAGGGGGATGGGATGGGGGAGGG - Intergenic
1017743334 6:157426251-157426273 CTGGGTGGGGAGGTGGGGAAGGG + Intronic
1018447147 6:163868058-163868080 CTGGGTGAGGAGCTGGGGAGGGG + Intergenic
1020137967 7:5596982-5597004 CTGGGGGTGGTGATGGGGACTGG + Intronic
1022480160 7:30738299-30738321 ATGGGTGATGTGATAGTGAATGG + Intronic
1023620439 7:42066443-42066465 CTGGGTTAAAAGATGGGGAAAGG + Intronic
1024554079 7:50588302-50588324 CTGGGAAATGGGATGGGGCAGGG + Intergenic
1025949255 7:66130622-66130644 CTGGGTGATGGGCGGGTGAAAGG + Intronic
1026153707 7:67809633-67809655 TTGGGTGTGGTGATGAGGAAAGG - Intergenic
1026180102 7:68031720-68031742 TTGGATGATGTCATGGGGTAAGG - Intergenic
1026508515 7:71007378-71007400 CTGGGTGATGTGAGGAGAAATGG + Intergenic
1027155521 7:75764799-75764821 ATGGTTGATGTGGTGGGGCAGGG - Intergenic
1027243793 7:76351879-76351901 CTGGGTGGGGTGAGGGGTAAGGG - Intronic
1027268976 7:76510168-76510190 CAGCGTGCTGTGATGGGGATGGG + Intergenic
1028446611 7:90931583-90931605 ATGGCTGATGTGATGGGGGAAGG + Intronic
1029284137 7:99454535-99454557 CTGGGGGAGGGGATGGGGACAGG - Intronic
1029465421 7:100721711-100721733 CTGTGGAATGTGCTGGGGAAGGG - Intronic
1029527662 7:101104866-101104888 CTTGGTGTTTAGATGGGGAAGGG + Intergenic
1031127996 7:117795981-117796003 CTGGGTGAAGATTTGGGGAAAGG - Intronic
1031376447 7:121032544-121032566 CGGGGTGGTGGGGTGGGGAAGGG + Intronic
1031552131 7:123128022-123128044 TTGTGTGAAGTGAGGGGGAAGGG - Intronic
1031785592 7:126027607-126027629 CTGTGTGAGGTGATTGGGTAAGG + Intergenic
1032007559 7:128315226-128315248 CTGTGTTATGGGAAGGGGAATGG - Intronic
1032720859 7:134549966-134549988 TTAGGTGTTGTTATGGGGAAGGG + Intronic
1032980245 7:137273703-137273725 CTGGGAGCTGTGAGGGGGAAAGG + Intronic
1033215104 7:139487680-139487702 AAGGGTGAGGTGAAGGGGAAGGG + Intergenic
1033254239 7:139785779-139785801 GTGGGAGATGAGATTGGGAAGGG - Intronic
1033261713 7:139849680-139849702 CTGGGGGATGGGATGGGGCGGGG + Intronic
1035216435 7:157371156-157371178 GTGGGTGATGGGTTGGGGTAGGG - Intronic
1036188319 8:6645143-6645165 GTGGCTGATGTGGTGGGGGATGG - Intergenic
1037126464 8:15356834-15356856 TAGGGTGATGTGATGAGGACTGG - Intergenic
1037950207 8:23014615-23014637 CTGGGGGATGTGGTGGGGCAGGG + Intronic
1038503422 8:28063920-28063942 CTGGGGCATGTGATTGAGAAAGG - Intronic
1038607781 8:29026372-29026394 GTGGGGGATGTGATGGCTAAGGG + Intronic
1039549914 8:38435958-38435980 CTGAGAGATGAGGTGGGGAATGG + Intronic
1039740647 8:40379715-40379737 CTCTGTGATGTGGTGCGGAACGG + Intergenic
1040451181 8:47548923-47548945 CTGGGACATGTCATGGGGTAGGG - Intronic
1040494647 8:47955773-47955795 TTGGGTGATGTGTTTGGGGAAGG - Intronic
1040546218 8:48400067-48400089 GTTGTTGATGTGATGGCGAAGGG + Intergenic
1041450719 8:58004030-58004052 CTGGGGGATGGGGTGGGGGAGGG + Intronic
1043037146 8:75212260-75212282 CTGGGTGAAGTGGTGATGAAAGG + Intergenic
1044505831 8:93018111-93018133 GGGGGTGAAGTGGTGGGGAATGG + Intergenic
1045322307 8:101091396-101091418 CTGGGATATGAGATGGGGAGGGG + Intergenic
1045661047 8:104438010-104438032 CTGGGTGATTTGAATGGGCATGG - Intronic
1046174174 8:110553259-110553281 CAGGCTTATGTGTTGGGGAATGG + Intergenic
1048109290 8:131449955-131449977 TTGGTTGATGTGGTGGGGAGAGG + Intergenic
1049151682 8:141038962-141038984 GTGGGTGATGAGTTTGGGAAGGG - Intergenic
1049359921 8:142207522-142207544 GTGGGTGGATTGATGGGGAATGG + Intergenic
1049589014 8:143447160-143447182 CTGGGTGCTGTGGTAGGGCAGGG - Intronic
1049655638 8:143795730-143795752 CTGTGAGCTGTGATGGGGACCGG - Intronic
1050121124 9:2308338-2308360 CTGGGAAATGTATTGGGGAAGGG - Intergenic
1052088296 9:24294793-24294815 ATGGGTGATGTCATGGTGAGTGG + Intergenic
1053430969 9:38041497-38041519 ATGGGTGATGGGAAGGAGAAGGG + Intronic
1055472620 9:76628362-76628384 GTGGGTGAGGTGGTGAGGAATGG - Intronic
1057384981 9:94599036-94599058 CTAGGTGTTGGGAGGGGGAATGG - Intergenic
1057425720 9:94947879-94947901 CTGGGGGAGGTGATGTGGAGAGG - Intronic
1059056924 9:110993265-110993287 GTGGGTGAGGGGCTGGGGAAGGG - Intronic
1060001558 9:119963477-119963499 CTGGGTGATGTGAGAGGACAAGG + Intergenic
1060727409 9:126015699-126015721 GTGGGAGCTGAGATGGGGAAGGG + Intergenic
1060752745 9:126184297-126184319 TTGGGTGCTTGGATGGGGAATGG - Intergenic
1061291675 9:129653888-129653910 CTGGGTGATTTGATGGGGCAGGG + Intergenic
1061721656 9:132555734-132555756 CTGGGGGGTGTGTTAGGGAAAGG - Intronic
1061893796 9:133636508-133636530 CAGGGGGATGTGATAGGGGAGGG - Exonic
1062097477 9:134710670-134710692 TTGGGTGCAGTGGTGGGGAAGGG + Intronic
1062231212 9:135482429-135482451 CTGGCTGAAGTGATGGGGATGGG - Intronic
1062324444 9:136005412-136005434 CTTGGTGGTGGGATGGGGACTGG + Intergenic
1062622371 9:137428736-137428758 CTGGGTGGGGGGATGGGGGAGGG + Intronic
1186079263 X:5912809-5912831 CTCTGTGATGTGATGGAGCAGGG + Intronic
1186156645 X:6733043-6733065 CAGGGTGATGAGAAGGGGCATGG + Intergenic
1186254355 X:7702862-7702884 CTGGCAAATGTGGTGGGGAATGG + Intergenic
1186390214 X:9151227-9151249 CAGGGGAATGTGATGGGGAATGG - Intronic
1187197174 X:17098864-17098886 CTGGCTGAGGTGTTGGGGAAGGG - Intronic
1187390444 X:18883344-18883366 CTGGCCAGTGTGATGGGGAAAGG - Intergenic
1189106636 X:38243336-38243358 CTGGGGGAGGGGATGGAGAAGGG + Intronic
1189269014 X:39737286-39737308 GTGGTTCATGTGGTGGGGAAAGG - Intergenic
1190819939 X:53964220-53964242 CTGGGGCCTGTGAGGGGGAAGGG + Intronic
1190886133 X:54532040-54532062 CTGGGAGAGGTGGTGGGGAAGGG - Intronic
1194667022 X:96686065-96686087 TTGGGTGGTGTGAGGGGAAAGGG + Intronic
1194884878 X:99301715-99301737 CAGGGTTATGTGATGGAGGATGG + Intergenic
1197208222 X:123808341-123808363 CTGGGTGATGTGTTAGGTAAGGG - Intergenic
1199438536 X:147841978-147842000 ATGGGGGAGGTGGTGGGGAAAGG - Intergenic
1201920536 Y:19229108-19229130 CTTGGTCATGTGATGGGAAAAGG - Intergenic