ID: 1129623025

View in Genome Browser
Species Human (GRCh38)
Location 15:77166824-77166846
Sequence GACACTAATGTGACAAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 154}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129623025 Original CRISPR GACACTAATGTGACAAAAGC AGG Intronic
900242634 1:1624318-1624340 GAGACAAAGGTGACAAATGCAGG - Intronic
901852438 1:12024267-12024289 GACAATAACGTGAAAAGAGCTGG - Intronic
902967505 1:20018821-20018843 GACAATAATATAACAAATGCTGG - Intergenic
905286566 1:36884209-36884231 GACTCAAAGGTGACAAGAGCAGG - Intronic
906430403 1:45751156-45751178 GCCACTAATGTGACACATGAGGG - Intergenic
907515253 1:54989679-54989701 GTCACTAAGGTGACAGAAGGTGG + Intronic
907769768 1:57449355-57449377 GACACTAAAATGATAAAAGAAGG - Intronic
908078167 1:60543745-60543767 GAGAGAAATGGGACAAAAGCAGG + Intergenic
910042525 1:82870118-82870140 GACACTAATGTGACAAATTATGG + Intergenic
911801180 1:102140446-102140468 GATACTAAATGGACAAAAGCTGG + Intergenic
913257815 1:116971176-116971198 AACACTAAAGGGAGAAAAGCAGG - Intronic
916537270 1:165715106-165715128 GACACTAAATTGAGAAAAGAGGG - Intergenic
922326253 1:224531153-224531175 GACACTGATGTGACTACAGCTGG - Intronic
923191107 1:231621708-231621730 CACACAATTGTGAGAAAAGCTGG + Intronic
923892954 1:238235867-238235889 GACTCCCATGTGACAACAGCAGG + Intergenic
1066216224 10:33290623-33290645 GAAACTAATTGAACAAAAGCTGG - Intronic
1067658959 10:48219326-48219348 CACTGTCATGTGACAAAAGCTGG - Intronic
1068178172 10:53488279-53488301 GAAAGTAATGTGACAAAATTGGG - Intergenic
1071219065 10:83442276-83442298 GACTCTAATAAGAAAAAAGCTGG + Intergenic
1071402887 10:85294766-85294788 GACACTAATAAGACAAATTCTGG + Intergenic
1072817768 10:98526658-98526680 GACACTAATGGGACGAAGGACGG + Intronic
1073050445 10:100663605-100663627 GACTCAGATGTGCCAAAAGCAGG + Intergenic
1074354222 10:112767926-112767948 GGCACTAGTGTCACAGAAGCCGG + Intronic
1076461311 10:130649328-130649350 GACATGAATGTCACACAAGCAGG + Intergenic
1078402663 11:11042170-11042192 GAGACTAAGGTGGCAAAAACAGG - Intergenic
1079582918 11:22088455-22088477 AACACTAATGTGACAGAGGCTGG - Intergenic
1082790925 11:57346343-57346365 GGCAGTAATGGGACAAAAGGTGG + Intronic
1085983400 11:81752973-81752995 GAGACTAAAGTCACAAGAGCAGG + Intergenic
1086370454 11:86151103-86151125 GACTCTAAATTGCCAAAAGCAGG - Intergenic
1086913256 11:92497174-92497196 GACAGAAATGTGACACTAGCTGG - Intronic
1087102828 11:94381533-94381555 CTCACTCCTGTGACAAAAGCAGG - Intronic
1087406321 11:97735333-97735355 CATACTAATTGGACAAAAGCTGG + Intergenic
1092778290 12:11962872-11962894 GACCCTAATGTGATAGAACCAGG + Intergenic
1093020626 12:14200318-14200340 TATATTAATGTGATAAAAGCAGG - Intergenic
1093391007 12:18621375-18621397 GACACTTCAGTGACAAAATCTGG + Intronic
1095619537 12:44233743-44233765 GACACTAATGTGATAAAATTTGG - Intronic
1097993271 12:65859335-65859357 GACACACATGTAACAAGAGCAGG - Exonic
1100472195 12:94903585-94903607 TATAGCAATGTGACAAAAGCAGG + Intronic
1106062971 13:26313037-26313059 GAAAATAATGTGTCAAAAACAGG - Intronic
1107239289 13:38212579-38212601 GACACCATTATGACAAAAGTTGG - Intergenic
1107351761 13:39522093-39522115 GAAAGTGATGTGACAAAAGTTGG - Intronic
1111658962 13:91185673-91185695 GAAACTAAGGTGCCTAAAGCTGG - Intergenic
1112691829 13:101905162-101905184 GACAGTAATGTTACAAATGATGG - Intronic
1114201604 14:20526134-20526156 CACCTTAATGTGACAAAAGAGGG - Intergenic
1114612911 14:24053905-24053927 GACACTGAGGAGACAAAACCTGG + Intronic
1116655788 14:47651916-47651938 AACATTAATTTGTCAAAAGCTGG - Intronic
1118535891 14:66763847-66763869 GCCACTGATCTGACAAAAGGTGG - Intronic
1118549072 14:66929413-66929435 GACCCTAATATGCCAATAGCTGG - Intronic
1120234902 14:81879036-81879058 GACAGTAATGTCACAAAGGATGG + Intergenic
1125861179 15:43002169-43002191 AACAGTAATGTAACAAAAACAGG + Intronic
1126158715 15:45588615-45588637 GACAGTGATGTGACAGCAGCGGG - Intronic
1126342330 15:47654736-47654758 CATGTTAATGTGACAAAAGCAGG - Intronic
1127247282 15:57191155-57191177 GAGACTCAAGTGAAAAAAGCAGG + Intronic
1127869612 15:63060403-63060425 GACACTAACGTGAGACAAGTTGG - Intronic
1129118205 15:73378165-73378187 GACAGAAATGTGACTAAATCTGG + Intergenic
1129623025 15:77166824-77166846 GACACTAATGTGACAAAAGCAGG + Intronic
1131512758 15:93058416-93058438 GGCACTGATGTGAGCAAAGCCGG + Intronic
1131610376 15:93955010-93955032 GGCACTAATGTGTCAAAACGTGG - Intergenic
1131716068 15:95112184-95112206 GCCACTAATCTGACAGAAGGTGG - Intergenic
1137392450 16:48092730-48092752 GACAAGAATGTCCCAAAAGCAGG + Intronic
1137866204 16:51899163-51899185 GACTCTAATGTGAAAGAAACTGG - Intergenic
1138951929 16:61922509-61922531 AACAATAAAGTGAAAAAAGCAGG - Intronic
1149074670 17:52580960-52580982 GACAATAAGGGAACAAAAGCTGG + Intergenic
1149681619 17:58511582-58511604 GGCACTAATGTATCAATAGCAGG + Intronic
1150799990 17:68273605-68273627 GACACTGATGTGAGAAATACTGG + Intronic
1155992714 18:32296444-32296466 GACACTCATGGGAAAAAAACTGG - Intronic
1156563355 18:38154944-38154966 GACAATAATAAGATAAAAGCAGG - Intergenic
1158024756 18:52882861-52882883 GACACCAATATGATAACAGCTGG - Intronic
1159885525 18:73900583-73900605 GTCAGCATTGTGACAAAAGCTGG + Intergenic
1168391284 19:56010070-56010092 GAAACAAACCTGACAAAAGCCGG + Intronic
926740532 2:16106838-16106860 GACACGGAGGTGAGAAAAGCAGG - Intergenic
928584932 2:32750008-32750030 AACACAAATGTGAGAAGAGCTGG + Intronic
929488308 2:42374362-42374384 GACACTTCTGTGAAAAAAGTAGG - Intronic
930809646 2:55527074-55527096 CACATTAATGTGAAAAAATCTGG + Intronic
930948402 2:57105913-57105935 GCCACTAATCTGACAACAGGTGG - Intergenic
933124486 2:78587167-78587189 CACACTATTGAGACAAAAGATGG + Intergenic
935789414 2:106577349-106577371 GACAATAAGGGGATAAAAGCTGG - Intergenic
937773149 2:125745648-125745670 GAGACCAATGTGACCACAGCAGG + Intergenic
938261261 2:129896561-129896583 GCCACCAAGGTGACATAAGCAGG + Intergenic
939977558 2:148736739-148736761 GAGACTACTGTGACAAAACATGG - Intronic
943760991 2:191608898-191608920 GAAAGAAGTGTGACAAAAGCAGG + Intergenic
946824982 2:223668526-223668548 GACACAACTGTGAGAAAAGAGGG - Intergenic
947358933 2:229326602-229326624 GACACTAATGAGAAGAAAGCTGG + Intergenic
948667596 2:239546108-239546130 GAGCCACATGTGACAAAAGCCGG + Intergenic
1173170466 20:40719376-40719398 GACACTCATGTGACAACTGTGGG - Intergenic
1174053163 20:47781265-47781287 GCCACTAATGTGAGCAATGCTGG - Intronic
1176043259 20:63078802-63078824 GACACTAATGTAGGAAATGCAGG - Intergenic
1176912163 21:14579124-14579146 GACACTAAAGTGAAAGAAGTTGG - Intronic
1178330030 21:31681184-31681206 TACAGTAGTGTGACAAAAACTGG + Intronic
1185154219 22:49183582-49183604 GTCACTGAGGTGACAAATGCTGG - Intergenic
949729833 3:7096185-7096207 TCCACTAATGTGACACCAGCTGG + Intronic
949771545 3:7584665-7584687 TACAATAATTTGACAAAAGATGG + Intronic
958763416 3:98335451-98335473 AACACTGAAGTGATAAAAGCAGG + Intergenic
958903012 3:99910380-99910402 AAGACTAATGTAACAAAAACAGG + Intronic
958915397 3:100044767-100044789 GAAACCAATGTGAAAAAGGCTGG + Intronic
959529161 3:107412931-107412953 GAAACTAATCTGACACAACCAGG + Intergenic
964378189 3:156070155-156070177 TCCACTAAAGTGACAATAGCTGG - Intronic
964531396 3:157671694-157671716 TACACTAATGGGACATAAGCAGG - Intronic
969297623 4:6279110-6279132 GTCACTGATGTGGCCAAAGCAGG + Intronic
970955585 4:21807157-21807179 GCCACTAATCTGACAGAAGGTGG + Intronic
972731950 4:41803308-41803330 GACACAAATGGACCAAAAGCAGG + Intergenic
972932117 4:44084997-44085019 GATACAAATTTGACATAAGCTGG - Intergenic
975805910 4:78111875-78111897 GAGAATAATATGAGAAAAGCAGG + Intronic
976373658 4:84319527-84319549 GACACAAATGGGTTAAAAGCCGG - Intergenic
976644757 4:87375755-87375777 AAAACTAATGTGGCAAAATCAGG + Intronic
977705814 4:100068746-100068768 GACAGCAATGTGCTAAAAGCAGG - Intergenic
979477902 4:121179994-121180016 AACACTAATGTAGCACAAGCAGG + Intronic
986507148 5:8463918-8463940 GAAACAAATGAGAAAAAAGCAGG + Intergenic
986888228 5:12266640-12266662 GACACTTTAGTCACAAAAGCTGG - Intergenic
988320687 5:29691563-29691585 GAGCCTAATGTGAAAACAGCTGG + Intergenic
989523237 5:42424630-42424652 ACCACTAGTGTGTCAAAAGCTGG - Intronic
991134850 5:63169447-63169469 GAAGCAAATGTGAAAAAAGCAGG - Intergenic
993552043 5:89285281-89285303 GACACAAATAGGAAAAAAGCAGG - Intergenic
996257020 5:121416636-121416658 GACACCAATGATACAAAAGTTGG + Intergenic
998494017 5:142571369-142571391 GACATTAATGGCAAAAAAGCTGG - Intergenic
998814849 5:146002725-146002747 GCCACTAATCTGACAGAAGGTGG - Intronic
999342759 5:150787094-150787116 GAGACTAAGGGGACAAAAGTTGG - Intronic
999520800 5:152348933-152348955 GCCACTAATCTGACAAGAGGTGG + Intergenic
1005147001 6:22702839-22702861 GGCTCTCATGTGGCAAAAGCAGG + Intergenic
1010836087 6:80588796-80588818 CACATTAAGGTGACAAAATCTGG + Intergenic
1011419719 6:87158142-87158164 AACACTAATGAAACAAATGCTGG + Intronic
1012373425 6:98532554-98532576 GGCACCAATAGGACAAAAGCAGG + Intergenic
1013208749 6:107968211-107968233 GACAGGAAGATGACAAAAGCAGG + Intergenic
1013642864 6:112104647-112104669 GACATTAATCTGAAGAAAGCTGG + Intergenic
1013952465 6:115800489-115800511 GACACTAATCAAATAAAAGCTGG + Intergenic
1020626316 7:10584413-10584435 TACACTAATGTGACAACAATAGG - Intergenic
1020997526 7:15281700-15281722 GAGACTGGTGTGGCAAAAGCAGG - Intronic
1024743696 7:52383128-52383150 GACACCACAGTGAGAAAAGCAGG - Intergenic
1025640079 7:63358554-63358576 GGCAGAAATGTGACAAAAGAAGG + Intergenic
1025642620 7:63389538-63389560 GGCAGAAATGTGACAAAAGAAGG - Intergenic
1031592377 7:123609446-123609468 GACACTGATGTGACAGGTGCTGG + Intronic
1032608002 7:133378546-133378568 GACAATAATTAGACAAAAGATGG + Intronic
1036107802 8:5860307-5860329 GACACCTCTGTGACAAAAGATGG + Intergenic
1036563536 8:9918594-9918616 GACACTAATGCTGCAAATGCAGG + Intergenic
1040547200 8:48407908-48407930 ATGACTAATGTGAGAAAAGCCGG + Intergenic
1043658867 8:82709161-82709183 GTCACTAATGGGCCAAAGGCTGG + Intergenic
1045501115 8:102745169-102745191 GACAATAGTGTGAAAAAGGCAGG - Intergenic
1049568772 8:143358472-143358494 GACCCGAATGTTACAAGAGCTGG + Intronic
1051950687 9:22628404-22628426 GACAATAATATTACAAAAGTGGG + Intergenic
1052254491 9:26438371-26438393 GAGACTAAGGGGACAAAAGTTGG - Intergenic
1053413082 9:37928300-37928322 GACAGCAAAATGACAAAAGCAGG + Intronic
1053584655 9:39444440-39444462 GAAACTCATGTGACATAGGCTGG - Intergenic
1054106235 9:61003186-61003208 GAAACTCATGTGACATAGGCTGG - Intergenic
1054581662 9:66920782-66920804 GAAACTCATGTGACATAGGCTGG + Exonic
1055190187 9:73510624-73510646 GACACTATTGTAACTAAAGAAGG - Intergenic
1055869957 9:80864624-80864646 AAAACTAATGAGAAAAAAGCTGG - Intergenic
1058517583 9:105792386-105792408 CACACTAAACAGACAAAAGCTGG - Intergenic
1060236456 9:121866921-121866943 GTCCCTAATGTCACAAAACCTGG + Intronic
1061593221 9:131612322-131612344 GACACTACTGTGCCTGAAGCTGG + Intronic
1186791883 X:13007677-13007699 CACACTGATGTGACAAATTCAGG + Intergenic
1188047729 X:25447458-25447480 GACATTAATATGATAAAAACAGG - Intergenic
1188659356 X:32739324-32739346 TACCCTAATGTGGCAAAATCAGG + Intronic
1188725171 X:33574015-33574037 TATACTAATTAGACAAAAGCTGG - Intergenic
1189095250 X:38131791-38131813 GACACTAATATGACTGAATCAGG - Intronic
1193642688 X:84030668-84030690 GACTCCAATGTGATAATAGCTGG + Intergenic
1194431153 X:93807422-93807444 GACCCTAAAGTGGAAAAAGCAGG + Intergenic
1196018710 X:110966649-110966671 TACAATTATGTGAGAAAAGCAGG + Intronic
1196572042 X:117277608-117277630 GACACTCATGGGAAAAAGGCAGG + Intergenic
1197281684 X:124544149-124544171 GACACTTATGTGCCATAATCAGG - Intronic
1198686103 X:139229508-139229530 GACACTACTATGACAAAGACAGG + Intergenic
1199488563 X:148373849-148373871 GACCCAAATCTGACAGAAGCTGG + Intergenic