ID: 1129622226

View in Genome Browser
Species Human (GRCh38)
Location 15:77158509-77158531
Sequence TGCTGTATGTTGCACTACAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 77}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129622226 Original CRISPR TGCTGTATGTTGCACTACAA GGG Exonic
904178411 1:28648011-28648033 TGCTATATGCTGCACTTCGAAGG - Intergenic
910361253 1:86415404-86415426 TGAAGTATGTTGCATTACAGTGG + Intergenic
914329771 1:146656097-146656119 TGCTCTATGTTATACTACAAAGG - Intergenic
914350626 1:146836695-146836717 TGATGTATTGTGCTCTACAAGGG + Intergenic
917430647 1:174964648-174964670 TGCTGTATGTGGGACTATTAAGG - Intronic
1065040806 10:21693681-21693703 TGCTGTATTTTGAAATATAATGG - Intronic
1066101950 10:32125296-32125318 TGCTGTCTGTTCCACTACACTGG - Intergenic
1068881271 10:62051662-62051684 TGAAGTATTTTGCACGACAAAGG + Intronic
1074071445 10:110073802-110073824 TGCTATCTGTTGGAATACAAAGG + Intronic
1075929039 10:126278953-126278975 TGCTGAATATTCGACTACAACGG - Exonic
1076143137 10:128095655-128095677 TGTTGTGTGTTGCCCTGCAAGGG - Intergenic
1076286419 10:129301867-129301889 TGCTTTTTGTAGCACCACAAAGG - Intergenic
1084044950 11:66563098-66563120 CGCCGTATGGTGCCCTACAAGGG + Exonic
1084975881 11:72798005-72798027 TGCTGTCTGTCTCATTACAAGGG + Intergenic
1087933484 11:104004608-104004630 TGCAGTATTTTGAACTACAGGGG + Intronic
1100304624 12:93338956-93338978 TGCTGCATGTTGGGATACAATGG - Intergenic
1103202833 12:119102582-119102604 GGCTGTTTTTTGCACTGCAATGG - Intronic
1108058090 13:46505178-46505200 AGCTGCGTGTTGCACTACACCGG + Intergenic
1112150747 13:96760172-96760194 TGTTTTATATTGCACTACCATGG + Intronic
1118520573 14:66578926-66578948 TGCTGTATGTAAAGCTACAATGG + Intronic
1125193065 15:37015746-37015768 TGCTCTATGTTGCACTGCACAGG - Intronic
1129622226 15:77158509-77158531 TGCTGTATGTTGCACTACAAGGG + Exonic
1139983410 16:70878844-70878866 TGATGTATTGTGCTCTACAAGGG - Intronic
1140003789 16:71054836-71054858 TGCTCTATGTTATACTACAAAGG + Intronic
1145197428 17:20907224-20907246 TGTTGTATATTTTACTACAATGG + Intergenic
1160980569 19:1814853-1814875 TGCTGTGTGTTGCCCGTCAAAGG - Intergenic
1164402214 19:27910108-27910130 TGCGGGATGTTGCACTACCTGGG - Intergenic
1164520007 19:28971977-28971999 GGCTAAATGTTGCACCACAAAGG - Intergenic
924992969 2:329934-329956 AGCTGTATGTTGCAAGACAGGGG - Intergenic
925418220 2:3688526-3688548 TGGTGTATGAGGCACTACTAAGG + Intronic
928818656 2:35332232-35332254 TGCTGTATCTCACACTACATGGG + Intergenic
933140055 2:78781173-78781195 TGTTGCTAGTTGCACTACAATGG + Intergenic
934578631 2:95420006-95420028 TGCTGTAAGTTCCAGTTCAAAGG + Intergenic
934600811 2:95656703-95656725 TGCTGTAAGTTCCAGTTCAAAGG - Intergenic
935039025 2:99407645-99407667 TGCTGTATGATGACCTAGAAGGG - Intronic
937666900 2:124498313-124498335 AGCTGTATGAGGAACTACAATGG - Intronic
942799402 2:179859780-179859802 TGCTGTATTTTGCATTCTAAAGG + Intronic
946936891 2:224731498-224731520 TGCTGTTTGTTCTACTATAATGG - Intergenic
1169722922 20:8698898-8698920 AGCTCTATTTTGCACCACAAGGG + Intronic
1175212010 20:57365204-57365226 TGCTGTAGTTTGCAGTACACTGG + Intronic
1182356718 22:29725538-29725560 CGCTGGATTGTGCACTACAAGGG - Intronic
1183446934 22:37863446-37863468 TGGGGTATTTTACACTACAATGG - Intronic
950192539 3:10987615-10987637 TGCTGTGTGTAGCAGTCCAAGGG + Intergenic
950355371 3:12403831-12403853 TACTGTATTTTGAAATACAATGG - Intronic
953188721 3:40663530-40663552 TGCAGTATGTTGTCCTACACCGG + Intergenic
957240095 3:77648635-77648657 TGCTGTATGTAGCTATACAAAGG + Intronic
957400349 3:79704283-79704305 TTCTGTATGTGATACTACAAGGG - Intronic
963572629 3:147016541-147016563 TTCTGTATTTTGGACTTCAATGG + Intergenic
975615392 4:76241411-76241433 TGCTGATTGTTGCTTTACAAAGG - Intronic
975867949 4:78745027-78745049 TGCTGTTTTTTACACTATAAGGG - Intergenic
979296760 4:119041763-119041785 AGCTATATGTTACACTACGAAGG - Intronic
979616711 4:122750882-122750904 TCCTGTATGTTGAATAACAATGG - Intergenic
984643103 4:182191949-182191971 TGCTGCATCTTGCTCTAAAACGG - Intronic
985331750 4:188844902-188844924 GGCTGTTTGTTGCAGTAGAATGG - Intergenic
987729628 5:21752205-21752227 TACTGTATGTAGCACTGCGAAGG - Exonic
993279314 5:85905112-85905134 TGCTGTGAGTTGCACTGCCAAGG - Intergenic
996182988 5:120442734-120442756 TGATGTATGTTCAACTTCAAAGG + Intergenic
997512481 5:134463176-134463198 TGCTGTATCTTGCACAGCAAAGG - Intergenic
999138721 5:149342464-149342486 TTCTGAATGTTGCAGTACAAGGG - Intergenic
1003808659 6:9755001-9755023 AAGTGTATGTTGCACTAAAAGGG - Intronic
1009671922 6:66764995-66765017 TTCTGTATGTTTCTCGACAATGG + Intergenic
1009919393 6:70038779-70038801 TACTGGTTGTTGCACTACACTGG + Intronic
1011806652 6:91079958-91079980 TGCTGTATTTTCCACTGCACAGG - Intergenic
1015620940 6:135130947-135130969 TGCTTTATATAGCACTAAAATGG + Intergenic
1016227272 6:141753668-141753690 TGCTTTATGTTGAAAAACAAAGG - Intergenic
1019038572 6:169083692-169083714 GCCTGTATGTTGCACAAAAATGG - Intergenic
1028117331 7:87014045-87014067 TGCTTTATGTTGCTTTAAAATGG + Intronic
1035552661 8:542288-542310 TCCTGTGTGTGACACTACAATGG + Intronic
1036444438 8:8809383-8809405 TGCCCTTTGTTGCTCTACAATGG + Intronic
1037694813 8:21214279-21214301 TGGTGTTTCTTGCACTCCAAGGG + Intergenic
1039032175 8:33322386-33322408 TGCTGAGTGTAGCTCTACAAGGG + Intergenic
1039974312 8:42347916-42347938 TGCTGAATGTTTAACTAAAAAGG + Intronic
1044316554 8:90755950-90755972 TTCTGTATGTGGCATTACAGCGG - Intronic
1048793363 8:138125092-138125114 TGCAGTTTGATGCAATACAAAGG + Intergenic
1051564026 9:18475777-18475799 TGCTTTATGATGCAATATAATGG - Intronic
1051755330 9:20393422-20393444 TGCTGATTGTTGCATTTCAAAGG + Intronic
1052011232 9:23412121-23412143 TGTTGTATGCTGCACTACTTGGG - Intergenic
1055565055 9:77559922-77559944 TGGTGTATGTCGCATAACAAGGG - Intronic
1060704870 9:125789503-125789525 TGCTGTAAGCTGCCCTAAAATGG - Intronic
1186210458 X:7245074-7245096 TGCTATATGTTGCACTCTTATGG + Intronic
1189390995 X:40576683-40576705 TGCTGTATTTTCCAGTAGAAAGG - Intergenic
1190027612 X:46939990-46940012 TGGTTTATTTTACACTACAATGG + Intronic
1192449865 X:71237626-71237648 TGTTGCATGGTGCACCACAAGGG + Intergenic
1194554812 X:95343033-95343055 TGGTGATTGTTGCACAACAATGG + Intergenic
1198754981 X:139973324-139973346 GTCTGTATGTTGCAATCCAATGG - Intergenic