ID: 1129627671

View in Genome Browser
Species Human (GRCh38)
Location 15:77220300-77220322
Sequence ACTTTTACTCAGAAGCTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 254}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129627671 Original CRISPR ACTTTTACTCAGAAGCTTCA AGG Intronic
900793457 1:4693933-4693955 ACATTTCCACAGAAGCTTCTGGG + Intronic
902902563 1:19529580-19529602 ACATTTACTCAGTGTCTTCATGG - Intergenic
903367755 1:22815474-22815496 GGTTTCACTGAGAAGCTTCATGG - Intronic
903678342 1:25080723-25080745 ACTTTTGGGCAGAAGCTTTAGGG - Intergenic
908879797 1:68718438-68718460 ACAGTTACTCTGAAGCTCCAAGG + Intergenic
909913513 1:81289948-81289970 ACTGTAGCTCAGAAGCTTTAAGG - Intergenic
910556860 1:88543961-88543983 ACTTCTAGACAGAAGCTTGAGGG - Intergenic
911450803 1:98058047-98058069 AGTTTAAGGCAGAAGCTTCAAGG + Intergenic
918792395 1:188846261-188846283 GCTTTCACTCAGAAAATTCATGG - Intergenic
919128395 1:193424703-193424725 AATTTTACTGAAAAGCTTCCTGG + Intergenic
919863446 1:201759524-201759546 AGTTTTACTGAAAAGATTCATGG - Intronic
922040290 1:221889651-221889673 ACTTTTATTAAGCAGCCTCATGG + Intergenic
923234116 1:232015712-232015734 AATTTCACACAGGAGCTTCATGG - Intronic
924436222 1:244046196-244046218 ACTTTTACTCACAATTTTCATGG + Intergenic
924640289 1:245827102-245827124 ACGTTTTCACAGAAACTTCAGGG + Intronic
1063270317 10:4501656-4501678 ACTTTATCTCAGATGGTTCAGGG + Intergenic
1065093226 10:22254486-22254508 TCTTTTACTAAGTAGCTTTAGGG - Intergenic
1065955087 10:30686588-30686610 CCTTTTTCTCAGAACCTTTAGGG + Intergenic
1066199442 10:33131009-33131031 ACTTTTACTCAGTAGCAAAACGG + Intergenic
1067233711 10:44429211-44429233 ACTAATACCCAGAATCTTCAAGG - Intergenic
1067373685 10:45708054-45708076 ACTGTTAACCAGAAGCCTCATGG - Intergenic
1067380002 10:45764172-45764194 ACTGTTAACCAGAAGCCTCATGG + Intronic
1067887702 10:50104827-50104849 ACTGTTAACCAGAAGCCTCATGG + Intronic
1068138928 10:52979629-52979651 ACTTTCTCTCAAAATCTTCAAGG + Intergenic
1069065219 10:63935541-63935563 CCTTTTAATCAGAAGATTCCTGG - Intergenic
1071414443 10:85428070-85428092 ACATTTAAACAGGAGCTTCAAGG + Intergenic
1072294639 10:93997378-93997400 ACTGTGATTCAGAAGCTTTATGG - Intronic
1074741568 10:116489481-116489503 ACTTTTTCTCTGAAGCTGCAGGG + Intergenic
1078444608 11:11394853-11394875 ACTCTAACTCAGAATGTTCAGGG - Intronic
1079749036 11:24171971-24171993 GCTTTTGCACAGCAGCTTCATGG + Intergenic
1085360954 11:75886822-75886844 ACTTTCACTTAAAACCTTCACGG + Intronic
1085421126 11:76361476-76361498 AATATTACTGAGAAGCATCAAGG + Intronic
1085751439 11:79165522-79165544 ACTAATACTCAGAATCTACAAGG - Intronic
1086140072 11:83488342-83488364 ACTATTACTCAGAAGTCTCCAGG + Intronic
1088139204 11:106595402-106595424 TCTTTCACTCTGAAGGTTCATGG + Intergenic
1088560236 11:111107528-111107550 ATTTTTACTAAGAAGATTAATGG + Intergenic
1088678879 11:112222216-112222238 CCTTTGACTGAGCAGCTTCAAGG + Intronic
1088717989 11:112565552-112565574 AATTTTACCCAGAAGCTGCCAGG + Intergenic
1089548916 11:119254919-119254941 ACTTGTTCTCAGTAGATTCATGG + Intronic
1089635826 11:119810912-119810934 ACTTTTTCTAAAAAGCTTCTTGG + Intergenic
1089822696 11:121242083-121242105 ACTTTAACTCAGAAGGGGCAGGG + Intergenic
1092143798 12:6201076-6201098 ACTTTTACGCAGGAGCGGCAGGG + Intronic
1092234644 12:6798820-6798842 TCTTTCACTCAGCAGCTGCAGGG + Intronic
1092724952 12:11475816-11475838 ACTTCCACTCAGAAGGTTAAGGG - Intronic
1092750595 12:11715626-11715648 ACTCTTCCTCAGCAGCATCAGGG - Intronic
1098301803 12:69061882-69061904 ACTTTTACTTGGAAGCTTAAGGG - Intergenic
1099337530 12:81382538-81382560 ACCTCTTCTCAGAATCTTCATGG - Intronic
1099831242 12:87845357-87845379 AATATTTCTCTGAAGCTTCAAGG - Intergenic
1100465103 12:94837355-94837377 ACTTTTACTCAGTAACTTTTTGG - Intergenic
1100467762 12:94862563-94862585 CCTTCTACTCAAAAACTTCATGG + Intergenic
1101599552 12:106197365-106197387 GCTCTTGCTCAGAAGCTGCAGGG + Intergenic
1102710286 12:114919993-114920015 ACTTTTGTTAATAAGCTTCATGG + Intergenic
1106541357 13:30693048-30693070 ACTAATATTCAGAAGCTACAAGG - Intergenic
1106978869 13:35254210-35254232 AATTTTAGCCAGAATCTTCAGGG + Intronic
1108172331 13:47754524-47754546 ACTAATACTCAGAATCTACAAGG + Intergenic
1108553126 13:51566125-51566147 ACTTATATTCAGAACCTCCAAGG - Intergenic
1109576768 13:64269622-64269644 ACTAATACTCAGAATCTACAAGG + Intergenic
1110666277 13:78121116-78121138 ACTTTTACTCAGGGGTTTAATGG - Intergenic
1110976252 13:81839389-81839411 ATTTTTGGTCAGAACCTTCATGG + Intergenic
1111475613 13:88742728-88742750 GCTTTAACTCAGAAATTTCAAGG + Intergenic
1113510145 13:110847361-110847383 AGTTCTAGTCAGAAGCTCCAAGG + Intergenic
1115208482 14:30940463-30940485 ACTTTCCCTCAGAATCTTTAAGG + Intronic
1116366323 14:44069850-44069872 AGTTTTATTCAGAAGCTTCGTGG - Intergenic
1116972226 14:51077849-51077871 AGTTTTTCTCAGAGGCATCATGG + Intronic
1118186435 14:63542778-63542800 ATTCTTCCCCAGAAGCTTCAAGG - Exonic
1118195191 14:63618905-63618927 ATTTTGACTCAGAATTTTCAAGG - Intronic
1118582301 14:67314512-67314534 ACTGTTACTCTGAAGAATCACGG - Intronic
1118683793 14:68270468-68270490 ACTTTTACTCAGAATAGTCTAGG + Intronic
1120058373 14:79952510-79952532 ACTCTTAATCTGAAGATTCAAGG + Intergenic
1120843877 14:89109550-89109572 ACTTTTACCAAGAAGTTTGATGG - Intergenic
1121490708 14:94357681-94357703 ACTATTACTCAGAATCCTTATGG - Intergenic
1122156159 14:99751664-99751686 CCCTTTTCTCAGAAGCTCCATGG - Intronic
1123988388 15:25665215-25665237 ACTTTTACACAGATGCTCCTTGG - Intergenic
1124487565 15:30132951-30132973 ACTTTTGATCAGAAGTTCCAGGG - Intergenic
1124542654 15:30601929-30601951 ACTTTTGATCAGAAGTTCCAGGG - Intergenic
1124755963 15:32405373-32405395 ACTTTTGATCAGAAGTTCCAGGG + Intergenic
1127263890 15:57345982-57346004 AATATTACCCAGAAGCTTCCTGG - Intergenic
1127356510 15:58205999-58206021 ATTTTTACTCTGAACGTTCAGGG + Intronic
1129627671 15:77220300-77220322 ACTTTTACTCAGAAGCTTCAAGG + Intronic
1130084562 15:80766370-80766392 GTTTTGACTCAGTAGCTTCATGG + Intergenic
1130535079 15:84778628-84778650 ACTTTTCCTGAGATGCTTTAAGG + Intronic
1130894374 15:88158942-88158964 GCTTTTAGTCAGTAGCTGCAAGG - Intronic
1131833013 15:96366260-96366282 ACTTTTACACAGGAACTCCAGGG + Intergenic
1132084559 15:98896836-98896858 ACTTCTGCTCAGATGCTCCAAGG + Exonic
1132273616 15:100547130-100547152 ACTTGTACGCAGGAGTTTCAAGG + Intergenic
1138038344 16:53631755-53631777 GCTTTTACTAAAAAGCTTCTAGG - Intronic
1139264755 16:65628520-65628542 ACTTTTACTAAGTAGCATCTTGG + Intergenic
1140185384 16:72764927-72764949 AATTTTATTCAGACTCTTCATGG - Intergenic
1141170277 16:81686629-81686651 GCCTTTCCTCAGAAGCTTCCAGG + Intronic
1141366547 16:83448844-83448866 ACCTTTGCTCAGAAACTTCTTGG - Intronic
1143123204 17:4622723-4622745 ATTTTCACACAGAAGCTTGAAGG + Intergenic
1146288589 17:31591940-31591962 ACATTTACAGAGAAGCATCAGGG + Intergenic
1149140507 17:53427786-53427808 TCTTCTACTATGAAGCTTCAGGG - Intergenic
1149646350 17:58244383-58244405 ACTTTTACTGAGAGGCTTTCTGG - Intronic
1151957571 17:77388055-77388077 ACTTCTGCCCAGAAGCCTCACGG - Intronic
1152164707 17:78695068-78695090 ACAGTTACTGAGATGCTTCAGGG - Intronic
1152509436 17:80775456-80775478 TCTTCTTCTCAGATGCTTCAGGG + Intronic
1154349691 18:13572650-13572672 AATGTTACTCAGAAGCATGATGG - Intronic
1156167057 18:34434681-34434703 ACTTTTCCTTAGAGCCTTCACGG - Intergenic
1156179359 18:34584951-34584973 CCTTTTCCTCAGAAATTTCAAGG - Intronic
1156386517 18:36610020-36610042 TCTTTCACTCAGAAGTTTCCAGG - Intronic
1156549896 18:38004454-38004476 CCTTTTGGACAGAAGCTTCAGGG + Intergenic
1157256632 18:46145330-46145352 ATATTTCCTTAGAAGCTTCAGGG - Intergenic
1157588577 18:48820757-48820779 GGTTTTACTCAGAAGCAGCAAGG - Intronic
1157930917 18:51822290-51822312 TTTTCTACTAAGAAGCTTCATGG - Intergenic
1158092004 18:53725969-53725991 GGTTTGACTCAGAATCTTCAGGG - Intergenic
1159967869 18:74614242-74614264 ATTTTTATTAAGAATCTTCAGGG + Intronic
1161076338 19:2287598-2287620 ACTTTTGCTCAAAGCCTTCAGGG + Intronic
1162684052 19:12366996-12367018 ATATTTCCTTAGAAGCTTCAGGG + Intergenic
1164030968 19:21404120-21404142 ACTTTTTTTCAGAACTTTCAGGG - Intronic
1165646851 19:37446869-37446891 ACTAATACTCAGAATCTACAAGG + Intronic
1166595215 19:44041784-44041806 ATATTTCCTTAGAAGCTTCAGGG - Intergenic
1166731789 19:45063383-45063405 AGTTTTACTCAAAAGATACATGG - Intronic
1168624584 19:57907261-57907283 TATTTTACTAAGATGCTTCATGG - Exonic
929122119 2:38491963-38491985 TCTTCTACTAAGAATCTTCATGG + Intergenic
929347488 2:40904066-40904088 ACTTTTACTGTGATGCTTCTTGG - Intergenic
929376428 2:41291544-41291566 ACTGCTTCTCAGAAGCTTCTGGG - Intergenic
933517562 2:83324940-83324962 AGATTTACTCAGAAGGATCAAGG - Intergenic
940843413 2:158612034-158612056 CCTTTTACTCAGATTCTTCCAGG - Intronic
940877485 2:158912542-158912564 GCTTTTTCTCAGAAGTTTGAAGG + Intergenic
946369940 2:219274613-219274635 ACTTTGGCTCAGAATCATCAGGG - Intronic
948968532 2:241405009-241405031 ATTTTAACTCAGAAGATTCTAGG + Intronic
1169667816 20:8057958-8057980 ACTTTTAAGCAGAGGCTTAAAGG + Intergenic
1170863747 20:20134214-20134236 AGTTTTACTCAAAAGCTTTGAGG - Intronic
1174269308 20:49355683-49355705 ACATTTACTCAGAATCTACTGGG - Intergenic
1175102714 20:56591090-56591112 ACTTTTACTCAGTAGGTGAAAGG + Intergenic
1175425188 20:58859931-58859953 ACTTTTACTCAAAGACTGCAAGG + Intronic
1176951496 21:15052256-15052278 ACTATTAATCAGAAGCACCATGG - Intronic
1177536704 21:22437591-22437613 CCTTTAACTCAGCTGCTTCAGGG - Intergenic
1178833983 21:36080460-36080482 GCTTTTACACAGATGCTTTAAGG + Intergenic
1179094211 21:38297326-38297348 AGTTTCAAACAGAAGCTTCATGG + Intronic
1179111973 21:38455166-38455188 ACTTTTCTTCAGAAGTTTGAGGG - Intronic
1179265765 21:39801583-39801605 GCTTTTACTTAGTAACTTCATGG - Exonic
949352465 3:3138303-3138325 ATTTTTACTCAGAAATTTAAAGG + Intronic
949584866 3:5427673-5427695 ACTTTTACTAGGAAGAATCAGGG + Intergenic
951713896 3:25617876-25617898 ACTTTTAATCTGAAGTTCCAGGG + Intronic
952855045 3:37763291-37763313 ACCTTTATTCAGAAGTTGCAGGG + Intronic
954907167 3:54072698-54072720 GCTTCTACACAGAGGCTTCAGGG + Intergenic
955109602 3:55935252-55935274 ACTATTACTCAAAAGCTTTCTGG - Intronic
956055105 3:65290354-65290376 ACTGCCACTCACAAGCTTCAAGG + Intergenic
956585858 3:70864027-70864049 ACTTTTATTAAAAAGCTTCCAGG + Intergenic
956859540 3:73308760-73308782 ATTTTTAAACAGAAGCTCCAGGG + Intergenic
956963919 3:74436201-74436223 ACATTTACTAATAATCTTCAAGG + Intronic
957356443 3:79093997-79094019 ACTTTTGGGCAGTAGCTTCAAGG + Intronic
958266129 3:91439305-91439327 ACTGTCACTCAGTTGCTTCAAGG + Intergenic
958547517 3:95573298-95573320 ATATTTCCTTAGAAGCTTCAGGG + Intergenic
963057743 3:141201231-141201253 AATTTTACTCAGAATCTGCTGGG + Intergenic
963403349 3:144831158-144831180 ACTTTTACTCTGAACCTACAAGG - Intergenic
963455564 3:145542184-145542206 ACTTGTATTCAGAATCTACAAGG - Intergenic
964554590 3:157922332-157922354 AATTTTTCTCAGAAGATTTATGG - Intergenic
964635449 3:158853312-158853334 CCTTTTTCTCAGAAGTTTCTGGG - Intergenic
965376802 3:167934878-167934900 ACTCTTACTCTGGAGCTTCCTGG - Intergenic
966228016 3:177619057-177619079 ACTTTGCCTTAGAAACTTCAAGG + Intergenic
966458870 3:180152064-180152086 ACTTTTCCTCAGATACTTGAAGG - Intergenic
967093861 3:186160563-186160585 ACCTTTTCTCAGCAGGTTCATGG + Intronic
967357935 3:188594248-188594270 ATTTTTACCCAGAATCTTGAAGG + Intronic
967406872 3:189126225-189126247 AATTTGACTCAGAAGATACATGG + Intronic
970892116 4:21058841-21058863 ATTTTTAATCAGAAGAATCAGGG - Intronic
972651622 4:41022969-41022991 ACTCTTGCTCAGATGCTACATGG - Intronic
974098678 4:57393424-57393446 AATTTTACTCAAAATCTTCTAGG - Intergenic
974321245 4:60353161-60353183 ACCTTTACTTAGCAGCTTGAAGG + Intergenic
974610835 4:64213713-64213735 ACATTTCCTTAGAAGCTTCAGGG - Intergenic
975151330 4:71024417-71024439 ACATTTAATCAGAAGCTTTCTGG + Intronic
975243933 4:72095807-72095829 TCTTTAACTCAGAAAGTTCACGG + Intronic
977851389 4:101833995-101834017 AATTTTACTAACAATCTTCAGGG - Intronic
980407610 4:132373871-132373893 ACTTCTAGTCAGAAACTTTAAGG - Intergenic
981468967 4:145107719-145107741 TCTTTTACTCAGGTGCTCCAGGG + Intronic
983296916 4:165877983-165878005 ACTTTCACTCAGGAGCTTCTAGG - Intronic
984686105 4:182669959-182669981 GCTTTTACTGAGAAGATTCAGGG - Intronic
987011241 5:13767984-13768006 ACTTTTACTAAGAAAGTTCCAGG - Intronic
989172891 5:38491066-38491088 CCTTTAACACTGAAGCTTCAAGG - Intronic
989535165 5:42555131-42555153 ATTTTTACATAGAAGCTTAAAGG + Intronic
989665152 5:43845686-43845708 ACATTTACAAAGAAGGTTCAAGG - Intergenic
990082976 5:51939797-51939819 ACTGATACTCTGAAGTTTCACGG - Intergenic
992304015 5:75416732-75416754 ACTACTACTCTGAAGCTTTATGG - Intronic
992575264 5:78102317-78102339 CCTGATACTCAGAAACTTCAAGG + Intronic
992770171 5:80040176-80040198 ACTTTTAGTCTGCAGCTTGAAGG - Exonic
993002323 5:82393915-82393937 ACTTTTCCTCAGAACTTTGAAGG - Intergenic
993090055 5:83414296-83414318 ACTTTGACTTAGATGATTCAGGG + Intergenic
993365633 5:87030750-87030772 TGGTTTACTCAGGAGCTTCACGG - Intergenic
994756098 5:103795620-103795642 ATTTTTTTTCAGAAGCTTCAGGG - Intergenic
995586346 5:113652519-113652541 ATATTTCCTTAGAAGCTTCAAGG - Intergenic
995833725 5:116380277-116380299 AAATTTACTCAGAATCTTCTAGG + Intronic
996998825 5:129733417-129733439 ACTAATACTCAGAATCTGCAAGG + Intronic
997402628 5:133613823-133613845 ATTTTTACTCAGAAGGATAAAGG + Intergenic
998892290 5:146759041-146759063 ACTTTTAATTAGATGCTTCCAGG + Intronic
999707777 5:154289732-154289754 ATTTTTACTTAGTAGGTTCAGGG + Intronic
1000150787 5:158498584-158498606 TCTTTTTCTCTGAATCTTCAGGG + Intergenic
1000645294 5:163754359-163754381 ATATTTCCTTAGAAGCTTCAGGG + Intergenic
1002070804 5:176677995-176678017 GCTTCAACTCAGAAGATTCAGGG - Intergenic
1002805890 6:573503-573525 ACTCCTACTCAGCAACTTCAGGG + Intronic
1004668861 6:17776681-17776703 ACTTCTACTCAGCTGCTTCTGGG + Intronic
1004910684 6:20279946-20279968 AATTTTACTTAGACCCTTCAGGG - Intergenic
1005636634 6:27759091-27759113 ATATTTCCTTAGAAGCTTCAGGG + Intergenic
1007192434 6:40030989-40031011 AATTTTATTGAGAAGGTTCAGGG - Intergenic
1007443039 6:41880726-41880748 CCTTTTTCTCAGGAGCTTCTGGG + Intronic
1008654775 6:53600815-53600837 ACTTTTACTCTGTAGCTCCAGGG - Intronic
1008989147 6:57582668-57582690 ACTGTCACTCAGTTGCTTCAAGG - Intronic
1009177680 6:60480909-60480931 ACTGTCACTCAGTTGCTTCAAGG - Intergenic
1009445021 6:63732438-63732460 ATTTTTATTTAGCAGCTTCAAGG + Intronic
1010087858 6:71941717-71941739 AGTTTTACTCAGAAGAATCTGGG - Intronic
1010315885 6:74449741-74449763 ACTAATACTCAGAATCTACAAGG - Intergenic
1012015284 6:93842307-93842329 ACTCAGACTCAGAACCTTCAAGG + Intergenic
1012081596 6:94764885-94764907 AATTTTATTCAGAAACTTAAAGG + Intergenic
1012089974 6:94879538-94879560 GTTTTTACTCAGAATTTTCATGG + Intergenic
1013939211 6:115640749-115640771 ACTTTTAATCAGATGCTTCAGGG + Intergenic
1017039977 6:150300352-150300374 ACTGCTACTGAGAAGCTCCAAGG + Intergenic
1017769945 6:157637246-157637268 ACTCTTCCTCAGGAGCTACAGGG - Intronic
1018652374 6:166003002-166003024 ACTTTTACTCAGTAGTGTCTCGG - Intergenic
1018777023 6:167026983-167027005 ACTTCTGTGCAGAAGCTTCATGG + Intronic
1021073897 7:16276562-16276584 TCTTTTGCTCAAAATCTTCAAGG - Intronic
1021348561 7:19558911-19558933 ACTTTTATAGAAAAGCTTCAAGG + Intergenic
1021385231 7:20021291-20021313 ACTTCTCTTCAGAAGCTTCTAGG - Intergenic
1021387470 7:20049699-20049721 ATTTCTACTCAGTAGCTTCTGGG + Intergenic
1021769285 7:23982833-23982855 ACTTTTTCTGAGAAGCAACATGG + Intergenic
1022501812 7:30886564-30886586 ACTTTGAGTCACAAGCTCCAAGG + Intronic
1024108471 7:46118516-46118538 ACTTTCTCCCAGAAGTTTCATGG + Intergenic
1024610306 7:51058703-51058725 TCATTCACTCAGGAGCTTCATGG + Intronic
1028517298 7:91691947-91691969 TCTTTTACTAGGAAGCTTTATGG - Intergenic
1028809384 7:95067038-95067060 ACTTTTCCTCAGAATTTTTAAGG - Intronic
1030222870 7:107115884-107115906 ACTTCTAGGCAGAAGCTTTAGGG + Intronic
1030255204 7:107502888-107502910 ACTAGTATTCAGAAGCTACAGGG - Intronic
1031448017 7:121878875-121878897 TTTTTTTCTAAGAAGCTTCATGG - Intronic
1031774645 7:125892346-125892368 ACTTATAAGCAGAAGCGTCAAGG - Intergenic
1033995872 7:147346656-147346678 ATTTTATCTCAGAAACTTCAGGG + Intronic
1035550486 8:519907-519929 ATATTTCCTTAGAAGCTTCAGGG - Intronic
1036476953 8:9102168-9102190 ACTTTTTCTAATATGCTTCAAGG + Intronic
1037005501 8:13774618-13774640 AATTTTACTGACAAACTTCAAGG + Intergenic
1038073309 8:24042677-24042699 ATATTTACTCAAAAGGTTCATGG - Intergenic
1038865597 8:31435937-31435959 ATGTTTCCTTAGAAGCTTCAGGG + Intergenic
1040811481 8:51459089-51459111 ACTTACACTGAGAAACTTCACGG - Intronic
1041093217 8:54324010-54324032 ACTGTTACTCAAAATATTCAAGG + Intergenic
1041914271 8:63124525-63124547 ATTTTTACTCTGAAACTGCAAGG + Intergenic
1042704779 8:71654595-71654617 ACTTTTATTGAGCAGCTTCTCGG - Intergenic
1043706915 8:83361560-83361582 ATATTTTCTTAGAAGCTTCAGGG + Intergenic
1044019630 8:87088995-87089017 ACTTTGACTAAGAAGATTTACGG + Intronic
1044357551 8:91241565-91241587 GCTTTTACTGTCAAGCTTCATGG - Intronic
1045376468 8:101579486-101579508 ACCTTTACTAAGTAGCTTCATGG + Intronic
1045737455 8:105313412-105313434 AATTCTACAAAGAAGCTTCAGGG + Intronic
1050779067 9:9307439-9307461 ATCTTTACTCATAAGCTTAAGGG + Intronic
1051499601 9:17762760-17762782 ATTTTTACCCAGAACCTTCTTGG + Intronic
1055070033 9:72156813-72156835 AAGTTTGCTCAGAAGCTTCTAGG + Intronic
1055194189 9:73567047-73567069 CATTTTACTTAGAAACTTCAGGG - Intergenic
1056140666 9:83676305-83676327 CCTTTTACTCAGATACTTAATGG - Intronic
1056981670 9:91318532-91318554 ATGTTTCCTTAGAAGCTTCAGGG + Intronic
1058116988 9:101095593-101095615 ACTTTCACATAAAAGCTTCAGGG + Intronic
1058870567 9:109198277-109198299 ATCTTTCCTCAGAAGCTTCCAGG + Intronic
1059991784 9:119872345-119872367 ACATTTCCTGAGAAGCTTCTAGG + Intergenic
1060715373 9:125922427-125922449 ACTTCTAATCAGAAAATTCAAGG + Intronic
1060867136 9:127009458-127009480 ATTTATACTCACAAACTTCAAGG - Intronic
1186506574 X:10098072-10098094 TGTTCTACTCAGAAGCTCCACGG - Intronic
1186748275 X:12593254-12593276 ATTTTTCCACAGTAGCTTCAGGG + Intronic
1188256884 X:27973563-27973585 ACTTTTACTCAGCTTCTCCAGGG + Intergenic
1188589207 X:31813801-31813823 ACTTGTAGTTAGACGCTTCATGG + Intronic
1189718464 X:43889603-43889625 ACTTATTCTCAAATGCTTCAGGG - Intergenic
1189778492 X:44491495-44491517 GTATTTACTGAGAAGCTTCAGGG + Intergenic
1190149364 X:47930793-47930815 ACTATTCCTCAAAAGCATCAAGG - Intronic
1190888732 X:54551253-54551275 ATCGTTATTCAGAAGCTTCAAGG - Intronic
1191662706 X:63667492-63667514 CCTTTCACCCAAAAGCTTCAAGG + Intronic
1192232901 X:69278165-69278187 TCTTTCGCTCAGAAGCTTCGAGG + Intergenic
1193147945 X:78096738-78096760 ATATTTCCTTAGAAGCTTCAAGG - Intronic
1193394607 X:80968805-80968827 AATTTTCCTCAGAAGCTTGGAGG - Intergenic
1193936382 X:87627145-87627167 ATATTTCCTGAGAAGCTTCAGGG - Intronic
1194723561 X:97368591-97368613 GCTTTTGCTCATTAGCTTCATGG + Intronic
1195950011 X:110260191-110260213 GCTTTTACCCAGATCCTTCAAGG + Intronic
1197550046 X:127880554-127880576 GCTTTAACTCAGAGCCTTCATGG + Intergenic
1198217684 X:134570748-134570770 ACTTGTACTCTGTAGCTTCAAGG - Intronic
1199215827 X:145259498-145259520 ACTTTTCCTCAGAAAGCTCATGG + Intergenic