ID: 1129637281

View in Genome Browser
Species Human (GRCh38)
Location 15:77333841-77333863
Sequence AAGGAGTAGCATTATGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 263}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129637281 Original CRISPR AAGGAGTAGCATTATGAAGT TGG (reversed) Intronic
902930319 1:19726505-19726527 CAGGACTAGCATGATGAAGCTGG - Intronic
908595400 1:65683829-65683851 AAGGACTAGCTTTATGAATCTGG + Intergenic
909150603 1:71998466-71998488 AAACAATAGCATTATGAAGCTGG - Intronic
910353787 1:86331314-86331336 AAGGACTTGCTTTATGAATTTGG - Intergenic
911246426 1:95523387-95523409 ACGTAGTAGTATTAAGAAGTGGG + Intergenic
911380611 1:97109389-97109411 AAGCAGTAGCATTTTGAAGGTGG - Intronic
913607956 1:120483186-120483208 AAGGACTTGCATTATGAATCTGG - Intergenic
914208484 1:145556972-145556994 AAGGACTTGCATTATGAATCTGG + Intergenic
914583242 1:149038654-149038676 AAGGACTTGCATTATGAATCTGG + Intronic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
916252095 1:162748487-162748509 AAGGACTTGCTTTATGAATTTGG - Intronic
917710031 1:177675475-177675497 AAGGACTTGCTTTATGAAATTGG + Intergenic
920008816 1:202853034-202853056 CTGGAGAAGGATTATGAAGTAGG - Intergenic
922727480 1:227929476-227929498 AAGTGGTAGCATTAGGAGGTGGG + Intronic
923077422 1:230622580-230622602 AAGAAGTACCATTATTAACTTGG + Intergenic
923909541 1:238425737-238425759 AAAGAGAAGAACTATGAAGTAGG - Intergenic
1063427599 10:5962107-5962129 AAGGAGGAGAATGATCAAGTAGG - Intronic
1063961653 10:11310935-11310957 AAGGGGTAGCATATTGAAGGTGG + Intronic
1064806037 10:19134232-19134254 AACAAATTGCATTATGAAGTAGG + Intronic
1065230465 10:23593440-23593462 AAGGACTTGCTTTATGAATTTGG + Intergenic
1065461854 10:25975345-25975367 GAGGGGTAGCATTAAGCAGTTGG + Intronic
1067490773 10:46699476-46699498 AAGGAGTAGTCTTGAGAAGTAGG - Intergenic
1067603888 10:47640891-47640913 AAGGAGTAGTCTTGAGAAGTAGG + Intergenic
1068126154 10:52844565-52844587 AAGGACTTGCATTATGAATCTGG + Intergenic
1070954783 10:80456417-80456439 AGGAAGTGGCAGTATGAAGTGGG + Intronic
1071748254 10:88445800-88445822 AAGGACTTGCTTTATGAATTTGG - Intronic
1072485906 10:95855092-95855114 AAGGACTTGCTTTATGAATTTGG + Intronic
1074277557 10:112018628-112018650 CAGGAATAGCATCATGACGTTGG + Intergenic
1076665834 10:132091427-132091449 AAGGAGTTGCTTTATGAATCTGG + Intergenic
1077458523 11:2695771-2695793 TAGGAGAAGCATTAGAAAGTAGG - Intronic
1077621150 11:3725200-3725222 TAGGAAGAGCATTAAGAAGTTGG - Exonic
1078796580 11:14598401-14598423 AAGGACTTGCTTTATGAATTTGG + Intronic
1080278693 11:30531748-30531770 ATGGAAGAGCATTATGAGGTAGG - Intronic
1082269221 11:50151325-50151347 AAGGACTTGCTTTATGAATTTGG - Intergenic
1083509528 11:63195090-63195112 AAGGACTAGCTTTATGAATCTGG - Intronic
1083513497 11:63234292-63234314 AAGGACTAGCTTTATGAATCTGG + Intronic
1086117546 11:83268594-83268616 AAGGACTTGCTTTATGAATTTGG - Intronic
1086878262 11:92124209-92124231 AAGGAGGAGCATCCTGGAGTGGG + Intergenic
1087719080 11:101641372-101641394 AAGGACTTGCTTTATGAAGCCGG - Intronic
1088539621 11:110900096-110900118 AAGGAGTAGAATGAGGATGTTGG + Intergenic
1088691117 11:112329262-112329284 AAGGACTTGCTTTATGAATTTGG + Intergenic
1091171740 11:133525945-133525967 AAGGATTATCATTATGATGCAGG - Intronic
1092358090 12:7813539-7813561 AATGAGTAGCTTTATTAAATAGG + Intronic
1092661797 12:10746922-10746944 AAGGAGTTGCTTTATGAATCTGG + Intergenic
1093494559 12:19741159-19741181 AAAGTGTAGCCTTATGAAATAGG - Intergenic
1093522241 12:20064608-20064630 AAGGAGTAGCATTTTTAGGTTGG - Intergenic
1093888861 12:24495309-24495331 AAAGAGAACCAGTATGAAGTAGG + Intergenic
1096044441 12:48550530-48550552 AAGGACTTGCTTTATGAACTTGG + Intergenic
1096954129 12:55508349-55508371 AAGGACTTGCTTTATGAATTTGG + Intergenic
1097325852 12:58276320-58276342 ATGTAGTAGTATTAAGAAGTGGG + Intergenic
1097418102 12:59339186-59339208 AAGGAACTGCATTTTGAAGTTGG + Intergenic
1098421469 12:70302871-70302893 AAGGACTTGCTTTATGAATTTGG + Intronic
1099261511 12:80388306-80388328 AAGGACTTGCTTTATGAATTTGG - Intergenic
1099456221 12:82865497-82865519 AAGGACTTGCTTTATGAATTTGG - Intronic
1099700816 12:86079166-86079188 AAGGAGTAGCATTTGTATGTTGG + Intronic
1100950266 12:99840551-99840573 AAGGGGTAGCATCATGTAGAGGG + Intronic
1105479364 13:20759648-20759670 AAGGAATTGCATTAAAAAGTGGG + Intronic
1107752002 13:43577668-43577690 GAGCAGTAGTATTGTGAAGTGGG - Intronic
1108230683 13:48337334-48337356 AAGGACTTGCTTTATGAATTTGG + Intronic
1109295733 13:60528219-60528241 AAGGAGTAAGATAATGAGGTAGG + Intronic
1111967257 13:94873250-94873272 AAGGACTTGCTTTATGAATTTGG - Intergenic
1112178485 13:97052797-97052819 AAGGACTTGCTTTATGAATTTGG + Intergenic
1113284471 13:108831141-108831163 AAGTGATAGCATTAAGAAGTAGG - Intronic
1113303376 13:109047963-109047985 AAAGAATAACATTATGAAGACGG + Intronic
1115978196 14:39019648-39019670 AAGGACTTGCTTTATGAATTTGG - Intergenic
1116719899 14:48482819-48482841 AAGGACTTGCTTTATGAAGCTGG - Intergenic
1117223138 14:53627405-53627427 AAGAAGGAGCATTATCATGTTGG - Intergenic
1117610073 14:57473997-57474019 AAGAAGTAGCTGGATGAAGTGGG - Intronic
1117784173 14:59265466-59265488 AAGGAGATCCATTATGAAGAAGG + Intronic
1117899482 14:60517013-60517035 ATGCAGTAGTATTAAGAAGTGGG + Intergenic
1118938276 14:70308705-70308727 AAGGACTTGCTTTATGAAGCTGG + Intergenic
1119637041 14:76281975-76281997 AATGAAAAGCATTATGAAGATGG + Intergenic
1120709534 14:87779109-87779131 AAGGACTTGCTTTATGAATTTGG + Intergenic
1121055744 14:90850984-90851006 ATTGACTAGCATTTTGAAGTAGG - Exonic
1121549761 14:94789982-94790004 ATGCAGTAGCATTAAGAGGTGGG + Intergenic
1121826836 14:97017120-97017142 ATGGGCTAACATTATGAAGTTGG + Intergenic
1129637281 15:77333841-77333863 AAGGAGTAGCATTATGAAGTTGG - Intronic
1131191440 15:90320040-90320062 AAGGAGTAGCTCTAAGAAGGAGG - Intergenic
1132188921 15:99831608-99831630 AAGGAGTTGCTTTATGAATCTGG + Intergenic
1132276965 15:100575510-100575532 AAGGAGTTGCTTTATGAATCTGG - Intronic
1133428317 16:5712798-5712820 AAGAAGTAGCATTAAAAACTAGG - Intergenic
1138301939 16:55937735-55937757 AAAGAGAAGAATTATGAAGAAGG - Intronic
1138734266 16:59232118-59232140 AAGGACTTGCTTTATGAAGCTGG - Intergenic
1142935092 17:3323025-3323047 AAGGACTTGCTTTATGAATTTGG + Intergenic
1143745349 17:8989967-8989989 AAGGGGTAGCATTATGATCAGGG + Intergenic
1149240376 17:54641683-54641705 AAGGACTTGCTTTATGAATTTGG - Intergenic
1149250893 17:54767935-54767957 GAGGAGTGGCATTTTGGAGTTGG + Intergenic
1149619637 17:58033767-58033789 AAGTAATAGTATTAAGAAGTAGG + Intergenic
1150956869 17:69868996-69869018 AAGGAGTGGCTTTATGCACTGGG + Intergenic
1155147297 18:23094669-23094691 AAGGATTAGCATGATCAAGTCGG - Intergenic
1156946113 18:42833901-42833923 AAGGATTAGCTTTGTGAAGAGGG + Intronic
1157123191 18:44931594-44931616 AAGGACTTGCTTTATGAAGCTGG + Intronic
1158364816 18:56721855-56721877 AAGGAATAGAAATATGATGTGGG - Intronic
1158413243 18:57226340-57226362 AAGGACTAGCTTTATGAATCTGG - Intergenic
1159140470 18:64388453-64388475 AAGGAGGAGAATTTTGATGTAGG - Intergenic
1159434467 18:68397931-68397953 AGGGAGTAGCATTTTGAATAAGG - Intergenic
1165763277 19:38335221-38335243 AAGGAGTAGAATTTTGGGGTAGG + Intergenic
1166814063 19:45531509-45531531 GAGGAGGAGCAGTATGAAGGAGG - Intronic
1168262056 19:55200990-55201012 ATGGAATAGCATTAAGAGGTAGG + Intronic
926874392 2:17458518-17458540 AGGAAGAAGCATTATGAAGATGG + Intergenic
930147631 2:48023546-48023568 AGGGAGAAGCCTTAGGAAGTGGG + Intergenic
932043408 2:68322975-68322997 AAGCAATAGTATTAAGAAGTGGG + Intergenic
933180272 2:79218529-79218551 AAGGAGTAGCAGTAGGGACTCGG + Intronic
934895364 2:98114801-98114823 AAGGAGTAGGACTATGTTGTAGG + Intronic
935611094 2:105026103-105026125 AATGAGAAACATTCTGAAGTGGG - Intergenic
935838385 2:107079939-107079961 AAGAAGTAGCAATATGCACTCGG + Intergenic
936601018 2:113894386-113894408 AAGAAATAGCATTATTAAGCCGG - Intronic
937605967 2:123802210-123802232 AAGGACTTGCTTTATGAATTTGG + Intergenic
941971222 2:171353617-171353639 AAGGACTTGCTTTATGAATTTGG + Intronic
942392107 2:175505948-175505970 AAGGACTTGCTTTATGAATTTGG - Intergenic
943549554 2:189321652-189321674 AAGGACTTGCTTTATGAAGCTGG - Intergenic
944322598 2:198365474-198365496 AAGGAGAAAAATTATGAAGTAGG + Intronic
944874955 2:203953620-203953642 CAGGATTAGCATTATGCAGGAGG - Intronic
945155417 2:206832612-206832634 AAGGAGTAGGAGGATGAATTTGG - Intergenic
945776463 2:214112466-214112488 AAGGACTTGCTTTATGAATTTGG + Intronic
946696623 2:222366376-222366398 AAGGAGTTGCTTTATGAATCTGG + Intergenic
946786911 2:223257039-223257061 AAGGATTTGCATTATGAATCTGG + Intergenic
1170595184 20:17799982-17800004 AAGCAGTAGCCAAATGAAGTGGG + Intergenic
1172412515 20:34735770-34735792 AGGATGTAGCATTCTGAAGTAGG + Intronic
1176369306 21:6052843-6052865 AAGCAGTGGCATTAGGAGGTGGG + Intergenic
1177158264 21:17520793-17520815 AATGAGTAGCATGAAAAAGTTGG + Intronic
1177240789 21:18454433-18454455 AAGGAGATTCATTATGAAATTGG + Intronic
1179754213 21:43485698-43485720 AAGCAGTGGCATTAGGAGGTGGG - Intergenic
1179829605 21:43988332-43988354 AAGGGGCAGCGTTAGGAAGTGGG + Intergenic
1182197262 22:28531395-28531417 AAGGACTTGCTTTATGAATTTGG - Intronic
1183334300 22:37237852-37237874 AAGGAGCAGCAAGATGAAGTCGG + Intronic
949687191 3:6589248-6589270 AAGGATTTGCTTTATGAATTTGG - Intergenic
950206622 3:11085742-11085764 AAGGGATACCATTATGAAGCTGG - Intergenic
950862515 3:16162498-16162520 AAGGAGTTGCTTTATGAATCTGG + Intergenic
952023823 3:29055267-29055289 AAGGACTTGCTTTATGAATTTGG + Intergenic
952989770 3:38821586-38821608 AAGGAGAATCATTTTGGAGTGGG - Intergenic
953166356 3:40468656-40468678 AAGACGTAGTATTATGAAGACGG - Intergenic
953837883 3:46362788-46362810 ATGGACTAGCATTGAGAAGTGGG + Intergenic
954112937 3:48445900-48445922 AAGGAGCAGCAATTTGAGGTGGG - Intergenic
954836986 3:53478515-53478537 AGGGAATAGCATTAAGAAGCAGG + Intergenic
956451615 3:69380533-69380555 AAGCAGCCGCATTATGAAATAGG - Intronic
958999765 3:100949792-100949814 AAGGAGTGGCGTTTTGAAGAAGG + Intronic
959688101 3:109169577-109169599 AATGAGTTGCATTTTGAAGTAGG - Intergenic
959932681 3:112000559-112000581 AAGGAGCAGCATTAGGAATGGGG + Intronic
960206232 3:114903116-114903138 AAGCAGTAGAGTTATGAGGTAGG + Intronic
960979273 3:123206646-123206668 AAGCAGTAGCATGAAAAAGTTGG - Intronic
961415209 3:126752077-126752099 TAGGACTAGCATTTTGAAATTGG + Intronic
961961771 3:130862873-130862895 TAGGAGTAGAATTGTGAAGGAGG + Intronic
962090409 3:132238628-132238650 AAGGAAGATCAATATGAAGTGGG - Intronic
962099972 3:132331653-132331675 ATGGAGCAGCATTATGAACTTGG + Exonic
962493454 3:135916338-135916360 GAGAAGTAGCAGTTTGAAGTAGG - Intergenic
962687470 3:137861398-137861420 ATGGAGTAGCATTCTGAATGTGG - Intergenic
963307099 3:143664821-143664843 AAGGACTTGCTTTATGAAGCTGG - Intronic
964516592 3:157516096-157516118 AAGGAGAATCTTTATGAACTTGG - Intronic
964681072 3:159339462-159339484 AAGAAGTTTCATTAAGAAGTGGG + Intronic
965965174 3:174480427-174480449 AAAGAGTAGCCTTTTGAAGCAGG - Intronic
965971836 3:174568027-174568049 AAACAGTAGAATTATGATGTAGG + Intronic
966157041 3:176927757-176927779 AAGGAGAAGCATTAAAAAGGAGG - Intergenic
967643155 3:191892745-191892767 AAGCAGAAGAATTATGAATTTGG - Intergenic
970688992 4:18600781-18600803 AAGGACTTGCTTTATGAATTTGG + Intergenic
973579072 4:52323442-52323464 AAGGACTTGCTTTATGAAGCTGG + Intergenic
974141065 4:57887362-57887384 AAGGACTTGCTTTATGAATTTGG - Intergenic
974654552 4:64801946-64801968 AAGGAGTTGCTTTATGAATCTGG - Intergenic
975560738 4:75706055-75706077 AAGGAGTGACACTATGAGGTTGG + Intronic
976318523 4:83685405-83685427 AAGGGATGGCATTATGAGGTGGG - Intergenic
980343387 4:131581421-131581443 AAGAAATAGCATTATGATTTGGG - Intergenic
981005530 4:139871231-139871253 AAGGAGTAACAGTGTGAATTTGG - Intronic
986988683 5:13527013-13527035 ATGCAGTAGCATTTGGAAGTGGG - Intergenic
989349689 5:40472392-40472414 AAGGACTAGCTTTATGAATCTGG + Intergenic
989357844 5:40565037-40565059 AAGGACTTGCTTTATGAAGCTGG + Intergenic
989517041 5:42355655-42355677 AAGGACTTGCTTTATGAAGCTGG - Intergenic
989847213 5:46159781-46159803 AAGGAGTTGCTTTATGAATCTGG + Intergenic
990282367 5:54264801-54264823 AGGAAGTTGCATTATGAAATAGG - Intronic
990354497 5:54952628-54952650 AAGGTGTAGGTTTATGAAGTAGG + Intergenic
990384593 5:55247463-55247485 AAGGAGTAGTAGTGGGAAGTGGG + Intergenic
990517649 5:56545142-56545164 AAGGGGAAGCATTCTGAAATAGG - Intronic
991627954 5:68624116-68624138 AAGGACTTGCATTATGAATCTGG + Intergenic
992202109 5:74394972-74394994 AAGGCCTGGCCTTATGAAGTAGG - Intergenic
992277341 5:75133501-75133523 AAGGAGTTGCTTTATGAATCTGG - Intronic
992287819 5:75253642-75253664 AAGGAGTTGCTTTATGAATTTGG + Intergenic
992873732 5:81031136-81031158 AAGGAGTTGCTTTATGAATCTGG - Intronic
992876044 5:81056783-81056805 AAGGAGTTGCTTTATGAATCTGG + Intronic
993026279 5:82650799-82650821 AAGGAGCAGGACAATGAAGTAGG - Intergenic
993206371 5:84885469-84885491 AGGGAGTAGCATTTTGAATTTGG - Intergenic
993528061 5:88991079-88991101 AAGGACTTGCTTTATGAATTTGG + Intergenic
993711046 5:91225709-91225731 AAGGAGTGTCATTTTTAAGTAGG + Intergenic
995015632 5:107305878-107305900 AACAAGTAGCATTTTGAATTTGG - Intergenic
995697381 5:114894902-114894924 AAGGACTTGCTTTATGAATTTGG + Intergenic
996100636 5:119441515-119441537 AAGGACTAGCTTTATGAATCTGG - Intergenic
996248305 5:121293606-121293628 AAGAAGTAGAATTATGATCTAGG + Intergenic
997109549 5:131059736-131059758 AAAGAGTAATATTAAGAAGTAGG - Intergenic
998951811 5:147400484-147400506 AAGGCCTAGCATTCTGAAGGAGG - Intronic
999852556 5:155558624-155558646 TAGTAGTATCTTTATGAAGTAGG + Intergenic
1000238911 5:159390698-159390720 ATGGAGAAGAACTATGAAGTGGG + Intergenic
1000855359 5:166391275-166391297 ATGGAGTAAAATAATGAAGTGGG + Intergenic
1001918552 5:175582199-175582221 AAAGTGGAGCATCATGAAGTAGG - Intergenic
1002657276 5:180760324-180760346 AAGGACTTGCATTATGAATCTGG + Intergenic
1005484551 6:26287088-26287110 AATGAGTTGCATTTTGAGGTGGG + Intergenic
1005745424 6:28832659-28832681 AAGGAGTGGTATTAAGAACTCGG + Intergenic
1005947520 6:30605131-30605153 CAGGTGTAGGATTATGAAGGAGG - Intronic
1006027401 6:31156205-31156227 AAGAAGCAGCATGATGAAGAAGG - Intronic
1007155512 6:39738873-39738895 AAGGACTTGCTTTATGAATTTGG - Intergenic
1007490106 6:42214173-42214195 TAGCAGTACCAATATGAAGTGGG - Exonic
1007919070 6:45589720-45589742 AAGGAGTATCATTATAAGGAGGG - Intronic
1009191317 6:60633443-60633465 AAGGAGTTGCTTTATGAATCTGG + Intergenic
1009246972 6:61250709-61250731 AAGGACTTGCTTTATGAATTTGG + Intergenic
1009502154 6:64427800-64427822 AAGAAGTAACACAATGAAGTAGG + Intronic
1010088968 6:71956622-71956644 AAGAAATAGCTGTATGAAGTCGG - Intronic
1011452316 6:87506891-87506913 ATGGAGTAGGATCATGAGGTGGG + Intronic
1011758386 6:90529494-90529516 AAGTAGTAGCAGTAAGAAGTTGG + Intronic
1011876489 6:91968256-91968278 AATGAGTAGAATTATGAGTTTGG - Intergenic
1013882882 6:114926853-114926875 AAGGAGTTGCTTTATGAATCTGG + Intergenic
1014560388 6:122882964-122882986 AAGAAGTTGCTTTATGAAGCTGG + Intergenic
1014938364 6:127410590-127410612 AAGGACTTGCTTTATGAAGCTGG + Intergenic
1016655407 6:146513310-146513332 AAGGACTTGCTTTATGAAGCTGG + Intergenic
1017447039 6:154516569-154516591 AAGAAGGTGCTTTATGAAGTGGG - Intergenic
1017618654 6:156272631-156272653 AAGGAGCAGTATGATGAAGTAGG + Intergenic
1019372472 7:670261-670283 AGGGAGGAGGAATATGAAGTGGG - Intronic
1021216580 7:17923398-17923420 AAGGTGTAACATTAGGAAGGTGG + Intronic
1021938864 7:25659309-25659331 AAGGAGTATCATTATAATCTTGG + Intergenic
1022133816 7:27428674-27428696 AAGGATTAGCTTTATAAATTAGG - Intergenic
1022626237 7:32039312-32039334 AAGATGTAGGATTATGAATTTGG + Intronic
1022836748 7:34124473-34124495 ATGGATTAGCATTGTGAAGTGGG + Intronic
1023632725 7:42179834-42179856 AAGGTGTAGCAGCCTGAAGTGGG + Intronic
1024634565 7:51276516-51276538 AAGGACTGGCATTATCAAGAGGG - Intronic
1028312014 7:89350464-89350486 ATGGAGAAGCATTAAGAATTAGG + Intergenic
1029048800 7:97661202-97661224 AAGGAATTGCATTTTAAAGTTGG - Intergenic
1029814366 7:103077898-103077920 AAGGAGTAGCTTCAGGAAGAAGG - Intronic
1030141935 7:106313223-106313245 AAACAGTAGCATTAGGAAGAAGG - Intergenic
1030540348 7:110822803-110822825 AAGAAGTAACATTTTGAAATAGG - Intronic
1030691944 7:112545104-112545126 AAGAACTAGCTTTATGAAGCTGG + Intergenic
1030890506 7:114994004-114994026 AAGGAGTTGCTTTATGAATCTGG + Intronic
1031222156 7:118981679-118981701 AAGGTTTAGCATTAAAAAGTTGG + Intergenic
1033852366 7:145513142-145513164 AAGGATTAGGATTAGAAAGTTGG - Intergenic
1036976099 8:13414560-13414582 AAAGAATAGCATTATGACCTTGG + Intronic
1037197349 8:16206611-16206633 AAGGAGTTGCTTTATGAATCTGG - Intronic
1038846478 8:31234919-31234941 AAGGACTTGCTTTATGAATTTGG + Intergenic
1040509316 8:48080032-48080054 AAGCATTCGTATTATGAAGTGGG - Intergenic
1041706840 8:60855481-60855503 AAAGTTCAGCATTATGAAGTGGG - Intronic
1042205828 8:66328844-66328866 AAGGGGCAGCATCAGGAAGTTGG - Intergenic
1042541347 8:69910006-69910028 AAGGACTTGCTTTATGAATTTGG - Intergenic
1042689425 8:71481195-71481217 AAGTAGTAACATAATAAAGTTGG + Intronic
1043602778 8:81961207-81961229 ATGGAACAGCCTTATGAAGTAGG + Intergenic
1043656835 8:82677643-82677665 AATTAGTAGCATTTTGAAGAGGG - Intergenic
1044292522 8:90489663-90489685 AAGGAGTTGCTTTATGAATCTGG + Intergenic
1044596794 8:93967485-93967507 AAGGACTTGCTTTATGAATTTGG + Intergenic
1045293663 8:100854789-100854811 AAGGACTTGCTTTATGAACTGGG - Intergenic
1045954274 8:107888806-107888828 CAAGAGTGGCATTATAAAGTTGG + Intergenic
1046276996 8:111974722-111974744 AAAGAGTAGCATCATTAATTTGG + Intergenic
1046869826 8:119193488-119193510 AGGGAGAAGCATTTTGAAGCAGG + Intronic
1048115137 8:131512624-131512646 AAGGAGTGGCATGATACAGTGGG - Intergenic
1049059522 8:140265235-140265257 AAATAGTAGCATTCTGAAGGTGG - Intronic
1050509475 9:6378742-6378764 AAGGAGTTGCTTTATGAATCTGG - Intergenic
1056066296 9:82938936-82938958 AAGGAGTAGAAGAATGATGTAGG - Intergenic
1056862109 9:90194660-90194682 AAGGACTAGCTTTATGAATCTGG - Intergenic
1056909846 9:90688741-90688763 AAGGACTAGCTTTATGAATCTGG - Intergenic
1057611997 9:96553012-96553034 AATGTGAAGCATTCTGAAGTTGG + Intronic
1058917278 9:109579830-109579852 AAGGAGGGGCATTTTCAAGTTGG - Intergenic
1059508551 9:114822371-114822393 AAAGAGTAGCATAAGGAGGTGGG + Intergenic
1190195047 X:48310025-48310047 AAGGAATAGCATTATGATGATGG - Intergenic
1190494535 X:51016310-51016332 AAGGACTTGCTTTATGAATTTGG + Intergenic
1190661478 X:52658248-52658270 AAGGGATAGCATTATGATGATGG - Intronic
1190922145 X:54863895-54863917 AAGGACTTGCTTTATGAAATTGG - Intergenic
1191049442 X:56175753-56175775 AAGGAGTTGCTTTATGAATCTGG + Intergenic
1191081103 X:56510455-56510477 AAGGACTTGCTTTATGAATTTGG - Intergenic
1191203372 X:57808688-57808710 AAGGACTTGCATTATGAATATGG + Intergenic
1191821003 X:65308474-65308496 AAGGAGTTGCTTTATGAATCTGG - Intergenic
1192010674 X:67268894-67268916 AAGGACTTGCTTTATGAATTTGG - Intergenic
1192027716 X:67472740-67472762 AAGGACTTGCATTATGAATCTGG + Intergenic
1192675109 X:73187317-73187339 AAGGACTTGCTTTATGAATTTGG - Intergenic
1192709572 X:73565720-73565742 AAGTAATATCCTTATGAAGTAGG + Intronic
1192993343 X:76486197-76486219 AAGGACTAGCTTTATGAATCTGG + Intergenic
1193071155 X:77306916-77306938 AAGGACTTGCTTTATGAAGCTGG - Intergenic
1193182044 X:78469881-78469903 AAGGACTTGCTTTATGAATTTGG + Intergenic
1193926774 X:87496614-87496636 ATGTAATAGTATTATGAAGTGGG + Intergenic
1194148364 X:90290416-90290438 AAGGAGTGGCAATTTGAAGCAGG - Intergenic
1194958811 X:100212441-100212463 AAGGACTTGCTTTATGAATTTGG + Intergenic
1195572254 X:106409486-106409508 AAGGACTTGCTTTATGAATTTGG - Intergenic
1195784240 X:108501263-108501285 AAGGAGCAGCATTATGGATTAGG - Intronic
1195901767 X:109805875-109805897 AAGAAGGATCATTATAAAGTAGG - Intergenic
1196112834 X:111965310-111965332 AAGGACTTGCTTTATGAATTTGG - Intronic
1199742433 X:150748178-150748200 AAGGTGTAGTATGAGGAAGTGGG - Intronic
1201351813 Y:13052166-13052188 AAGGAATATCATGATTAAGTAGG - Intergenic
1201561263 Y:15319955-15319977 AAGGACTTGCTTTATGAATTTGG + Intergenic