ID: 1129619034

View in Genome Browser
Species Human (GRCh38)
Location 15:77126876-77126898
Sequence AGGGCTTTTCCTGGATTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 192}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129619034_1129619039 28 Left 1129619034 15:77126876-77126898 CCTTCAAATCCAGGAAAAGCCCT 0: 1
1: 0
2: 0
3: 20
4: 192
Right 1129619039 15:77126927-77126949 GACAAACATGACACCTGCTATGG 0: 1
1: 0
2: 0
3: 4
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129619034 Original CRISPR AGGGCTTTTCCTGGATTTGA AGG (reversed) Intronic
902041194 1:13493574-13493596 GGGGATTATCCTGGATTTGCAGG + Intronic
902497961 1:16887506-16887528 CGGGCTTTTGATGGATTTCAGGG + Intronic
903460444 1:23516927-23516949 AGGACTTTTGCTGGACTTGTGGG + Intronic
904771942 1:32885814-32885836 AGGGGGTTTCCTTGATTGGAAGG + Intergenic
904896536 1:33822280-33822302 AGGGCATTTCCAGGATTTCCAGG + Intronic
904941667 1:34167795-34167817 TGAGCTTTTCCTGGACTTGGGGG + Intronic
911181321 1:94863081-94863103 AGGGCTGTTTCTAGTTTTGAGGG + Intronic
912633128 1:111266662-111266684 AGGGCTTTCCAGGTATTTGAGGG + Intergenic
917433327 1:174994150-174994172 AGGGCTTTGCCTGTATTAAATGG - Intronic
917790582 1:178496435-178496457 AGGGCTTTTCCTGGCTTTCTTGG + Intergenic
918600726 1:186356826-186356848 AGGACTTGTCCTAGATTTCAGGG - Intronic
921595062 1:217045679-217045701 CGGGCTTTTCCTAGATACGACGG + Intronic
921603591 1:217133247-217133269 AGGGCTTTTCCCGCCTTTGACGG - Intronic
921885982 1:220306821-220306843 AGAACTTTTCCTAGATTTGAAGG + Intergenic
922095133 1:222436726-222436748 AGCACCTTTCCTGGACTTGAGGG - Intergenic
923017565 1:230138680-230138702 AGGGATTTTCCTGGAACTGAAGG + Intronic
923388329 1:233488307-233488329 AGGGCTTTTGCTGGCTTTATAGG - Intergenic
923522145 1:234743591-234743613 AGGGCTTATCCTTGTCTTGACGG - Intergenic
923563337 1:235058456-235058478 AGGGCAATTCCTGGTTATGAGGG - Intergenic
923881797 1:238111597-238111619 AGGGCTGTTACTGAATTTGCAGG + Intergenic
1068740354 10:60462121-60462143 AGTGCTTTTCCATGATTGGAAGG + Intronic
1069574650 10:69517770-69517792 AGGGCTCTGCCAGGGTTTGAGGG + Intergenic
1070144376 10:73763173-73763195 GGGGCTTTTCCTGGAATGGGAGG + Intronic
1070591125 10:77801896-77801918 AGGGCTTTTCCTGGAGTATCTGG + Intronic
1071240868 10:83703261-83703283 AGGGCTTTTCCTGCATACGGAGG + Intergenic
1074049407 10:109868416-109868438 TGAGCTTTTCCTGTATTTGTTGG - Intronic
1075081868 10:119389663-119389685 AGTCCTTTCCCTGGAATTGATGG + Intronic
1075338637 10:121627508-121627530 AGTGATTTTCCAGGATTTAAGGG - Intergenic
1076675262 10:132144265-132144287 AGGGCTTTTCCTGTAGATGTGGG + Intronic
1077863089 11:6200158-6200180 CGGGCTTTTTCTGAATGTGAAGG - Exonic
1078508120 11:11966919-11966941 AGGGTTTTTCCTGCATCTGAGGG + Intronic
1079473267 11:20800904-20800926 AGGGCTTTCCTTGGTTGTGATGG + Intronic
1079981315 11:27154122-27154144 AGAGCCTTGCCTGGATTTGATGG - Intergenic
1081515760 11:43827158-43827180 GGGGCTTTGCCTGGATTCTAGGG + Intronic
1081574575 11:44311021-44311043 AGGGCTTCTCCAGGGCTTGAGGG - Intergenic
1082110712 11:48270757-48270779 TGGGCATTTCCTGGAACTGAGGG + Intergenic
1083367722 11:62151595-62151617 AGGGCGTTCTCTGGGTTTGATGG + Intronic
1090065113 11:123497103-123497125 AAGGCTTTTCAGGTATTTGAAGG + Intergenic
1090091853 11:123704936-123704958 AGGCCTTTTTATGTATTTGAGGG + Intergenic
1093960624 12:25269303-25269325 AGGTGTTTTCCTTGCTTTGATGG + Intergenic
1094530573 12:31270768-31270790 TGGACCTTTCCTGGATTTGAGGG - Intergenic
1094655749 12:32418397-32418419 AAGGCTTTTCAGGTATTTGAGGG + Intronic
1095902868 12:47346442-47346464 ATTGCTTTATCTGGATTTGAGGG - Intergenic
1096927015 12:55159186-55159208 AGGTTTTTTTCTGGATATGATGG + Intergenic
1099616246 12:84939038-84939060 AAGGCTTTCCTTGTATTTGAAGG - Intergenic
1099956586 12:89356866-89356888 AGGAATTTTCCTGAGTTTGAGGG + Intergenic
1101425497 12:104584889-104584911 AGGGAAATTGCTGGATTTGAAGG + Intronic
1103893582 12:124257945-124257967 AGAGGTTTTGCTGGGTTTGATGG - Intronic
1104237558 12:126953787-126953809 AGGGCAATTCCTGGAACTGAGGG - Intergenic
1107557723 13:41532337-41532359 AGGGCTTTTTCTGTCTTTTAAGG - Intergenic
1109319707 13:60795365-60795387 ATGGCTTTTACTGTATTTTATGG + Intergenic
1111028159 13:82561858-82561880 AGAGGTTCTCCTGGATATGAAGG + Intergenic
1111787238 13:92804590-92804612 AGGGTTTTGCCTCCATTTGATGG + Intronic
1113782753 13:112986087-112986109 AGGGCATTTTCTGGATTTCGAGG - Intronic
1114065666 14:19057952-19057974 AGGGCTTATCCTGGTTTTACTGG - Intergenic
1114096595 14:19342048-19342070 AGGGCTTATCCTGGTTTTACTGG + Intergenic
1116669312 14:47821047-47821069 AAGGCTTTTCAGGTATTTGAAGG + Intergenic
1118949339 14:70419777-70419799 TGGGCTATTCCTGGAACTGAGGG - Intergenic
1119446985 14:74673254-74673276 AGGACTTTTACTGGCCTTGAGGG - Intronic
1121438955 14:93936829-93936851 AGGGCTTTCTCTGGCTCTGAGGG - Intronic
1123171520 14:106377446-106377468 AGGGCTTTGAGTGGATGTGATGG - Intergenic
1125185772 15:36928266-36928288 AGGGTTTTTCCAGGAATAGACGG + Intronic
1127774752 15:62256079-62256101 AGGGCTCTCCCTGGTTTTGCTGG + Intergenic
1128752841 15:70161355-70161377 AGGGCTTTTCCTTGGCTGGATGG - Intergenic
1129523845 15:76201867-76201889 AGGGCTTTTCCTTGTCTGGATGG - Intronic
1129594219 15:76947004-76947026 AGGGTTGTTCATGGATTGGAGGG + Intronic
1129619034 15:77126876-77126898 AGGGCTTTTCCTGGATTTGAAGG - Intronic
1131894011 15:97006358-97006380 AGGGCTTTTTCTTGCTTTGATGG - Intergenic
1132359192 15:101198328-101198350 ATGGCTTTTCCAGGATTTCGGGG - Intronic
1133541316 16:6757268-6757290 TGGGATTTTGCTGGATTTTATGG - Intronic
1134347887 16:13408617-13408639 AGAGCTTTTCCTAAGTTTGATGG - Intergenic
1134434663 16:14245139-14245161 AGGGCCGTTTCTGGATTTGCTGG + Intronic
1136253428 16:29022632-29022654 TGGGCTGTTTCTGGATTTGCTGG + Intergenic
1138515604 16:57534124-57534146 AAGGCATTTCCTGGAGTTGGTGG - Intronic
1138551626 16:57751861-57751883 AGAGCTTGGCCTGGATTAGAGGG + Intronic
1138629667 16:58283097-58283119 AGGGCTTTTGCTGAATGTCAAGG - Exonic
1138727042 16:59151460-59151482 AGGGCATTTCCTGGAACTAAGGG + Intergenic
1139420725 16:66848064-66848086 AGGGCTTTTATTGTATTTGTGGG - Intronic
1141268222 16:82516308-82516330 TGGGCTTTTTCTGTACTTGAGGG + Intergenic
1141643825 16:85356949-85356971 AGGGCCTTTCCCTGATTTGCAGG + Intergenic
1142744023 17:1946148-1946170 AGGGGTTTTCCAGGATGTGTGGG + Intronic
1144221242 17:13101769-13101791 AGAGCTTTTCCTGGATCTACTGG + Intergenic
1144444814 17:15317096-15317118 ATGGCTTCTCCAGGATTTGTGGG - Intronic
1146518588 17:33508833-33508855 AGGGCTTTTTCTGGAGATGATGG - Intronic
1146519139 17:33512783-33512805 AGGCCTTTTGCTGGAGATGATGG - Intronic
1149253942 17:54803029-54803051 ATGGATATTCCTGGATTTGGGGG - Intergenic
1151323572 17:73365736-73365758 AGGCCATTTCCTGGCTTTGCGGG + Intronic
1152583679 17:81179915-81179937 AGGGCCTTTCCTGGCACTGAGGG + Intergenic
1155655028 18:28182398-28182420 AGGACCTTTCCTGGCTTTTATGG + Intergenic
1156151060 18:34243371-34243393 TGGCCTTTTGCTGGTTTTGAAGG + Intergenic
1158844013 18:61421516-61421538 AGCTCTATTCCTGGATTTGTGGG + Intronic
1159021264 18:63145049-63145071 AGGGCTTTTCCTGAATAATATGG - Intronic
1159788773 18:72750206-72750228 AGGGGTTTTCCTGGCTGTGTGGG + Exonic
1162492710 19:11003403-11003425 AGTGCATTTCCTGGCTTTCAAGG + Intronic
1164804211 19:31103778-31103800 CAGGCTTGTCCTGGATTTTAGGG - Intergenic
1165257754 19:34589852-34589874 AGGGCTTTTCCTGGAGCCGCAGG + Intergenic
1167314748 19:48756777-48756799 TGGGCTTCTCCTGGGTCTGAGGG + Intronic
926697635 2:15781884-15781906 AGTGCTTTTACTTGATTTCACGG - Intergenic
927296528 2:21460915-21460937 AGGGCTTCTACATGATTTGAGGG + Intergenic
932197754 2:69798804-69798826 AGGGCTCGTCTGGGATTTGAAGG - Intronic
934156542 2:89206272-89206294 AGGGCTTCACGTGGATTCGAGGG + Intergenic
935022516 2:99245322-99245344 ATGGCTTTCCCTGGAGATGATGG + Exonic
937831913 2:126433594-126433616 AGGGCATTGCCTAGATTTGTGGG - Intergenic
937969784 2:127540609-127540631 AGGGCTTTTTCTGGAATGAAGGG + Intronic
938483084 2:131678318-131678340 AGGGCTTATCCTGGTTTTACTGG - Intergenic
940764768 2:157778333-157778355 AAGGATTTTCCTGGAGTTGGAGG + Exonic
942418156 2:175780457-175780479 AGGACTTTTTCTGGAGTTGGGGG - Intergenic
942814184 2:180033141-180033163 AAGGCTTTCCAGGGATTTGAAGG + Intergenic
944565074 2:200981666-200981688 AGGGCTCTCACTGGATTTGATGG + Exonic
946979999 2:225200655-225200677 AGGGCTTTTAATAGATTTTATGG + Intergenic
947683532 2:232059413-232059435 AGGGCTTATGCTGGGTTTGGTGG - Intronic
948281718 2:236752246-236752268 GGGGCTGTTCCAGGATTTGGAGG + Intergenic
1168743945 20:219783-219805 AAGGCTTTTCAGGTATTTGAAGG - Intergenic
1171008966 20:21496618-21496640 AGTGCTTTGCCTGGACTTGTTGG + Intergenic
1171257160 20:23698110-23698132 AGGGGTTTTCCTAGATTCAAGGG - Intergenic
1171264516 20:23759965-23759987 AGGGGTTTTCCTAGATTCAAGGG - Intergenic
1171511300 20:25686623-25686645 TGAGCTTGTCCTGGATTTGCAGG - Exonic
1173461520 20:43246921-43246943 ATGGCTGATCCTGGACTTGAAGG - Intergenic
1174688244 20:52476351-52476373 AGGCCATTTCTTGGATTTGGTGG + Intergenic
1175232531 20:57482911-57482933 TGGGCAGTTGCTGGATTTGATGG + Intergenic
1177684764 21:24421335-24421357 ATTTCTTTTCCTGTATTTGATGG + Intergenic
1178200302 21:30395764-30395786 AGGGGTTTTCCTGGACATAATGG + Intronic
1180484147 22:15780545-15780567 AGGGCTTATCCTGGTTTTACTGG - Intergenic
1185253936 22:49821457-49821479 AGGGTTTTCCCTGGATGGGAAGG + Intronic
949928453 3:9059920-9059942 AGGTCCTTTGCTGGGTTTGAGGG - Intronic
952978184 3:38713965-38713987 CGGGCTCTTTCTCGATTTGAAGG - Exonic
959496185 3:107054978-107055000 AAAGCTTTTCCTGTAATTGAAGG + Intergenic
962650852 3:137489115-137489137 TGGACTTATCCTAGATTTGAAGG + Intergenic
962780921 3:138716222-138716244 ACGCCTTTTTCTGGAGTTGAAGG - Intronic
963385444 3:144586461-144586483 AGGGCTGATACTGGATTTGGAGG - Intergenic
963840613 3:150101980-150102002 AGGGCTTTACCTGGTTGAGATGG + Intergenic
964169332 3:153750388-153750410 TGGGCTTCTCCTGCATCTGAAGG - Intergenic
966843134 3:184105696-184105718 ACTGCTATTCCTGGATTTGAGGG + Intronic
967606129 3:191449361-191449383 TGGGCAATTCCTGGAATTGAGGG + Intergenic
969206935 4:5654290-5654312 AGGGCCTTTCCTGGACTCCAGGG - Intronic
969208683 4:5669575-5669597 AGTTCTTTTCCTGGCTTTTACGG - Intronic
971239107 4:24871507-24871529 ACGGCTTTTTATGGACTTGAAGG - Intronic
971486424 4:27165188-27165210 AAGGATTTACCTGAATTTGAAGG - Intergenic
972801350 4:42478830-42478852 AGGGATTTTCTTGGTTCTGATGG + Intronic
973175395 4:47199016-47199038 AGGCCCTTTCCTGGACTTGTGGG + Intronic
975218785 4:71789746-71789768 AGGGATTTTCCTGGATTATTAGG + Intronic
975489084 4:74969126-74969148 AGGGCTTCTCCTGGCAATGAGGG + Intronic
976287394 4:83383968-83383990 AGAGCTTTTCCTGTATCTGCTGG - Intergenic
978979379 4:114923080-114923102 AGGGCTTATTCTGTATTAGAAGG - Intronic
980693120 4:136321157-136321179 AAGGCTTTTCAGGTATTTGAAGG - Intergenic
983846406 4:172525424-172525446 ACTTCTTTTGCTGGATTTGATGG + Intronic
984759206 4:183349191-183349213 TGGGCTATTCCCGGAATTGAGGG - Intergenic
987556155 5:19453432-19453454 AGGGCTTTTTCTGATTTTGTGGG - Intergenic
988061777 5:26179583-26179605 AGGACTTTTCCTGGATTTTTTGG + Intergenic
988101644 5:26687050-26687072 ATGACTTTTTATGGATTTGAGGG + Intergenic
989083147 5:37647514-37647536 AAGGCTTTTCAGGCATTTGAAGG + Intronic
990018745 5:51099681-51099703 AGGGTATTTCCTGGAACTGAGGG - Intergenic
992934662 5:81688722-81688744 AAGGCTTTTCAGGTATTTGAAGG - Intronic
993492582 5:88570037-88570059 AAGGCTTTTCCTTGAGTAGAGGG - Intergenic
993847930 5:92968670-92968692 AGGACTTTTCTTTGTTTTGAAGG - Intergenic
994235131 5:97354519-97354541 TGGGCATTTCCTGAATTTGAAGG + Intergenic
995434855 5:112124056-112124078 AGATCTTTTCCTACATTTGAAGG + Intergenic
998754096 5:145357253-145357275 TCTGCATTTCCTGGATTTGAGGG + Intergenic
1001602947 5:172940738-172940760 AGGGCTTAACCTGGGTATGAGGG + Intronic
1002441379 5:179266140-179266162 AGGGCTTTGGCTGGATTTGCAGG - Intronic
1002441736 5:179267797-179267819 AGGGCTTTGTCTGGATTTGCTGG + Intronic
1006930946 6:37688118-37688140 AGGGCATTTCCTGGTTTTCCAGG - Intronic
1006962950 6:37952331-37952353 AGGGCTTTTGCTGGATTGGTAGG + Intronic
1009724944 6:67526459-67526481 AGTGCATTTGCTGGTTTTGAAGG - Intergenic
1009776576 6:68213146-68213168 AGGGCTTTTCTGGGATTCGGGGG - Intergenic
1012126750 6:95439055-95439077 AGGGCTTTTTCTGGATGGTAGGG - Intergenic
1014768892 6:125438850-125438872 AGAGATTTTCCTGGATTAGTTGG - Intergenic
1014851538 6:126345172-126345194 AGGGCTTTTGTTGGTTTGGATGG + Intronic
1019951466 7:4376476-4376498 CGGGCTATTCCTGGAACTGAGGG - Intergenic
1021329825 7:19322725-19322747 AGATATCTTCCTGGATTTGAGGG + Intergenic
1022313257 7:29217875-29217897 ATGTCTCTTCCTGGATTTGAAGG + Intronic
1023288314 7:38642808-38642830 AGGACTTTTCCTCGATTTTCAGG + Intergenic
1024322295 7:48083523-48083545 AGGGTGTTTCCTAGATTAGATGG + Intergenic
1024374259 7:48619698-48619720 TCGGCTTTTCCTGGGTTTGGAGG - Intronic
1024655772 7:51450309-51450331 AGTGCTTTTCATGCATGTGATGG - Intergenic
1025089808 7:56052331-56052353 CGGGCTTTTCCCAGATTTTAGGG - Intronic
1032455913 7:132073317-132073339 AGGGATTTTCTTGTATTTGAGGG + Intergenic
1032631384 7:133656478-133656500 AGCGCTTTTTCTGTATTTGAGGG - Intronic
1033545235 7:142393501-142393523 AGGGTGTTTCTTGCATTTGAGGG + Intergenic
1033765247 7:144482329-144482351 AGGCCTTTTCCTTGATTAAAAGG - Intronic
1034189841 7:149205501-149205523 GGGGCTTTTCCTGCATCTGGTGG + Intronic
1034716863 7:153251584-153251606 ATAGCTTTCCCTGGATTTGCAGG + Intergenic
1035861569 8:3034091-3034113 TGGACCTTGCCTGGATTTGAAGG + Intronic
1037201935 8:16265274-16265296 ATTGCTTTTCCTTGATTTGGTGG + Intronic
1037210688 8:16383462-16383484 AGGGCTTATCTTGTATTTCAGGG - Intronic
1037436927 8:18872622-18872644 AGGGCTTCTCTGGAATTTGATGG - Exonic
1038376081 8:27041778-27041800 AGTGCTTTGCCTGCAGTTGAAGG + Intergenic
1039139557 8:34370846-34370868 AGGACATTTCCTGCATTTAAAGG + Intergenic
1040784764 8:51152339-51152361 AGGAGGTTTCCTGAATTTGATGG - Intergenic
1040986638 8:53301413-53301435 AGGGCTTTTTTTTGATTTGTAGG + Intergenic
1042965745 8:74350370-74350392 AAGGCGTTTCCGGGTTTTGAGGG - Exonic
1044402045 8:91783907-91783929 AGGGCTTTTCCCAGATCTGCAGG + Intergenic
1046430631 8:114122484-114122506 AGGTTTTTTTGTGGATTTGAGGG + Intergenic
1046509370 8:115181220-115181242 AGGGATTGTCCTAGAATTGAAGG + Intergenic
1048118909 8:131556432-131556454 AAGGCTTTTCACGTATTTGAAGG - Intergenic
1048974645 8:139664375-139664397 AGGGCTTTGCCTGGCTGGGAAGG - Intronic
1049137744 8:140919595-140919617 TGGTCTTTTCCTGGATTTGCTGG - Intronic
1050192795 9:3045932-3045954 AGGGCTTTTCACTTATTTGAGGG - Intergenic
1052695628 9:31873691-31873713 AGCCCTTTTCCTGAATTAGAGGG + Intergenic
1055274305 9:74596986-74597008 AGGGCTTTCCCTGGGAATGAAGG - Intronic
1059175511 9:112166671-112166693 AGGGCTTTGCTAGGATCTGAGGG + Intronic
1059313706 9:113406405-113406427 AGAGCTTTTCATGGATGTGCTGG - Intergenic
1059997844 9:119930521-119930543 AGAGCTTTTCCAAGATTTCAAGG + Intergenic
1061781632 9:132999692-132999714 AAGGCTATGCCTGGGTTTGATGG - Intergenic
1186123286 X:6385472-6385494 TGGGCTGTTCCTGGAGCTGAGGG + Intergenic
1187865861 X:23722822-23722844 AAGGCTTTTCATGGATCTCAGGG - Intronic
1188046910 X:25436073-25436095 ATGTCTTTTCCTGGATGAGAGGG + Intergenic
1190360895 X:49647172-49647194 AGAGCTTTTCCTGCATCTGCTGG - Intergenic
1192236109 X:69297185-69297207 AGGGCTCTGCCTGGATTGGGAGG + Intergenic
1192304281 X:69943319-69943341 AGGGCTTTCCAGGTATTTGAAGG + Intronic
1193052281 X:77114446-77114468 AAGGCTTTTCAGGTATTTGAAGG + Intergenic
1194036951 X:88886753-88886775 AAGGCTGTTCATGTATTTGAAGG + Intergenic
1196595458 X:117540830-117540852 AGAGATTTTCCTGGATTTTCTGG - Intergenic