ID: 1129621058

View in Genome Browser
Species Human (GRCh38)
Location 15:77146130-77146152
Sequence ACAAGGCTGCTGCACAGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 541
Summary {0: 1, 1: 0, 2: 5, 3: 54, 4: 481}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129621058_1129621060 -10 Left 1129621058 15:77146130-77146152 CCATCACTGTGCAGCAGCCTTGT 0: 1
1: 0
2: 5
3: 54
4: 481
Right 1129621060 15:77146143-77146165 GCAGCCTTGTCAAATGAATAGGG 0: 1
1: 0
2: 1
3: 18
4: 175
1129621058_1129621062 1 Left 1129621058 15:77146130-77146152 CCATCACTGTGCAGCAGCCTTGT 0: 1
1: 0
2: 5
3: 54
4: 481
Right 1129621062 15:77146154-77146176 AAATGAATAGGGTATCTCATTGG 0: 1
1: 0
2: 0
3: 14
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129621058 Original CRISPR ACAAGGCTGCTGCACAGTGA TGG (reversed) Intronic
901838171 1:11937491-11937513 ACAGGGCTCCTGGCCAGTGAGGG - Intronic
902244990 1:15114938-15114960 GCTTGGCTGCTCCACAGTGACGG - Exonic
903043480 1:20549542-20549564 ACATGTGTGCTGCACATTGAAGG - Intergenic
904915682 1:33968697-33968719 AAAAGGCTGCTGTCAAGTGATGG - Intronic
905289741 1:36913124-36913146 AGTAGGCAGCTGCACAGAGAGGG + Intronic
905497822 1:38408362-38408384 AAAAAGCTTCTGCACAGTAAAGG + Intergenic
905561041 1:38927515-38927537 ACATGGCAGCTTCACAGTGATGG - Intronic
905987965 1:42304908-42304930 AAAAAGCTTCTGCACAGTAAAGG + Intronic
906903017 1:49857879-49857901 AAAAAGCTTCTGCACAGTGAAGG + Intronic
906925333 1:50109837-50109859 ACAGAGCTGCTGCCCAGAGAAGG - Intronic
907368615 1:53982634-53982656 TCCAGGCTGCAGCACAGGGAAGG + Intergenic
907867083 1:58408796-58408818 ACAGGGCTGCTGAACTGTGCTGG + Intronic
907985990 1:59531016-59531038 AATAGGCTGATGAACAGTGATGG + Intronic
908513507 1:64869527-64869549 AGAAGGCTACTACACAGGGAGGG + Intronic
909063943 1:70910284-70910306 ACAAGGCTGCCTGACAGTGGTGG + Intronic
910066880 1:83164312-83164334 ACAGAGCTGATTCACAGTGACGG - Intergenic
910206452 1:84753283-84753305 CCAGGGCTGCTGCACAATGAGGG - Intergenic
912098367 1:106173722-106173744 AAAGAGCTTCTGCACAGTGAAGG - Intergenic
912705887 1:111911908-111911930 TCCAGGCTGCAGCACAGGGAAGG + Intronic
913431600 1:118800056-118800078 AAACAGCTTCTGCACAGTGAAGG + Intergenic
913682514 1:121199922-121199944 GCATGGCTGCTGCACACTTATGG + Intronic
914017523 1:143833689-143833711 ACAAGGCTCCTGAAGAGTCAGGG - Intergenic
914034357 1:143987551-143987573 GCATGGCTGCTGCACACTTATGG + Intergenic
914155093 1:145080419-145080441 GCATGGCTGCTGCACACTTATGG - Intronic
914656134 1:149742221-149742243 ACAAGGCTCCTGAAGAGTCAGGG - Intergenic
915785077 1:158601804-158601826 AAAAAGCTTCTGCACAGTAAAGG + Intergenic
916404569 1:164485258-164485280 ACAAGGGTCCTGGGCAGTGAAGG + Intergenic
916794835 1:168156311-168156333 ACAAAGCTTCTGCACAGCAAAGG - Intergenic
917274363 1:173315871-173315893 ACAAAGCTTCTGCACAGCAAAGG - Intergenic
917548654 1:176000084-176000106 AAAAAGCTTCTGCACAGCGAAGG - Intronic
918021375 1:180695367-180695389 AAAAGGCTTCTGCACAGCAAAGG - Intronic
918169269 1:181980428-181980450 AAAGGGCTTCTGCACAGCGAAGG + Intergenic
918835150 1:189452838-189452860 ACAAAGCTTCTGCACAGCAAAGG - Intergenic
919113220 1:193246103-193246125 AAAAAGCTTCTGCACAGTAAAGG - Intronic
919147343 1:193651989-193652011 ACATGGCTGCTGCTGAGTGATGG + Intergenic
919325650 1:196103062-196103084 AAAAAGCTTCTGCACAGTAAAGG + Intergenic
919536017 1:198788811-198788833 AGAAGGCTGCTGAATAGGGAGGG - Intergenic
919897964 1:202021240-202021262 ACAAGACTGCTGGGCAGTGGTGG - Intergenic
920469827 1:206218440-206218462 GCATGGCTGCTGCACACTTATGG + Intronic
920582134 1:207120086-207120108 AGATTGCTTCTGCACAGTGATGG - Intronic
920608951 1:207418744-207418766 TCCAGACTGCTGCACAGGGAAGG + Intergenic
921399428 1:214704353-214704375 ACAAAGCTTCTGCACAGCAAAGG - Intergenic
921941767 1:220848196-220848218 AAAAGGCTTCTGCACAGCAAAGG - Intergenic
922156038 1:223040336-223040358 ACAAGACAGGTGAACAGTGAGGG + Intergenic
922407424 1:225329817-225329839 AAAAAGCTTCTGCACAGTAAAGG + Intronic
922771688 1:228188062-228188084 AAAAAGCTTCTGCACAGCGAAGG - Intergenic
923276303 1:232399971-232399993 TCAATGCTCCTGCACAGTGCTGG - Intronic
923886194 1:238159321-238159343 AAAAAGCTTCTACACAGTGAAGG - Intergenic
924907153 1:248468124-248468146 AAAAAGCTTCTGCACAGTGAAGG - Intergenic
924916959 1:248580024-248580046 AAAAAGCTTCTGCACAGTGAAGG + Intergenic
1063758971 10:9050019-9050041 ACAAAGCCTCTGCATAGTGAAGG + Intergenic
1064521161 10:16202919-16202941 AAAAAGCTTCAGCACAGTGAAGG - Intergenic
1064809624 10:19180734-19180756 AAAAGGCTTCTGCACAGTAAAGG + Intronic
1065273204 10:24057876-24057898 AAAAGGCTTCTGCACAGCAAAGG - Intronic
1067359683 10:45567253-45567275 AAAAAGCTTCTGCACAGCGAAGG - Intronic
1068069287 10:52175969-52175991 GAAAGGCTTCTGCACAGTAAAGG - Intronic
1068288937 10:54976697-54976719 ACATGGCTCCTGAACAGTAAGGG + Intronic
1069077095 10:64050002-64050024 AAAAAGCTTCTGCACAGTAAAGG + Intergenic
1070566893 10:77610415-77610437 CCGAGGCTGCGGCTCAGTGAGGG - Intronic
1070970578 10:80563423-80563445 ACAAAGCTTCTGCACAGCCAAGG - Intronic
1071002759 10:80849344-80849366 AAAAAGTTTCTGCACAGTGAAGG + Intergenic
1071523837 10:86346931-86346953 ACATGGCAGCTACATAGTGAGGG + Intronic
1072610076 10:97011921-97011943 ACAAGGGGACTGCTCAGTGAGGG - Intronic
1072771847 10:98147385-98147407 ACAAAGTTTCTGCACAGTAAAGG - Intronic
1072882762 10:99244512-99244534 ACAAGGCTGCTGAAGTGAGAGGG - Intergenic
1073872861 10:107886103-107886125 AAAAAGCTTCTGCACAGTGAAGG + Intergenic
1074290352 10:112133541-112133563 ACTAAGCACCTGCACAGTGACGG + Intergenic
1074336623 10:112582842-112582864 TCAAAGCTGGTGCACAGTGGTGG - Intronic
1074736213 10:116436513-116436535 AAAAAGCTTCTGCACAGTAAAGG + Intronic
1074933187 10:118150546-118150568 ACTAGGCCGCTGTCCAGTGATGG + Intergenic
1074949538 10:118317574-118317596 ATAAGGCTGGTGTTCAGTGATGG - Intronic
1075895228 10:125989282-125989304 ACAAGGCTCTTGCTCAGAGATGG - Intronic
1076260490 10:129061039-129061061 GCAAGGCTGTGGCACAGGGAAGG - Intergenic
1076456444 10:130602395-130602417 AAAAGGCTTCTGCACAGCAAAGG - Intergenic
1076619165 10:131775948-131775970 GCTGGGCTTCTGCACAGTGACGG + Intergenic
1077047603 11:553329-553351 ACCAGGCTCCTGCACAGAGGAGG - Intronic
1077984778 11:7340907-7340929 ACAGGGCTGCTGCAGTGTGCTGG + Intronic
1078216257 11:9314438-9314460 CCATGGCTGCTGCAAGGTGAAGG + Exonic
1079062307 11:17260011-17260033 ACAAGACTGCTGCCCAGGGGTGG - Intronic
1079342689 11:19626007-19626029 GCAAAGCTTCTGCACAGTAAGGG - Intronic
1079516899 11:21280473-21280495 ACATGGCTCCTGCTGAGTGATGG - Intronic
1079651036 11:22930341-22930363 AAAAGGCTTCTGCACAGCAAAGG - Intergenic
1079743581 11:24096435-24096457 AAAAGGCTTCTGCACAGGAAAGG + Intergenic
1080713792 11:34777516-34777538 AAAAAGCTTCTGCACAGTAAAGG - Intergenic
1081011563 11:37819478-37819500 AAAAAGCTTCTGCACAGTGAAGG + Intergenic
1081649314 11:44813022-44813044 AGCAGGCTGCTGCAAGGTGAGGG - Intronic
1081773500 11:45663680-45663702 GCCAGGATGCTTCACAGTGATGG - Intronic
1081818182 11:45965274-45965296 ACAAGGCTACTGCCCAGAGCAGG + Intronic
1082111133 11:48275724-48275746 AAAAAGCTTCTGCACTGTGAAGG - Intergenic
1082214027 11:49545144-49545166 ACCAGGCTGCTTCTCAGAGATGG + Intergenic
1083071606 11:59989792-59989814 ACAAAGCTTCTGCACAGCAAAGG - Intergenic
1083127548 11:60586616-60586638 AAAAAGCTGCTGCACAGCAAGGG + Intergenic
1083203751 11:61135119-61135141 ACAGAGAAGCTGCACAGTGAGGG - Intronic
1083555556 11:63623471-63623493 CCCAGGCTGCAGTACAGTGATGG + Intergenic
1083973245 11:66096258-66096280 CCAAGGCTGGAGTACAGTGATGG + Intronic
1085147841 11:74218904-74218926 AAAAGGCTTCTGCACAGCAAAGG + Intronic
1085317570 11:75554772-75554794 ACCAGGCGGCCGCACGGTGATGG - Intergenic
1086036064 11:82415682-82415704 AAAAGGCTCCTGCACAGCAAAGG + Intergenic
1086123194 11:83322169-83322191 ACAAAGCTTCTGCACAGCAAAGG - Intergenic
1086171975 11:83846520-83846542 ACACTTCTGCTGCAAAGTGAGGG + Intronic
1086635576 11:89079347-89079369 ACCAGGCTGCTTCTCAGAGATGG - Intergenic
1086720536 11:90115840-90115862 AAAAGGCTTCTGCACAGCAAAGG + Intergenic
1086838139 11:91652147-91652169 GAAAAGCTTCTGCACAGTGAAGG - Intergenic
1087253241 11:95927253-95927275 AAAAAGCTTCTGCACAGTAAAGG + Intergenic
1087588013 11:100147219-100147241 ATAAGCCAGCTGCACAGAGATGG - Intronic
1088175665 11:107050484-107050506 ATATGCCTGCTGCACAGTAACGG - Intergenic
1088586556 11:111364801-111364823 GCAAGGCAGCACCACAGTGAGGG + Intronic
1090157224 11:124452744-124452766 ACAAAGCTTCTGCACAGTGAAGG + Intergenic
1090768325 11:129895921-129895943 ACAGGGCTGCAGCACAAAGACGG - Intergenic
1092024948 12:5232539-5232561 ACAAGGCCTCTGCATCGTGAGGG + Intergenic
1092982226 12:13808170-13808192 AAAATGCTGATGCACACTGATGG - Intronic
1093064035 12:14637892-14637914 AAAAGGCTTCTGCACAGCAAGGG + Intronic
1093191544 12:16080680-16080702 ACAAGGCAGCAGCATAGTGGAGG + Intergenic
1093992016 12:25600464-25600486 AAAAAGCTTCTGCACAGTAAAGG + Intronic
1094410669 12:30165151-30165173 ACAAGGCAGCTGCAGGGAGAGGG - Intergenic
1094424652 12:30305500-30305522 ACAAGGTGGCTGCACCGGGAAGG + Intergenic
1094524298 12:31221552-31221574 AAGAGGAGGCTGCACAGTGAAGG + Intergenic
1094773657 12:33696056-33696078 AAAAAGCTTCTGCACAGTAAAGG - Intergenic
1094785406 12:33842738-33842760 AAAGGGCTTCTGCACAGTAAAGG + Intergenic
1095134219 12:38578870-38578892 AAAAAGCTTCTGCACAGCGAAGG + Intergenic
1095852055 12:46821136-46821158 AAAAGGCTTCTGCACAGCGAAGG - Intronic
1097660981 12:62431014-62431036 AAAAAGCTTCTGCACAGTAAAGG + Intergenic
1097756546 12:63413389-63413411 AAAAGGCTTCTGCACAGCAAAGG - Intergenic
1098396664 12:70026367-70026389 AAAAGGCTTCTGCACAGCAAAGG + Intergenic
1099024945 12:77453913-77453935 AAAAAGCTTCTGCACAGTAAAGG + Intergenic
1099423597 12:82495059-82495081 AAAAAGCTTCTGCACAGTAAAGG + Intergenic
1099510575 12:83530739-83530761 ACCAGGCTGCAGCGCAGTGGTGG + Intergenic
1100854532 12:98747083-98747105 AAAAAGCTTCTGCACAGCGAAGG + Intronic
1100958181 12:99932742-99932764 AAAAAGCTTCTGCACAGTAAAGG - Intronic
1101025722 12:100603608-100603630 AAAAAGCTTCTGCACAGTAAAGG - Intronic
1101270357 12:103137041-103137063 AAAAAGCTGCTGCACAGCAAAGG + Intergenic
1101562749 12:105874371-105874393 AAAAAGCTTCTGCACAGTAAAGG + Intergenic
1102505302 12:113380934-113380956 ACCAGGCTGCAGCCCAGTGCTGG + Intronic
1103181064 12:118912050-118912072 AAAAGGCTGCTGCATGGAGAAGG - Intergenic
1104937054 12:132371265-132371287 AAAAAGCTTCTGCACAGTGAGGG - Intergenic
1104937056 12:132371303-132371325 AAAAAGCTTCTGCACAGCGAGGG - Intergenic
1106443360 13:29800912-29800934 ATAAGGCTGCTGCACCGTGGGGG - Intronic
1106609222 13:31262648-31262670 ATAAGGCTGCTGGACACTGCAGG - Intronic
1107294911 13:38898147-38898169 AAAAAGCTTCTGCACAGTAAAGG - Intergenic
1108328941 13:49365466-49365488 GAAAAGCTTCTGCACAGTGAAGG + Intronic
1108558262 13:51617962-51617984 CCAAGGCTGCTGAATAATGATGG - Intronic
1108896683 13:55337302-55337324 ACAAAGCTTCTGCACAGCAAAGG - Intergenic
1109040948 13:57335486-57335508 ACAAAGCTTCTGCACAGAAAAGG - Intergenic
1109129640 13:58566514-58566536 ACAAGGGTGCTACACGGTGATGG - Intergenic
1109376816 13:61506074-61506096 ACAAAGCTTCTGCACAGTAAAGG + Intergenic
1110734276 13:78916995-78917017 AAAAAGCTTCTGCACAGTTAAGG - Intergenic
1111641481 13:90976246-90976268 AAAAAGATGCTGCACAGTGTTGG + Intergenic
1112706632 13:102077312-102077334 AAAAAGCTTCTGCACAGTAAGGG + Intronic
1112972072 13:105273360-105273382 GTAAGGCAGCTGCACAGTGCTGG + Intergenic
1113938063 13:114005642-114005664 ACAAGGCTGCTGGCCAGCAAGGG + Intronic
1115401539 14:32966941-32966963 AAAAAGCTTCTGCACAGTGAAGG + Intronic
1115942552 14:38625737-38625759 AAAAAGCTTTTGCACAGTGAAGG + Intergenic
1116193054 14:41684816-41684838 AAAAACCTTCTGCACAGTGAAGG + Intronic
1116310837 14:43325020-43325042 AAAAAGCTTCTGCACAGTAAAGG - Intergenic
1116810154 14:49531976-49531998 AAAATGCTACTACACAGTGAAGG + Intergenic
1116829765 14:49706958-49706980 TAAATGCTTCTGCACAGTGAAGG - Intronic
1116928052 14:50661419-50661441 AAAAGGCGTCTGCACAGTAAAGG - Intronic
1117283337 14:54262000-54262022 AAAAAGCTTCTCCACAGTGAAGG - Intergenic
1118497304 14:66320737-66320759 AGAAAGCTTCTGCACAGTAAAGG + Intergenic
1119401294 14:74364449-74364471 CCACGGCTGCTGCAAACTGAGGG - Intergenic
1119811383 14:77523338-77523360 TGCAGGCTGCTGCACAGGGAAGG + Intronic
1120608489 14:86609452-86609474 AAAGAGCTTCTGCACAGTGAAGG - Intergenic
1122351760 14:101099462-101099484 ACAAAGCTTCTGCACAGCAAAGG - Intergenic
1122534818 14:102454853-102454875 GGAAGGCTGCTGCACCGTGGTGG + Intronic
1123111624 14:105871198-105871220 AAAAAGCTTCTGCACAGTAAGGG - Intergenic
1124080960 15:26495943-26495965 AAAAGGCTTCTGCACAGCAAAGG - Intergenic
1125393222 15:39218333-39218355 AAAAAGCTTGTGCACAGTGAAGG + Intergenic
1126207853 15:46066494-46066516 AAAAGGCTTCTGTACAGTGAAGG + Intergenic
1126441116 15:48689947-48689969 AAAAAGCTTTTGCACAGTGAAGG + Intergenic
1127177563 15:56376726-56376748 AAAAAGCTTCTGCACAGTGAAGG - Intronic
1127680376 15:61290045-61290067 AAAAGGCTTCTGCACAGCAAAGG + Intergenic
1129315028 15:74737053-74737075 AAAAGGCTTCTGCACAGCAAAGG + Intergenic
1129587972 15:76887576-76887598 GCAAGGCTGCAGCCCAGTCAGGG + Intronic
1129621058 15:77146130-77146152 ACAAGGCTGCTGCACAGTGATGG - Intronic
1131339032 15:91578980-91579002 TCAGGGCTCCTGCACAGTGAGGG + Intergenic
1131987290 15:98056424-98056446 AAAAAGCTTCTGCACAGTAAAGG - Intergenic
1132502636 16:291364-291386 CCAATGCTGCTGCGCAGGGACGG + Intronic
1137690546 16:50423976-50423998 ACAAGGGAGCTGAACAGTGAGGG + Intergenic
1137727443 16:50666686-50666708 CCAAGGTTGCTGCACTGTGAGGG + Intronic
1137873124 16:51970049-51970071 ACAACTCAGCTGCACAGAGAGGG + Intergenic
1138155344 16:54697661-54697683 ATAATGCTACTGCACTGTGACGG + Intergenic
1140134615 16:72195036-72195058 CCATGGCTGCTGCAGATTGAAGG - Intergenic
1140249192 16:73280267-73280289 AAAATGCTTCTGCACAGTAAAGG + Intergenic
1140467819 16:75196424-75196446 AACAGGCTGCTGGGCAGTGAGGG - Intergenic
1141036215 16:80628532-80628554 ACAAGGCTGCTGTCAAGTGGAGG - Intronic
1141133529 16:81450982-81451004 ACAAGGCAGCTGCACACGCATGG - Intronic
1141494808 16:84401043-84401065 AAAAGGCTTCTGCACAGCAAAGG - Intronic
1141755810 16:85989870-85989892 TCGAGGTTGCTGCACACTGAAGG + Intergenic
1141926615 16:87174202-87174224 ACCAGGCTGCTGCCCTGGGAGGG - Intronic
1142205036 16:88778858-88778880 ACAAGGCTGTGGCCCAGGGAAGG + Intronic
1143256970 17:5565459-5565481 AAAAAGCTTCTGCACAGTGAGGG - Intronic
1143469182 17:7161065-7161087 TCAAGGCTGCTGCACATTTTGGG - Intergenic
1144787738 17:17841140-17841162 CAAAGATTGCTGCACAGTGAGGG + Intergenic
1144951175 17:18994315-18994337 TCCAGGCTGCAGCACAGGGAGGG + Intronic
1146755286 17:35426269-35426291 AAAAAGCTTCTGCACAGTAAAGG - Intronic
1148159803 17:45443507-45443529 ACAGCGCTGCTGCCCAGGGATGG + Intronic
1150035836 17:61796229-61796251 AAAAAGCTGCTGCACAGCAAAGG - Intronic
1150201682 17:63363334-63363356 ACAAAGCTTCTGCACAGCAAAGG - Intronic
1150391090 17:64790379-64790401 ACAGCGCTGCTGCCCAGGGATGG + Intergenic
1150409870 17:64934431-64934453 ACAGCGCTGCTGCCCAGGGATGG + Intergenic
1151260025 17:72908849-72908871 ACAAGGATGCTGGCCAGAGAAGG + Intronic
1152276890 17:79363218-79363240 GCAAGGCTGATGCACAGAGAGGG + Intronic
1153837130 18:8973657-8973679 AAAAAGCTTCTGCACAGTGAAGG - Intergenic
1153875857 18:9369936-9369958 AAAAAGCTTCTGCACAGTCAAGG - Intronic
1154002722 18:10497084-10497106 AAAAAGCTTCTGCACAGTGAAGG + Intergenic
1156166956 18:34433072-34433094 AAAAATCTTCTGCACAGTGAAGG - Intergenic
1156735741 18:40256857-40256879 ACAAGTTTGCAGCACAGTGGAGG + Intergenic
1156927272 18:42597003-42597025 ACAAGTTTTCTGCACAGGGATGG + Intergenic
1157065607 18:44346314-44346336 ACAATGCTTCTGCACAGCAAAGG - Intergenic
1157425768 18:47583069-47583091 ACAAGGCTGCAGCAATGTGCAGG - Intergenic
1157807389 18:50668278-50668300 ACCAGGCTGCTGCACACTGCTGG - Intronic
1158156420 18:54430619-54430641 TGAAGGCTGCTCCACGGTGAAGG + Intergenic
1158206572 18:55000081-55000103 ACAAGGCTGCTGCCCTGTCTGGG + Intergenic
1158763408 18:60417871-60417893 AAAAAGCTTCTGCACAGTAAAGG - Intergenic
1159190238 18:65031746-65031768 AAAAGGCTTCTACACAGAGAAGG - Intergenic
1159314480 18:66753814-66753836 ACAAGGCTGCAGCAATGTGCTGG - Intergenic
1160334379 18:78025042-78025064 AAAAGACTCCTGCACAGTGAAGG + Intergenic
1160368820 18:78353234-78353256 ACAAGCCAGCTCCACTGTGAAGG + Intergenic
1160657439 19:280790-280812 AAAAGGCTGCTGCAGGTTGAAGG - Intergenic
1162452712 19:10764493-10764515 ACGGGGCTGCTTCCCAGTGAGGG - Intronic
1164451938 19:28373813-28373835 ACAATGTTGCTGCACCCTGAGGG - Intergenic
1164636274 19:29793627-29793649 GGAAGGCTGGAGCACAGTGACGG - Intergenic
1165265757 19:34662612-34662634 ACAAAGCTGATCCACAGTGTTGG + Intronic
1167763926 19:51467891-51467913 ACAACACTTCTGCACAGCGAAGG + Intergenic
1167797175 19:51717011-51717033 ACAAGCCCGCTCCACATTGAAGG + Exonic
925045372 2:769289-769311 ACAAGGGTGATGCAAAGTTAAGG - Intergenic
925637558 2:5955303-5955325 AAAACGCTTCTGCACAGTAAAGG - Intergenic
927331010 2:21864060-21864082 ACAAAGCTTCTGCACAGCCATGG - Intergenic
927894007 2:26769782-26769804 AGATGGCTTCTGCTCAGTGAAGG + Intronic
928142182 2:28739393-28739415 CCCAGGCTACTCCACAGTGATGG - Intergenic
930103825 2:47623994-47624016 AAAAAGCTTCTGCATAGTGAAGG - Intergenic
930291310 2:49496618-49496640 AAAAAGCTTCTGCACAGTGAAGG + Intergenic
930376065 2:50568309-50568331 ACAAAGCTTCTGCACAGCAAAGG + Intronic
931406232 2:61981126-61981148 AAAAGGCTTCTGCACAGCAAAGG - Intronic
931457341 2:62422259-62422281 AAAAGGCTGCTGCACAGCAAAGG + Intergenic
931599267 2:63987042-63987064 ACAAAGCTTCTGCACAGCAAAGG - Intronic
932197757 2:69798823-69798845 ACAAGGCTGCTTCATTTTGAGGG - Intronic
933176357 2:79178193-79178215 ACAAGGCTGCTGCTCTCAGAAGG - Intergenic
935008907 2:99112696-99112718 GCATGGCTGGAGCACAGTGAGGG + Intronic
935395336 2:102602209-102602231 AAAAAGCTTCTGCACAGTAAAGG - Intergenic
935437448 2:103050445-103050467 AAAAAGCTGCTGCACAGCAAAGG - Intergenic
935859089 2:107308382-107308404 ACAAAGCTTCTGCACAGAAAAGG - Intergenic
936431598 2:112469241-112469263 ACAAAGCTTCTGCACAGCAAAGG + Intergenic
937114573 2:119395792-119395814 CCAAGAGTGCTGCACAATGATGG - Intergenic
937567551 2:123313102-123313124 AAAAAGCTTCTGCACAGTAAAGG + Intergenic
937830471 2:126416063-126416085 ACAAGGCTTCTGCACTGCAAAGG + Intergenic
938918760 2:135972591-135972613 AAAAAGCTTCTGCACAGTAAAGG + Intronic
939212049 2:139188238-139188260 AAAAGGCTTCTGCACAGCAAAGG - Intergenic
940402673 2:153265529-153265551 ACAAGACTGCTGCAGAAGGATGG + Intergenic
940553149 2:155187225-155187247 AAAAGGCTCCTGCACAGCAAAGG + Intergenic
940587484 2:155671597-155671619 ACAAAGCTTCTGCACAGCAAAGG - Intergenic
942778608 2:179614071-179614093 ACACGGCTGCTGCCAAGGGATGG + Intronic
943873289 2:193029684-193029706 AAAAGGCTTCTGTTCAGTGAAGG + Intergenic
944178517 2:196861336-196861358 AAAAGGCTACTGCACAGCAAAGG + Intronic
944812223 2:203338809-203338831 AAAAGGCTTCTGCACAGCAAAGG + Intronic
944919094 2:204392041-204392063 AAAAAGCTCCTGCACAGTGAAGG - Intergenic
945277927 2:208007239-208007261 ACAAGGATGGTCCACATTGAGGG + Intronic
945695493 2:213098081-213098103 ATAATTCTGATGCACAGTGAAGG - Intronic
945844183 2:214924053-214924075 AAAAAGCTTCTGCACAGTAAAGG - Intergenic
946726884 2:222670429-222670451 CCAAGACTGCTGCACGGTCAGGG - Intergenic
947039655 2:225902426-225902448 AAAAGGCTTCTGCACAGCAAAGG + Intergenic
948774546 2:240277028-240277050 ACATGGCTGCTGCTCAGGGTTGG - Intergenic
1171335302 20:24380082-24380104 ACAAAGCTTCTGCACAGCAAAGG + Intergenic
1171903911 20:30883853-30883875 AAAGAGCTTCTGCACAGTGAAGG - Intergenic
1172358189 20:34294174-34294196 ACAAGGCTGTTGGTCACTGATGG + Intronic
1173003561 20:39123002-39123024 ACAGGGCTGGTGCAGAGTGTGGG + Intergenic
1173274618 20:41568813-41568835 AGAAGGATGCTGCACCCTGATGG + Intronic
1173767412 20:45625433-45625455 AAAAAGCTGCTGCACAGCAAAGG - Intronic
1174113570 20:48212472-48212494 ACAAGGCTGCTGCCCTGGGTGGG + Intergenic
1174307205 20:49621614-49621636 AAAGGGCTGAAGCACAGTGAAGG - Intergenic
1177240289 21:18446950-18446972 ACAAAGCTTCTGGACAGTAAAGG + Intronic
1177670998 21:24227202-24227224 AAAAGGCTTCTGCACAGCAAAGG - Intergenic
1178470375 21:32887016-32887038 ACAAGGATGCTGCAGACTGTGGG - Intergenic
1178802121 21:35805906-35805928 ACAAGGCTGCTGTACAGAGTAGG - Intronic
1179103868 21:38381042-38381064 CCCAGGCTGCTGCAAAATGATGG + Exonic
1179206449 21:39284895-39284917 ACAAAGCTTCTGCACAGCAAAGG - Intronic
1179506207 21:41843496-41843518 ACAAGGATGTTTCACAGTGCTGG - Intronic
1179831390 21:43999113-43999135 AAAAGGCTTCTGCACAGCGAAGG - Intergenic
1180005125 21:45017214-45017236 ACAAGGATGGTGCACAGTGATGG - Intergenic
1180337335 22:11589989-11590011 AAAGAGCTTCTGCACAGTGAAGG - Intergenic
1180597718 22:16989698-16989720 ACACAGCTGCTGCCCAGGGAGGG + Intronic
1180691107 22:17716584-17716606 GAAAGGCTACAGCACAGTGAAGG - Intronic
1181876325 22:25943553-25943575 GCAGGGCAGCTGCACAGAGAAGG - Intronic
1182344611 22:29652796-29652818 GCAAGGCAGCTGTAGAGTGAGGG - Intronic
1182526670 22:30924712-30924734 ACAAGGCTGCAAGAAAGTGAAGG - Intergenic
1183135650 22:35884565-35884587 ACAAGGCTACTTAACAGTGTAGG + Intronic
1183374290 22:37454024-37454046 CCAAGACTGCTGGACAGTCATGG - Intergenic
1183572687 22:38665928-38665950 ACAAGGCTGAGGCACAGAGCAGG + Intronic
1183710748 22:39502029-39502051 ACAAGGCTGCCGCACCGGGTAGG - Intronic
1184093009 22:42302140-42302162 TCAAGGCACCTGCCCAGTGAGGG - Intronic
1184753559 22:46503048-46503070 ACAAAGCTGCTGCAGAGGGTGGG - Intronic
949942220 3:9163720-9163742 ATAAGGCCTCTGCACAGTCAGGG + Intronic
950557830 3:13705976-13705998 AGAAGGCTGGTGTACATTGAGGG + Intergenic
951496264 3:23330638-23330660 ATAAAGCTGCTGGACAATGAAGG - Intronic
951988931 3:28653862-28653884 AAAAGGCTTCTGCACAGCAAAGG - Intergenic
952065998 3:29571299-29571321 AAAAAGCTTCTGCACAGTGAGGG - Intronic
953509162 3:43518059-43518081 ACACGTATGCTGCAGAGTGAGGG + Intronic
954030663 3:47817898-47817920 ACAGGGCTGCTGGACAGTGCTGG - Intronic
954869818 3:53759249-53759271 TCAATGCTGGTGCACTGTGATGG - Intronic
955352565 3:58204702-58204724 TCAAGGCTGCTGCGCATTCATGG + Intronic
955621172 3:60865758-60865780 ACAAGGCTGAAGCAAAGAGAGGG + Intronic
957594835 3:82250101-82250123 AAAATGCTTCTGCACAGTAAAGG - Intergenic
957615341 3:82519157-82519179 ACAAGACTGTTGCACAGTTGAGG - Intergenic
957903497 3:86529102-86529124 AAAAGGCTTCTGCACAGCAAAGG + Intergenic
958068067 3:88571109-88571131 AAAAAGCTCCTGCACAGTAAAGG + Intergenic
958670093 3:97192601-97192623 AAAAAGCTTCTGCACAGTAAAGG - Intronic
958776652 3:98492225-98492247 AAAAAGCTGCTGCACAGCAAAGG + Intergenic
959408489 3:105991174-105991196 AAAAAGCTTCTGCACAGTAAAGG - Intergenic
960151832 3:114257275-114257297 AAAAAGCTGCTGCACAGAAAAGG - Intergenic
960951900 3:123004716-123004738 ACCAGGCTCCTCCACACTGATGG + Intronic
961041142 3:123679348-123679370 AGAAGGCAGCTGCCCAGAGATGG - Intronic
961176750 3:124841935-124841957 ACATGGATGATGCCCAGTGAGGG + Intronic
961392145 3:126558484-126558506 ACAGGGCTGCTGCAGAGTCCAGG + Intronic
962175553 3:133150485-133150507 AAAAGGCTTCTGCACAGGAAGGG - Intronic
962592035 3:136900191-136900213 AAAAGGCTTCTGCACAGCAAAGG - Intronic
962668547 3:137681169-137681191 GAAAAGCTTCTGCACAGTGAAGG + Intergenic
962938168 3:140100781-140100803 AGAAGGCTGCTGTAGAGTGTTGG + Intronic
963877198 3:150489789-150489811 AAAAATCTTCTGCACAGTGAAGG + Intergenic
964226858 3:154413318-154413340 AAAAAACTTCTGCACAGTGAAGG + Intronic
964319249 3:155477411-155477433 AAAAGGCTTCTGCACAGCAAAGG + Intronic
965867144 3:173217650-173217672 ACATGGCTGCTGCAGGGTGATGG + Intergenic
968004432 3:195230359-195230381 GAAAAGCTTCTGCACAGTGAAGG - Intronic
968575089 4:1362321-1362343 CCAAGGCTGGTCCACAGTGCAGG - Intronic
968864573 4:3199761-3199783 ACTAGGCTGTTCCGCAGTGATGG + Exonic
969120523 4:4906113-4906135 AAAAAGCTTCTGCACAGTGAAGG - Intergenic
969173058 4:5379311-5379333 ACAAGGCTGCTGGAGAGTGTGGG - Intronic
969182820 4:5455237-5455259 ACAGGGCTGCTGCAGACAGAAGG - Intronic
969373336 4:6747758-6747780 GCAAGGCTGTTGCACACTCAGGG - Intergenic
969617283 4:8261238-8261260 ACAAGGCAGGTGCACGTTGAGGG + Intergenic
969946708 4:10790690-10790712 GCATGGCTGGTGCACAGTTAGGG - Intergenic
970062971 4:12055978-12056000 AAAAAGCTTCTTCACAGTGAAGG - Intergenic
970723105 4:19010718-19010740 CCATGGCAGCTCCACAGTGATGG - Intergenic
970924269 4:21432726-21432748 AGAATGCTGGTGCACATTGATGG - Intronic
970931277 4:21515179-21515201 ACTAGGCTGGAGCTCAGTGATGG + Intronic
972157727 4:36185452-36185474 ACAAAGCTGCTCCAGTGTGAAGG + Intronic
972207633 4:36797318-36797340 AAAAAGCTTCTGCACAGGGAGGG + Intergenic
972836994 4:42883471-42883493 ACAAAGCTTCTGCACAGCAAAGG - Intergenic
972884158 4:43464691-43464713 AAAAAGATTCTGCACAGTGAAGG - Intergenic
973227631 4:47803870-47803892 ACAAAGCTCCTGCACAGCAAAGG + Intronic
974267678 4:59605938-59605960 AAAAGGCTTCTGCACAGCAAAGG + Intergenic
974910769 4:68117011-68117033 AAAACGCTTCTGCACAGTCAAGG + Intronic
976149073 4:82075089-82075111 ACATGGCTGATGCCCACTGAAGG - Intergenic
976161616 4:82206907-82206929 AAAAGGCTTCTGCACAGCAAAGG + Intergenic
976453960 4:85224042-85224064 GCATGGCTGCTGCAGAGGGATGG + Intergenic
977293443 4:95187823-95187845 ACAAAGCTGCAGCACAGGGCTGG + Intronic
978247613 4:106593850-106593872 ACAATGCTGCTGCACAGAAAGGG - Intergenic
978910106 4:114052393-114052415 ACAAGGGTGGTGCACAGCCATGG - Intergenic
979040002 4:115777699-115777721 AAAAACCTTCTGCACAGTGAAGG - Intergenic
979218242 4:118192260-118192282 AAAAAGCTTCTGCACAGTGAAGG - Intronic
979946315 4:126836345-126836367 AAAAAGCTGCTGCACAGCAAAGG + Intergenic
981163184 4:141523237-141523259 AAAAAGCTGCTGCACAGCAAAGG - Intergenic
982521742 4:156425865-156425887 AAAAGGCTTCTGCACAGCAAAGG - Intergenic
985904859 5:2825700-2825722 AAAAAGCTTCTGCACAGTAAAGG - Intergenic
987151993 5:15051545-15051567 AAAAAGTTTCTGCACAGTGAAGG - Intergenic
988029216 5:25740429-25740451 AAAAAGCTACTGCAGAGTGAAGG + Intergenic
988091795 5:26551747-26551769 AAAAGGCTTCTGCACAGCAAAGG + Intergenic
989428297 5:41322095-41322117 AAAAGGCTTCTGCACAGTGAAGG + Intronic
989491702 5:42062991-42063013 AAAATGCTTCTGCACAGTAAGGG + Intergenic
990593453 5:57289993-57290015 AAAAGGCTTCTGCACACTAAAGG + Intergenic
990854200 5:60244960-60244982 AAAAAGCTTCTGCACAGTAAAGG + Intronic
991482318 5:67094690-67094712 ACAATACTGCTGCAAAGGGAAGG - Intronic
993206602 5:84889440-84889462 AGAAAGCTGCTGCACAGAAAAGG - Intergenic
994596797 5:101848432-101848454 AAAAGGCTTCTGCACAGCAAAGG - Intergenic
994944629 5:106370460-106370482 AGAAAGCTTCTGCACAGTAAAGG + Intergenic
995271141 5:110220593-110220615 ACAGGGCTGCTTCACTGTGCTGG + Intergenic
995604589 5:113838437-113838459 ACAAAGCTTCTGCACAGCTAGGG - Intergenic
995617507 5:113982156-113982178 AAAAGGCTTCTGCACAGCAAAGG - Intergenic
997410302 5:133685843-133685865 ACACGGCTGGGACACAGTGAGGG - Intergenic
997616978 5:135253533-135253555 ACCAGGCTGCTGCAAATTAAGGG - Intronic
998585571 5:143423148-143423170 AAAAGGCTTCTGCACAGCAAAGG + Intronic
998746679 5:145268114-145268136 AAAAGGCTTCTGCACAGCAAAGG - Intergenic
998913307 5:146985378-146985400 AAAAAGCTTCTGCACAGTAAAGG - Intronic
999284306 5:150384976-150384998 ACAGGGCGGAGGCACAGTGAGGG - Intronic
999849166 5:155519119-155519141 AAAAAGCTTCTGCACAGTAAAGG - Intergenic
999938552 5:156515802-156515824 AAACGGCTGGGGCACAGTGATGG - Intronic
1000363712 5:160471933-160471955 ACACAGCTGCTACACAGGGAAGG + Intergenic
1000549386 5:162640865-162640887 AAAAGGCTTCTGCACAGCAAAGG - Intergenic
1000994643 5:167946367-167946389 CCAGGGATGCAGCACAGTGAAGG + Intronic
1001471601 5:172017422-172017444 CCAAGGCTGCTGTGCAGTGGTGG - Intergenic
1003235169 6:4288953-4288975 ACAATTCTGCTGGGCAGTGATGG + Intergenic
1005105497 6:22220531-22220553 CTAAGGCAGCTACACAGTGAAGG - Intergenic
1005800947 6:29423958-29423980 AAAAGGCTTCTGCACAGTGAAGG + Intronic
1005993281 6:30916618-30916640 CCAAGGATGCTTCACAGAGATGG - Intronic
1006059145 6:31406530-31406552 AAAAGGCTTCTGCACAGCAAAGG - Intronic
1006246168 6:32738575-32738597 AAGAGGATGCTGCACGGTGAAGG + Intergenic
1006405651 6:33843359-33843381 ACATGTCTGCTGCCCAGTGTGGG + Intergenic
1007274789 6:40665410-40665432 ACAAGGCTGCAGCTTAGAGATGG - Intergenic
1008237459 6:49067516-49067538 AAAAAGCTGCTGCACAGCAAAGG + Intergenic
1009894116 6:69725901-69725923 AAAAAGCTTCTGCACAGTAAAGG + Intronic
1010014949 6:71093910-71093932 AAAAAGCTTCTGCACAGCGAGGG + Intergenic
1010062323 6:71637103-71637125 ACAAAGCTTCTGCACAGAAAAGG - Intergenic
1010321932 6:74521407-74521429 AAAAAGCTTCTGCACATTGAAGG - Intergenic
1010859739 6:80894694-80894716 AAAAGGCTTCTGCACAGTAAAGG - Intergenic
1011102486 6:83738606-83738628 AAAAAGCTTCTGCACAGTGAAGG - Intergenic
1011176176 6:84563226-84563248 AAAAAGCTTCTGCACAGTAAAGG + Intergenic
1011712694 6:90070593-90070615 ACAAGACTGCTGCACTGTGTGGG - Intronic
1012163896 6:95924106-95924128 GGGAGGCAGCTGCACAGTGATGG - Intergenic
1012601372 6:101101619-101101641 AAAAAGCTTCTGCACAGTCAAGG - Intergenic
1013065031 6:106675942-106675964 ACAAGGCTGGATCACAGTGTTGG - Intergenic
1013563073 6:111326149-111326171 AAAAAGCTTCTGCACAGTAAAGG + Intronic
1013567704 6:111384273-111384295 ACAAAGCTTCTGCACAGCAAAGG + Intronic
1014059107 6:117050398-117050420 GTAGGGCTGCTGCACAGTGGTGG - Intergenic
1014075825 6:117233108-117233130 ACCAGTCAGCTGCTCAGTGAAGG - Intergenic
1016230212 6:141794670-141794692 AAAAAGCTTCTGCACAGTGAAGG + Intergenic
1016636870 6:146302729-146302751 ACAAGGCTGTAGCACCGTGGGGG + Intronic
1016955085 6:149618993-149619015 AAAATGCTTCTGCACAGTAAAGG + Intronic
1017288543 6:152707479-152707501 ACAAAGCTTCTGCACAGTAAAGG - Intronic
1017387815 6:153906731-153906753 AAAAAGCTTCTGCACAGTAAAGG + Intergenic
1017849343 6:158290488-158290510 ACAAAGCTTCTGCACAGCAAAGG - Intronic
1018774590 6:167001023-167001045 AGAAGGCTACTGCACAGCTAGGG - Intronic
1018970314 6:168523790-168523812 ACAAGGCTGTTAAACAGTTAGGG + Intronic
1021212072 7:17866156-17866178 AAAAGGCTTCTGCACAGCAAAGG + Intronic
1021681050 7:23132619-23132641 AAAAAGCTTCTGCACAGTAAAGG - Intronic
1022756840 7:33302252-33302274 AAAAAGCTTCTGTACAGTGAAGG - Intronic
1023450253 7:40276709-40276731 ATAGGGCTGCTTCAAAGTGAGGG + Intronic
1024083740 7:45876754-45876776 CCCTGGCTGCTGCCCAGTGATGG - Intergenic
1024141497 7:46467270-46467292 CCCAGGCTCCTGCATAGTGATGG + Intergenic
1025910337 7:65823736-65823758 CTCAGGCTGCAGCACAGTGACGG + Intergenic
1026598957 7:71757608-71757630 AAAAAGCTTCTGCACAGCGAAGG - Intergenic
1026847004 7:73704048-73704070 TCAAGGCTGCTGCTTAGTTAGGG - Intronic
1027153384 7:75749277-75749299 ACAAGGGTGGTGCTCAGTAACGG + Intergenic
1027277228 7:76570452-76570474 ACAGAGCTGATTCACAGTGATGG + Intergenic
1027996554 7:85432994-85433016 TAAAGGCTTCTGCACATTGAAGG + Intergenic
1028353001 7:89872245-89872267 AAAAAGCTTCTGCACAGTAAAGG - Intergenic
1028728026 7:94111133-94111155 GCTAGTCTGCTGCACAGTGAGGG + Intergenic
1029603336 7:101583021-101583043 GGATGGCTGCTGCACAGTGGAGG + Intergenic
1029906631 7:104099762-104099784 ACCACGTTGCAGCACAGTGAGGG + Intergenic
1030391681 7:108936108-108936130 AAAAAGCTTCTGCACAGCGAAGG + Intergenic
1030475701 7:110031104-110031126 AAAGAGCTTCTGCACAGTGAAGG - Intergenic
1031065744 7:117103763-117103785 AAAAGGCTCCTGCACAGCAAAGG + Intronic
1031286139 7:119870159-119870181 AAAATGCTTCTGCACAGTGAAGG - Intergenic
1031828257 7:126593763-126593785 AAAAAGCTTCTGCACAGTAAAGG + Intronic
1032011027 7:128348040-128348062 TCCTGGCTCCTGCACAGTGATGG - Intergenic
1033109714 7:138563249-138563271 CAAAGGCTGCTGCACCCTGAAGG - Intronic
1033329662 7:140407528-140407550 ACAAGGATGTAGCACTGTGAAGG + Intronic
1034016059 7:147587676-147587698 AGAAGGGAGCTGGACAGTGAAGG - Intronic
1034348588 7:150402361-150402383 GCAAAGCTGCTGCCCTGTGAGGG - Intronic
1034512568 7:151548334-151548356 ACAAAGCTTCTGCACAGCCAAGG - Intergenic
1034863780 7:154623138-154623160 ACAAGGCTGCTGAACATGAAGGG - Intronic
1035080379 7:156210663-156210685 AGAAGGCTGCTTCTGAGTGAAGG + Intergenic
1035349259 7:158234138-158234160 AAAAGGCTTCTGCACAGCAAAGG + Intronic
1035590120 8:806349-806371 GCACGGCTGCTGCAGAGTGACGG - Intergenic
1036652427 8:10653963-10653985 CCCCAGCTGCTGCACAGTGAAGG - Intronic
1036961404 8:13248627-13248649 TCCAGACTGCTGCTCAGTGATGG - Intronic
1038573345 8:28682419-28682441 AAAAAGCTGCTGCACAGCAAAGG - Intronic
1038984746 8:32796136-32796158 ACAAGAATGCTGTAAAGTGATGG - Intergenic
1039089589 8:33813831-33813853 ACAAGAATGCTGAACAGTGCAGG - Intergenic
1039900708 8:41750461-41750483 ACAAGGCTTTTACAAAGTGATGG + Intronic
1040018997 8:42723672-42723694 TCAAGGCTGCTGCACATGGCTGG - Intronic
1041365918 8:57104570-57104592 AAAAAGCTTCTGCACAGTGAAGG + Intergenic
1041416472 8:57615392-57615414 AAAAAGCTTCTGCACAGTAAAGG + Intergenic
1041836445 8:62221900-62221922 AAAAACCTTCTGCACAGTGATGG + Intergenic
1041851656 8:62399980-62400002 ACAAGGCTCCTGAACATAGAGGG + Intronic
1042000430 8:64117575-64117597 AAAATGCTTCTGCACAGTGAAGG + Intergenic
1043119509 8:76305095-76305117 ACAAGGCTGCTGAAATGTAAAGG - Intergenic
1043794022 8:84512506-84512528 AAAACGCTTCTGCACAGTAAAGG - Intronic
1043833424 8:85017024-85017046 TAAGGGCAGCTGCACAGTGATGG - Intergenic
1044000420 8:86872892-86872914 ACAAAGCTTCTGCACAGAAAAGG - Intronic
1044927365 8:97221082-97221104 ATGAGGCTGCTGCACTGTGGAGG - Intergenic
1044957475 8:97496151-97496173 AAAAAGCTGCTGCACAGCAAAGG + Intergenic
1045274924 8:100694998-100695020 GCCAGGCTGGTGTACAGTGACGG - Intronic
1046257132 8:111715274-111715296 ACAAGGCAGCTCCACAGGAAAGG + Intergenic
1046281371 8:112036957-112036979 TAAAGGCAGCTGTACAGTGAAGG + Intergenic
1046413621 8:113881641-113881663 AAAATGCTTCTGCACAGTAAAGG + Intergenic
1046656164 8:116897804-116897826 ACAAGGCTTCTGCACAGCAGAGG + Intergenic
1046820012 8:118623643-118623665 AGAAGGCTGATGCACAGCCAAGG - Intergenic
1047938740 8:129807195-129807217 AAAATGCTGATGGACAGTGAAGG + Intergenic
1048576751 8:135697320-135697342 AAAAACCTTCTGCACAGTGAAGG - Intergenic
1048654209 8:136517438-136517460 TCAAGGCTGTAGCACAGAGAAGG - Intergenic
1049334679 8:142077000-142077022 TCCAGGCTGCTGCTCAGGGAGGG + Intergenic
1051578318 9:18643392-18643414 AAAAAGCTTCTGCACAGTGAAGG - Intronic
1052694755 9:31863300-31863322 AAAAAGCTTCTGCACAGTCAAGG - Intergenic
1053278383 9:36800259-36800281 CCATGGCAGCTGCACAGTCACGG + Intergenic
1053520508 9:38773141-38773163 AAAAGGCTTCTGCACAGCCAAGG - Intergenic
1053664151 9:40305775-40305797 AGCAGCCTGCTGCAGAGTGAGGG + Intronic
1053665118 9:40311980-40312002 AGTAGCCTGCTGCAGAGTGAGGG + Intronic
1053914698 9:42937030-42937052 AGCAGCCTGCTGCAGAGTGAGGG + Intergenic
1054376279 9:64452010-64452032 AGTAGCCTGCTGCAGAGTGAGGG + Intergenic
1054519498 9:66064304-66064326 AGTAGCCTGCTGCAGAGTGAGGG - Intergenic
1054520464 9:66070510-66070532 AGTAGCCTGCTGCAGAGTGAGGG - Intergenic
1054732983 9:68720256-68720278 ACAAGGCTGCTCCTCGGGGAAGG - Intronic
1054785444 9:69205794-69205816 AGACTGCTGCTGCCCAGTGATGG - Intronic
1055300977 9:74882272-74882294 AAAAAGTTTCTGCACAGTGAAGG + Intronic
1055820943 9:80262999-80263021 ACAAATCTTCTGCACAGTAAAGG + Intergenic
1055984522 9:82043203-82043225 AAAAGGCTTCTGCACAGCAAAGG - Intergenic
1056120391 9:83482138-83482160 ACAAGGCTTGTGCACAAGGAAGG + Intronic
1056180237 9:84075947-84075969 ACAAGGCTGCTGCCAGGGGATGG - Intergenic
1056204159 9:84304324-84304346 CCCAGGCTGCTGCACAGCCAAGG - Intronic
1056480029 9:86993402-86993424 AAAAAGCTGCTGCACAGCAAAGG + Intergenic
1056493573 9:87132743-87132765 AAAAGGCTTCTGCACAGCAAGGG + Intergenic
1056943419 9:90974508-90974530 ACACAGCTGCTGATCAGTGAAGG + Intergenic
1057034866 9:91804617-91804639 CCAAGGCAGCTGCACAGTGAAGG - Intronic
1058013084 9:99999655-99999677 AAAAAGTTTCTGCACAGTGAAGG - Intronic
1058038603 9:100280212-100280234 ACAACGCTGCTTCACATTGCTGG - Intronic
1058077879 9:100668737-100668759 AAAAAGCTGCTGCACAGCAAAGG + Intergenic
1058197032 9:101990040-101990062 AAAAAGCTTCTGCACAGTAAAGG + Intergenic
1059447541 9:114348205-114348227 ACAAGGATGCAGCATAGAGAGGG + Intronic
1059975704 9:119714681-119714703 AAAAGGCTTCTGCACAGCAAAGG + Intergenic
1060514768 9:124258638-124258660 ACCAGGCCTTTGCACAGTGATGG + Intronic
1061841138 9:133359237-133359259 ACAAGGCTGCTGCATGGCCATGG + Intronic
1186001190 X:5012857-5012879 AAAAGGCTGCTGCATAGCAAAGG + Intergenic
1186316871 X:8380300-8380322 CCAACGTTGATGCACAGTGATGG - Intergenic
1186604189 X:11072118-11072140 GCAGGGCTGCTGGACAGTGGTGG - Intergenic
1186733431 X:12434750-12434772 ACAGGGCAGCTACACAGTGCAGG + Intronic
1188275306 X:28193102-28193124 AAAAAGCTGCTGCACAGCAAAGG - Intergenic
1188739445 X:33760314-33760336 AAAAGGCTTCTGCACAGCAAAGG - Intergenic
1188929808 X:36093866-36093888 ACATGGCTTCTGCACAGCAAAGG - Intronic
1190957978 X:55215325-55215347 AAAAGGCTTCTGCACAGCAAAGG - Intronic
1191193500 X:57693083-57693105 ACAAAGCTTCTGCACAGCAAAGG + Intergenic
1191594206 X:62923855-62923877 ATAAGGCTGCTGCAGATTGCTGG - Intergenic
1192269032 X:69561259-69561281 ATAATACAGCTGCACAGTGAGGG + Intergenic
1192272419 X:69594452-69594474 AAAAAGCTGCTGCACAGCAAAGG + Intergenic
1192488336 X:71550708-71550730 AAAAAGCTTCTGCACAGTAAAGG - Intronic
1192813034 X:74564961-74564983 AAAAGGCTTCTGCACAGCAAAGG + Intergenic
1192953114 X:76039115-76039137 ACAAAGCTGGTGCACTGTGCTGG + Intergenic
1192990160 X:76443797-76443819 AAAAAGCTTCTGCACAGTAAAGG - Intergenic
1193425657 X:81338005-81338027 ATAAGGCAGCTGCACTGTGCTGG + Intergenic
1193439205 X:81517653-81517675 AAAAAGTTTCTGCACAGTGAAGG + Intergenic
1193679049 X:84495185-84495207 TCAAGGCTGGAGAACAGTGAGGG + Intronic
1194055811 X:89129617-89129639 AAAAAGCTGCTGCACAGCAAAGG - Intergenic
1194097602 X:89662232-89662254 ACAAAGCTTCTGCACAGAAAAGG - Intergenic
1194273790 X:91854973-91854995 ACAAAGCTTCTGCACAGCAAAGG - Intronic
1194477203 X:94372915-94372937 AAGAAGCTTCTGCACAGTGAAGG + Intergenic
1194537843 X:95129119-95129141 ACAATGCTTCTGCACAGCGATGG + Intergenic
1194573504 X:95582240-95582262 CCAAGGCAGCTTCACAGTTATGG + Intergenic
1195250832 X:103045209-103045231 ACAAAGCTTCTGCACAGCAAAGG - Intergenic
1196087385 X:111699363-111699385 AAAAAGCTGCTGCACAGCAAAGG - Intronic
1196154487 X:112412871-112412893 ACAAAGCTTCTGCACAGTAAAGG + Intergenic
1196290988 X:113940706-113940728 AAAAAGCTTCTGCACAGTGAAGG + Intergenic
1196509591 X:116492169-116492191 AAAAAGCTTCTGCACAGTGATGG - Intergenic
1197166793 X:123386432-123386454 AAAAAGCTTCTGCACAGTAAAGG - Intronic
1197508340 X:127337383-127337405 AAAAGGCTTCTGCACAGCAATGG - Intergenic
1197926610 X:131653438-131653460 ACAAGGCTTCTGCACAGCAATGG - Intergenic
1198056820 X:133003963-133003985 ACCAGGCTGCTGCATACGGAGGG + Intergenic
1198802091 X:140458498-140458520 CCCAGGCTGGAGCACAGTGATGG + Intergenic
1198885428 X:141330635-141330657 AAAAAGCTTCTGCACAGTAAAGG + Intergenic
1199425444 X:147695681-147695703 AAAATGCTGCTGCACAGCAAAGG + Intergenic
1199810874 X:151347231-151347253 ACACAGTTTCTGCACAGTGAAGG + Intergenic
1200569482 Y:4810796-4810818 AAAAAGCTGCTGCACAGCAAAGG + Intergenic
1200591028 Y:5076390-5076412 ACAAAGCTTCTGCACAGCAAAGG - Intronic
1201676175 Y:16587029-16587051 AGAAAGTTGTTGCACAGTGAAGG - Intergenic