ID: 1129628454

View in Genome Browser
Species Human (GRCh38)
Location 15:77230877-77230899
Sequence AACCAAATTATGCTTCTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 152}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129628454_1129628457 25 Left 1129628454 15:77230877-77230899 CCAGTAAGAAGCATAATTTGGTT 0: 1
1: 0
2: 2
3: 12
4: 152
Right 1129628457 15:77230925-77230947 AAGTAAAAACCAAAAATTAGGGG 0: 1
1: 0
2: 8
3: 108
4: 1447
1129628454_1129628456 24 Left 1129628454 15:77230877-77230899 CCAGTAAGAAGCATAATTTGGTT 0: 1
1: 0
2: 2
3: 12
4: 152
Right 1129628456 15:77230924-77230946 GAAGTAAAAACCAAAAATTAGGG 0: 1
1: 0
2: 1
3: 72
4: 667
1129628454_1129628455 23 Left 1129628454 15:77230877-77230899 CCAGTAAGAAGCATAATTTGGTT 0: 1
1: 0
2: 2
3: 12
4: 152
Right 1129628455 15:77230923-77230945 AGAAGTAAAAACCAAAAATTAGG 0: 1
1: 0
2: 4
3: 97
4: 1194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129628454 Original CRISPR AACCAAATTATGCTTCTTAC TGG (reversed) Intronic
903083276 1:20830843-20830865 AAAAAAAATAAGCTTCTTACAGG - Intronic
905965529 1:42092275-42092297 AACCAAATTAAACTTATTCCAGG + Intergenic
907804051 1:57800754-57800776 AGCCAAATTATACTGCTAACAGG - Intronic
908126196 1:61032566-61032588 AACCAAACTGTGCTGCTTATGGG - Intronic
908127612 1:61046665-61046687 AAGCAAATTATGCTTCTTTCAGG - Intronic
910540365 1:88348880-88348902 AATCAAATTATGTTTATTATAGG + Intergenic
911269738 1:95786490-95786512 AAGTATATTATGGTTCTTACTGG + Intergenic
912014438 1:105015467-105015489 AAACAAATTATGCTTTTGATGGG - Intergenic
912752811 1:112299509-112299531 AACCAAATGATGATTCTGCCTGG + Intergenic
912888753 1:113504791-113504813 AACAAAATAATGCTTATTAATGG + Intronic
916183838 1:162111977-162111999 ACCCAAATTATGTTCCTAACTGG + Intronic
917949836 1:180020116-180020138 AGCCATATTATGATTCTTCCTGG - Exonic
918758919 1:188375823-188375845 AACCAAATTATGCTTTGTGTGGG + Intergenic
921500756 1:215899889-215899911 GACCACATTATTCTTCTTTCTGG + Intronic
1064921104 10:20519282-20519304 AACAAAATAATGCTTTTTGCAGG - Intergenic
1065414190 10:25466717-25466739 AACAAAATTCTGTTACTTACTGG - Exonic
1066547974 10:36522122-36522144 AAGAAAATAATGGTTCTTACTGG - Intronic
1068339386 10:55682196-55682218 TTGCAAATTATGCATCTTACAGG - Intergenic
1068568427 10:58601647-58601669 AACCAAATTATTCTTCAAAATGG + Intronic
1069363124 10:67666902-67666924 AACCCAATTCTGCTTCTTCTTGG - Intronic
1071422554 10:85515256-85515278 AAACAGATTATGCTTCTTTCAGG + Intergenic
1074643718 10:115419502-115419524 GACCAAACTATGCTGCCTACAGG + Intronic
1081177779 11:39949821-39949843 AACAAGATTATGCTTTTTGCAGG + Intergenic
1084632897 11:70367060-70367082 AACCAAATTCTGCTCCTTGGTGG - Intronic
1085420932 11:76359146-76359168 AAATACATTATGGTTCTTACTGG - Intronic
1088692966 11:112343708-112343730 ACCCAATTTGTGCTTCTTCCTGG + Intergenic
1089835897 11:121370379-121370401 ACCCAAATTATTCTCATTACAGG + Intergenic
1091000636 11:131908233-131908255 AAGAAAATAATTCTTCTTACAGG - Intronic
1091102055 11:132883925-132883947 AAACACATTATGTTTCTCACTGG - Intronic
1092767582 12:11867180-11867202 TACCAAACTAACCTTCTTACGGG - Intronic
1093406711 12:18813353-18813375 CAGTAAATTATGCCTCTTACCGG + Intergenic
1093700034 12:22209906-22209928 AACAAAATAATACTTCTTATGGG - Intronic
1094351863 12:29535398-29535420 GACCTAATTTTGCTTCTTGCTGG + Intronic
1097996440 12:65892822-65892844 AACCAAATGATGCTGCCTCCTGG + Intronic
1098922017 12:76311461-76311483 AACCAATTTTTACTTCTTACTGG + Intergenic
1109551959 13:63915673-63915695 CATCAGATTATGCTTCTTATTGG - Intergenic
1111055042 13:82938247-82938269 AATCAAATGATGCTTTTTCCAGG + Intergenic
1111157181 13:84343141-84343163 AACCAAATAATCATTCTTGCAGG - Intergenic
1111239335 13:85454688-85454710 AAACTACTTATGCTCCTTACTGG - Intergenic
1112373793 13:98819843-98819865 AAACACTTAATGCTTCTTACTGG + Intronic
1112616309 13:101009643-101009665 AAGCAAATTATGCTATATACTGG - Intergenic
1112862034 13:103842611-103842633 AACCACATTATGCTTCATTCAGG - Intergenic
1113050945 13:106211276-106211298 CAACAAATTATACTTCTTTCCGG + Intergenic
1115630853 14:35243681-35243703 AACCTAGTTCTGCTACTTACTGG + Intronic
1115880857 14:37916568-37916590 AGCCAAATGATGCTTCTTAATGG - Intronic
1116140603 14:40988965-40988987 AACCTAATTATGCTTCTTAAAGG - Intergenic
1118357498 14:65026878-65026900 AAACAAAACTTGCTTCTTACTGG + Intronic
1129628454 15:77230877-77230899 AACCAAATTATGCTTCTTACTGG - Intronic
1129960327 15:79678928-79678950 AACCAAAGCATGCTTCCTACAGG + Intergenic
1131314921 15:91327550-91327572 AACCTAATAATGCATCTTAAGGG - Intergenic
1131907944 15:97164539-97164561 AACCAAATCATTCCTCTTTCAGG + Intergenic
1133888935 16:9860133-9860155 ATCCAAAAAATGCTTCTAACAGG + Intronic
1135006607 16:18829361-18829383 CACCAAGTCATGCTTCTTCCAGG + Exonic
1135578616 16:23606024-23606046 AACTAAGATATGCTTCCTACAGG + Intronic
1136984556 16:35086809-35086831 AAGAAAATAATGGTTCTTACTGG + Intergenic
1139002545 16:62530766-62530788 ACGTAAATTATGCTTCCTACTGG - Intergenic
1143210108 17:5179815-5179837 ACACAAATCATGCTTCTGACTGG - Exonic
1143262282 17:5608388-5608410 AACCAAATTGTGGCTCTTCCTGG + Intronic
1144131615 17:12251989-12252011 AACCAAAAGATGCTCATTACAGG + Intergenic
1151885746 17:76922430-76922452 AAACAAATGAAGCTTCTTTCTGG + Intronic
1158676784 18:59527733-59527755 AGCCAAACTAAGCTTCATACTGG - Intronic
1159685986 18:71421405-71421427 AACTATAATATGCTGCTTACAGG + Intergenic
1159843911 18:73436029-73436051 ACCCAAATTATCCTCCTTACTGG + Intergenic
1159917026 18:74197292-74197314 TAGCAAATTAAGCTTCTTATGGG - Intergenic
1159919827 18:74217410-74217432 AACAAAATGTTGCTTGTTACCGG + Intergenic
1164770770 19:30807101-30807123 AAGAAATCTATGCTTCTTACAGG - Intergenic
1165729875 19:38138279-38138301 ATCCAACTTCTACTTCTTACTGG + Intronic
926498223 2:13618065-13618087 AACAAAATGATGTTTCTCACTGG + Intergenic
927147206 2:20174045-20174067 AAAGAAATTCTGCTTCTTCCAGG + Intergenic
930337322 2:50065650-50065672 AACAAAATACTGCTTCTCACTGG - Intronic
931976283 2:67647174-67647196 AATCAAATGATGCTTTTTCCAGG - Intergenic
935284722 2:101554270-101554292 AACCAATTTATACATCTTTCTGG - Intergenic
939367765 2:141256894-141256916 AACCCAAGTATTCTTCTTAAGGG - Intronic
939383854 2:141470720-141470742 AACCAAATAATGAATCATACGGG + Intronic
943408570 2:187518390-187518412 AGCCAAATTAAGCTTCATAAGGG - Intronic
944698459 2:202224466-202224488 AAACAAATTATAATTCTTCCTGG + Intronic
944806707 2:203289014-203289036 TGCCAAATTATGCTTCTGAAAGG + Intronic
945576735 2:211540329-211540351 TACCAGATTATGATTCTTAAAGG - Intronic
948150623 2:235741542-235741564 AATCATAATATGCTTCATACCGG - Intronic
948571956 2:238923211-238923233 AGCCACATTATGCTTTTTAGAGG - Intergenic
1170328545 20:15182960-15182982 AACCAAGTAAAGCTTCTGACTGG - Intronic
1170472658 20:16683731-16683753 AACCAGATTATTATTGTTACGGG - Intergenic
1171011869 20:21513391-21513413 AGCCAAGTTTTGCTACTTACGGG + Exonic
1178087960 21:29131678-29131700 GGCCAAATTATGATTCTAACTGG + Intronic
1178186761 21:30230987-30231009 AAGCAATTTATGGTTTTTACTGG + Intergenic
949688825 3:6610647-6610669 AACCAATTTATCCTTTTTATGGG - Intergenic
949767936 3:7547679-7547701 ATCCAAATTTTGCTACATACTGG - Intronic
951061944 3:18219228-18219250 AATAAAATTCTGCTTCTTACAGG + Intronic
951870808 3:27360055-27360077 TAGCAAGTTATGTTTCTTACAGG - Intronic
953395652 3:42567402-42567424 CACCAAAGTCTGCTTCTTATGGG - Intronic
956647769 3:71473695-71473717 AACCAAATTATGGTTTAAACTGG + Intronic
957433557 3:80145916-80145938 AACCTAATGATGCATCTTAAAGG - Intergenic
961269326 3:125676971-125676993 AACCAATTTATCCTTTTTAAAGG - Intergenic
961629878 3:128288754-128288776 ATCCAAGTTATTCTTCTTAAAGG - Intronic
962338298 3:134558638-134558660 AGCCAAATTCTACTTCTTATGGG - Intronic
962470995 3:135708678-135708700 ATCCAAGTCATGCTTTTTACTGG + Intergenic
962485946 3:135842443-135842465 AACCAAAATAAGCTTGTTAAAGG + Intergenic
963461966 3:145625944-145625966 AACCATATAATGGTTCTTTCAGG - Intergenic
965504857 3:169503625-169503647 AATCAAAATTTGCTTCTTAATGG + Intronic
965810344 3:172585269-172585291 AAGCCAATAATGCTTCTGACTGG - Intergenic
965855898 3:173087773-173087795 AACCAAACTAAGCTTCATAAGGG - Intronic
966125629 3:176572972-176572994 AAGCAAACAATGCTTCTGACTGG + Intergenic
967589456 3:191255986-191256008 ATCCAAAGTTTGCTTCTTTCTGG - Intronic
970036736 4:11744443-11744465 AAGTAAATTATGTTTCTTAATGG + Intergenic
970709335 4:18843332-18843354 AATCAAATGATGCTTTTTCCAGG - Intergenic
971603883 4:28631817-28631839 AACCATATTTTTCTTCTTGCAGG - Intergenic
972019443 4:34292191-34292213 CAGAAAATTATGCTTGTTACAGG + Intergenic
974325611 4:60410828-60410850 TACCAAATTATGTTTATTAGAGG + Intergenic
974475816 4:62378529-62378551 AAGCATATTATCCTTATTACAGG - Intergenic
975104323 4:70550485-70550507 AACCAAACTAAGCTTCATAAGGG + Intergenic
975678612 4:76852581-76852603 CACCAAATTCTGCTTCCTGCTGG + Intergenic
975964856 4:79960275-79960297 AACAAAAGTATGCTTAGTACTGG + Intronic
977004089 4:91543552-91543574 AGCCAAATTAAGCTTCATAAGGG - Intronic
978112793 4:104983135-104983157 AATCAAATTATCCTTCTTTGTGG + Intergenic
979114861 4:116810608-116810630 AACTAAATTATGCTTCATAAGGG - Intergenic
981849668 4:149215036-149215058 ATCAAAATTATGTTTCTTCCTGG + Intergenic
982173865 4:152686770-152686792 AACCACATCATGTTTCTTTCCGG - Intergenic
985030585 4:185785238-185785260 AACCACAGTAAGATTCTTACAGG - Intronic
989174468 5:38509323-38509345 AATCATATTATCCTTCTTAATGG - Intronic
992137289 5:73759945-73759967 AAACAAATCTTGCTTCCTACTGG - Intronic
993260515 5:85652055-85652077 TATCATATTCTGCTTCTTACTGG - Intergenic
993344690 5:86768726-86768748 TATCAAATTAAGCTTCTTCCTGG + Intergenic
993346864 5:86794940-86794962 AACCATATTATGCTTCTCCCAGG - Intergenic
999029865 5:148279530-148279552 AACCAAACTAAGCTTCATAAGGG - Intronic
999958650 5:156729927-156729949 AATGAAATTATACTTCTGACAGG + Intronic
1000494600 5:161965520-161965542 AATAAAATTATGCCTCTTTCAGG + Intergenic
1002950110 6:1801280-1801302 AAGCAAGCTATGCTCCTTACAGG + Intronic
1003180535 6:3787770-3787792 AACCAACTTCTGCTTCTGAGGGG + Intergenic
1003576570 6:7302116-7302138 AATAAAATTATACTTCCTACAGG + Intronic
1004984801 6:21069487-21069509 AACCAAGTAAAGCTTATTACAGG - Intronic
1007880092 6:45155066-45155088 AAACAAAAAATGCATCTTACTGG + Intronic
1008074703 6:47133469-47133491 ACCCAACATTTGCTTCTTACAGG - Intergenic
1008589381 6:52977799-52977821 AACCGAATCCTGCTTCTCACAGG - Intergenic
1012773675 6:103476595-103476617 AAACAAATTATGCTTTTAAAAGG - Intergenic
1012796345 6:103767017-103767039 AACCAAATTACAGTTCTTAATGG + Intergenic
1013968113 6:115980817-115980839 AAACACATTGTGCTTCTCACTGG - Intronic
1016541924 6:145175781-145175803 AACCAAATTATTCTTGTTTTCGG + Intergenic
1020780740 7:12514865-12514887 AAGAAAATTATCCTTCATACAGG - Intergenic
1021004598 7:15378266-15378288 AACCAAATTATTCTTCATATAGG - Intronic
1025115620 7:56255659-56255681 AATCAAATGATGCTTTTTCCAGG + Intergenic
1026200021 7:68206570-68206592 AATCAAATGATGCTTTTTCCAGG + Intergenic
1027982561 7:85244660-85244682 ATCTAAATTATTCTTCTTCCAGG + Intergenic
1028574680 7:92333965-92333987 AACCAATTTATTCTTATTAAAGG + Intronic
1030136069 7:106250425-106250447 AAGAAAATAATGGTTCTTACTGG - Exonic
1031493023 7:122412436-122412458 AACCAAATTATGCTTCTGGTTGG - Intronic
1031908514 7:127488368-127488390 AACCAAATAAGGCTTATTGCAGG + Intergenic
1031946447 7:127846631-127846653 ATCCAAGTTATGCTTCATAAAGG - Intronic
1034044669 7:147915183-147915205 AACCAAACAAAGCATCTTACTGG + Intronic
1039161141 8:34622566-34622588 CACAAAATAGTGCTTCTTACTGG + Intergenic
1041517961 8:58723330-58723352 AACTAAGTTTTGCTTCTTATGGG - Intergenic
1042943923 8:74136223-74136245 AACAAAACTATGCTTCTTCTGGG - Intergenic
1044123504 8:88427718-88427740 AACCTATTTATACTTCTTTCAGG - Intergenic
1046294819 8:112203645-112203667 AACCCAATTATGATTCTGTCCGG - Intergenic
1046819453 8:118620137-118620159 GACAAATTTATACTTCTTACAGG + Intronic
1051859297 9:21606259-21606281 CACCAAATTATTCTTTTTAAGGG - Intergenic
1053526304 9:38833862-38833884 AGCCACATTGTGGTTCTTACTGG - Intergenic
1053901462 9:42799852-42799874 AACCAAATTATGGTACTTATGGG - Intergenic
1054198530 9:62058287-62058309 AGCCACATTGTGGTTCTTACTGG - Intergenic
1054639823 9:67530076-67530098 AGCCACATTGTGGTTCTTACTGG + Intergenic
1188927225 X:36059232-36059254 ATCCAAACCATGCTTTTTACAGG - Intronic
1189121241 X:38397231-38397253 AAATAAATTATGCTTCTAAAGGG - Intronic
1190919171 X:54834618-54834640 AACGAGATTATGTTTTTTACAGG - Intergenic
1191132435 X:57029270-57029292 AGCCAAATTATGTTTCATAAGGG - Intergenic
1194171598 X:90591697-90591719 AAACAAATTATGCTTATTCTGGG - Intergenic
1194929662 X:99870647-99870669 AACCTAATAATGCATCTTAAAGG + Intergenic
1197880566 X:131162659-131162681 AGCCAAATTAAGCTTCATAAGGG - Intergenic
1200517830 Y:4169447-4169469 AAACAAATTATGCTTATTCTGGG - Intergenic