ID: 1129632844

View in Genome Browser
Species Human (GRCh38)
Location 15:77280178-77280200
Sequence GTAAATACACAAAATTAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135495
Summary {0: 1, 1: 25, 2: 1590, 3: 34610, 4: 99269}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129632842_1129632844 3 Left 1129632842 15:77280152-77280174 CCAACATGGTGAAATCTCAGTCT 0: 1
1: 7
2: 162
3: 1856
4: 5825
Right 1129632844 15:77280178-77280200 GTAAATACACAAAATTAGCTGGG 0: 1
1: 25
2: 1590
3: 34610
4: 99269
1129632841_1129632844 8 Left 1129632841 15:77280147-77280169 CCTGGCCAACATGGTGAAATCTC 0: 385
1: 10765
2: 90247
3: 171120
4: 201162
Right 1129632844 15:77280178-77280200 GTAAATACACAAAATTAGCTGGG 0: 1
1: 25
2: 1590
3: 34610
4: 99269
1129632840_1129632844 12 Left 1129632840 15:77280143-77280165 CCAGCCTGGCCAACATGGTGAAA 0: 87987
1: 159650
2: 173325
3: 160643
4: 141633
Right 1129632844 15:77280178-77280200 GTAAATACACAAAATTAGCTGGG 0: 1
1: 25
2: 1590
3: 34610
4: 99269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129632844 Original CRISPR GTAAATACACAAAATTAGCT GGG Intronic
Too many off-targets to display for this crispr