ID: 1129622226

View in Genome Browser
Species Human (GRCh38)
Location 15:77158509-77158531
Sequence TGCTGTATGTTGCACTACAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 77}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129622226 Original CRISPR TGCTGTATGTTGCACTACAA GGG Exonic