ID: 1129643829

View in Genome Browser
Species Human (GRCh38)
Location 15:77411780-77411802
Sequence CTTTTTGTAAAGATGGGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1218
Summary {0: 1, 1: 0, 2: 22, 3: 206, 4: 989}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129643822_1129643829 4 Left 1129643822 15:77411753-77411775 CCAGCACACCCAGCTAATACTTT 0: 2
1: 18
2: 474
3: 12239
4: 63064
Right 1129643829 15:77411780-77411802 CTTTTTGTAAAGATGGGGGTTGG 0: 1
1: 0
2: 22
3: 206
4: 989
1129643824_1129643829 -5 Left 1129643824 15:77411762-77411784 CCAGCTAATACTTTTTTACTTTT 0: 2
1: 2
2: 66
3: 1913
4: 27745
Right 1129643829 15:77411780-77411802 CTTTTTGTAAAGATGGGGGTTGG 0: 1
1: 0
2: 22
3: 206
4: 989
1129643823_1129643829 -4 Left 1129643823 15:77411761-77411783 CCCAGCTAATACTTTTTTACTTT 0: 2
1: 1
2: 43
3: 1322
4: 18478
Right 1129643829 15:77411780-77411802 CTTTTTGTAAAGATGGGGGTTGG 0: 1
1: 0
2: 22
3: 206
4: 989

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129643829 Original CRISPR CTTTTTGTAAAGATGGGGGT TGG Intronic
900255165 1:1694110-1694132 TTTTTAGTAGAGATGGGGGGGGG - Intronic
900287363 1:1908177-1908199 TTTTTTGTAGAGTTGTGGGTGGG + Intergenic
900999017 1:6138196-6138218 TTTTTAGTAGAGATGGGGTTTGG - Intronic
901246485 1:7735948-7735970 TTTTTAGTAGAGATGGGGTTAGG + Intronic
901287365 1:8091549-8091571 TTTTTTGCAGAGATGGGGTTTGG + Intergenic
901358467 1:8673851-8673873 GTTTTTGTAGAGATGGGATTTGG - Intronic
901503186 1:9666667-9666689 AATTTTGTAGAGATGGGGGAGGG - Intronic
901560020 1:10062777-10062799 TTTTTAGTAAAGATGGGGTTTGG - Intronic
901675967 1:10885127-10885149 TTTTCTGTAGAGATGGGGTTTGG + Intergenic
901885506 1:12220135-12220157 TTTTTTGTAGAGATGGGTGGGGG - Intergenic
902352169 1:15864852-15864874 TTTTTAGTAGAGAAGGGGGTAGG + Intronic
902398426 1:16144695-16144717 CTCATTTTACAGATGGGGGTGGG + Intronic
902590901 1:17473762-17473784 TTTTTTGTAGAGATGGGGTCTGG + Intergenic
903041303 1:20532801-20532823 TTTTTAGTAGAGATGGGGGGGGG - Intergenic
903080337 1:20805936-20805958 ATTTTTATAAAAGTGGGGGTGGG - Intergenic
903209176 1:21806654-21806676 TTTTTTGTAGAGATGGGGTTTGG + Intergenic
903230425 1:21919023-21919045 CTTTGGGGAAAGATGGGGGCAGG - Intronic
903250452 1:22049566-22049588 TTTTTTGTAGAGATGGGTGGGGG + Intergenic
903452530 1:23464162-23464184 TTTTTGGTATAGATCGGGGTGGG - Intronic
903704618 1:25276518-25276540 TTTTTTTTAGAGATGGGGGGGGG - Intronic
903812186 1:26040918-26040940 ATGTTTGTAGAGATGGGGGGGGG - Intronic
903893780 1:26588748-26588770 ATTTTAGTACAGATGGGGTTTGG + Intergenic
903975564 1:27147634-27147656 GTTTTTTTAGAGATGGGGGATGG - Intronic
904118872 1:28182494-28182516 GTTTTTGTAAAGATGGAGTCTGG - Intronic
904239957 1:29137609-29137631 TTTTTAGTACAGATGGGGTTTGG + Intergenic
904257354 1:29263160-29263182 TTTTTAGTAGAGATGGGGTTTGG + Intronic
904638753 1:31905356-31905378 TTTTTTGTCAAGTTGGGGTTTGG + Intergenic
904740504 1:32671714-32671736 ATTTGTGTAGAGATGGGGTTAGG - Intronic
904915461 1:33967260-33967282 TTTTTTTTAAAGCGGGGGGTGGG + Intronic
905027045 1:34857793-34857815 ATTTTTCCACAGATGGGGGTTGG + Intronic
905568211 1:38982968-38982990 TTTTTAGTAGAGATGGGGTTTGG - Intergenic
905572910 1:39020257-39020279 TTTTTAGTAGAGATGGGGTTTGG + Intergenic
905998259 1:42401034-42401056 ATTTTTCCACAGATGGGGGTGGG + Intronic
906575323 1:46884279-46884301 TTTTTAGTAGAGATGGGGTTTGG + Intergenic
906596656 1:47083616-47083638 TTTTTAGTAGAGATGGGGTTTGG - Intronic
907050835 1:51329299-51329321 GTATTTGTAAAGCTGGAGGTTGG - Intronic
907198978 1:52709849-52709871 TTTTTAGTAGAGATGGGGTTTGG + Intergenic
907200165 1:52719721-52719743 CTTTTTGTACAGACGGGGTCTGG - Intergenic
907396442 1:54193661-54193683 CTTTTTATAAAGATAGAGATGGG - Intronic
907411116 1:54283989-54284011 CTTTTTTTAAAAATGGGGTAAGG + Intronic
907504044 1:54904215-54904237 TTTTTTGTACAGATGGGGTCAGG + Intergenic
908036640 1:60061759-60061781 TTTTTGGTAGAGATGGGGTTTGG - Intronic
908184083 1:61634884-61634906 TTTTTTGTAGAAATGGGGGTTGG - Intergenic
908375801 1:63539277-63539299 ATTTTTTTAAAGCTGGGGGTAGG + Intronic
908538347 1:65099668-65099690 TGTTTTGTAGAGATGGGGTTTGG - Intergenic
908753645 1:67447850-67447872 TTTTTAGTAGAGATGGGGTTTGG + Intergenic
909040409 1:70642808-70642830 TTTATTGTAGAGAAGGGGGTTGG - Intergenic
909451031 1:75797766-75797788 CTTTTAGTAGAGATAGGGGATGG - Intronic
909629241 1:77753414-77753436 TTTTTTGTAAAGATGGGGGGTGG - Intronic
909643496 1:77891903-77891925 TTTTTTGTAGAGATGGGGGTGGG - Intronic
909672282 1:78202953-78202975 TTTTTTGTAGAGATGGGGTCTGG + Intergenic
910027394 1:82672254-82672276 CTTTTTGTGAAAAGGAGGGTAGG + Intergenic
910434580 1:87192188-87192210 AGTTTTATAAAAATGGGGGTGGG - Intergenic
910455109 1:87389542-87389564 TTTTTAGTAAAGATGGGTTTAGG - Intergenic
910577267 1:88778890-88778912 TTTTTAGTAGAGACGGGGGTGGG + Intronic
910711391 1:90185986-90186008 GTTTTTGTGTAGATGGGGGTGGG + Intergenic
910862034 1:91751153-91751175 TTTTTTCTAAACATGGGGGTGGG + Intronic
911346094 1:96698461-96698483 CTTTTTGAAGAGGTGGGGTTTGG + Intergenic
911552423 1:99299656-99299678 CTTTTTGTAAAGTTTGAGGAGGG + Intronic
911750622 1:101492923-101492945 ATTTTTGTAGAGATGGCGGGTGG + Intergenic
911757911 1:101581953-101581975 CTTTTTGTCAAAAGGGGAGTTGG - Intergenic
912399536 1:109378057-109378079 CTTTTTGTAGCGATGGGGGCGGG - Intronic
912878729 1:113388955-113388977 CATTTTGCAAAGATGTGGGCAGG - Intergenic
912880341 1:113406114-113406136 ATTTTTTTAAAGATGGGGTTTGG - Intronic
913214692 1:116610575-116610597 CCTTTGGTTAGGATGGGGGTAGG - Intronic
913331368 1:117670928-117670950 CTTTTTGAAATGATGAGAGTAGG + Intergenic
913403687 1:118464181-118464203 CTTTTTTGAAAAATGGGGGGGGG - Intergenic
913489819 1:119368450-119368472 CTTTTTGTGGTGATGGGGTTGGG - Intergenic
914046287 1:144095734-144095756 TTTTTAGTAGAGATGGGGTTTGG - Intergenic
914094839 1:144536126-144536148 TTTTTAGTAGAGATGGGGTTTGG - Intergenic
914131823 1:144864952-144864974 TTTTTAGTAGAGATGGGGTTTGG + Intergenic
914763159 1:150615416-150615438 CTTTTTTAAGAGATGGGGTTTGG + Intronic
914842201 1:151257741-151257763 TTTTTAGTAAAGATGGGGTTTGG + Intronic
914860939 1:151385649-151385671 TTTTTTGTAGAGATGGTGGCTGG + Intergenic
915136551 1:153735898-153735920 GTTTTTGTAGAGATGGGGTTGGG + Intronic
915309170 1:154998742-154998764 TTTTTTTTAAAGACGGGGTTTGG + Intergenic
915423730 1:155806459-155806481 TTTTTTGTAGAGATGGGGGTGGG + Intronic
915624569 1:157106806-157106828 GTTCTTGTTAAGATTGGGGTTGG - Intergenic
915749582 1:158193535-158193557 TTTTTCATAAAGATGGGGTTTGG + Intergenic
915959316 1:160251641-160251663 TTTTTTGTAGAGATGGTGGTGGG + Intronic
917435522 1:175017230-175017252 TTTTTAGTAGAGATGGGGTTTGG + Intronic
919305465 1:195828898-195828920 CTTAAAGTAAAGGTGGGGGTGGG + Intergenic
919452366 1:197787499-197787521 CTTTGTTAAAAGATGGGAGTAGG - Intergenic
919615278 1:199799501-199799523 ATTTTTCTACAGATAGGGGTTGG - Intergenic
919619171 1:199846006-199846028 TTTTTAGTAGAGATGGGGTTTGG + Intergenic
919648387 1:200119802-200119824 TTTTTAGTAGAGATGGGGTTTGG + Intronic
919741456 1:200983704-200983726 CTTTTTGGAAGGATTGGGGCAGG - Intronic
919868238 1:201800176-201800198 TTTTTAGTAGAGATGGGGTTTGG + Intronic
919875221 1:201860986-201861008 TTTTTAGTAGAGATGGGGTTAGG - Intronic
920322827 1:205137721-205137743 TTTTTAGTAGAGATGGGGTTTGG + Intergenic
920578613 1:207083363-207083385 ATTTTTGTAGAGATGGGTGGGGG - Intronic
920620515 1:207541964-207541986 TTTTTAGTAGAGATGGGGTTTGG - Intronic
920622297 1:207560521-207560543 TTTTTAGTAGAGATGGGGTTTGG - Intronic
920623915 1:207577590-207577612 TTTTTAGTAGAGATGGGGTTTGG - Intronic
920827721 1:209437443-209437465 TTTTTAGTAGAGATGGGGTTTGG + Intergenic
921458032 1:215395284-215395306 TTTTTAGTAGAGATGGGGGACGG + Intergenic
921869855 1:220128229-220128251 ATTTTGGTACATATGGGGGTGGG + Intronic
922016670 1:221655229-221655251 CAATTTTTAAAGATGGGCGTTGG - Intergenic
922063639 1:222115334-222115356 CTTTTGGTACAGATGGGGTCTGG + Intergenic
922091432 1:222399149-222399171 CTGTTTGAAAAGCTGTGGGTGGG - Intergenic
922137791 1:222848857-222848879 ATTTTTCTAAATATGGGGATGGG + Intergenic
922174723 1:223188624-223188646 TTTGTTGGAAAGATGGTGGTGGG + Intergenic
922301632 1:224306652-224306674 TTTTTTGTAGAGATGGCGTTTGG - Intronic
922324206 1:224513328-224513350 ATTTTTGTAGAGTTGGGGGTGGG + Intronic
922431661 1:225560667-225560689 GTTTTTATAAATATTGGGGTGGG + Intronic
922493800 1:226040285-226040307 TTTTTAGTAGAGATGGGGTTTGG + Intergenic
922591142 1:226778153-226778175 TTTTTTGTAGAGGTGGGGTTTGG - Intergenic
922781417 1:228256049-228256071 ATTTTTCCACAGATGGGGGTTGG - Intronic
922912382 1:229228529-229228551 TTTTTTGTACATATAGGGGTGGG - Intergenic
923133085 1:231094266-231094288 CTTTTTTTAAATTTAGGGGTGGG - Intergenic
923164492 1:231346763-231346785 ATTTTAGTAGAGATGGGGTTTGG - Intronic
923501982 1:234572696-234572718 TTTTTAGTAGAGACGGGGGTTGG - Intergenic
923780034 1:237013968-237013990 TTTTTTGTAGATATGGAGGTGGG - Intergenic
923789033 1:237095410-237095432 CTTTTTGTAAATACGTGGGAGGG - Intronic
923883656 1:238131253-238131275 TTTTTTGTAGAGATGGGGGGGGG + Intergenic
923984919 1:239370840-239370862 TTTTTCGTAGAGATGGGGTTTGG - Intergenic
923986811 1:239390957-239390979 CTTTTTGTAGAGATGGGGTCTGG - Intronic
924056530 1:240129678-240129700 TTTTTAGTAGAGATGGGGTTTGG + Intronic
924240350 1:242034067-242034089 GTTTTTGTAGAGATGGGGGGGGG - Intergenic
924464036 1:244284339-244284361 TTTTTTGTGGAGATGGGGGGGGG + Intergenic
924704166 1:246485609-246485631 TTTTTTGTAGAGATGTGGGGGGG - Intronic
1063646223 10:7886099-7886121 TTTTTTGTAGAGATGTGGGGGGG + Intronic
1063671380 10:8102670-8102692 TTTTTTGTAAAGATTGGGGTGGG - Intergenic
1064326319 10:14354623-14354645 CTTTTTGTAAAGTAGGGGGCTGG - Intronic
1064379345 10:14827036-14827058 TTTTTTGTAGAGACGGGGTTTGG - Intronic
1064582467 10:16808304-16808326 ATTTTAGTAGAGATGGGGATGGG - Intronic
1064623390 10:17238247-17238269 TTTTTTGTAGAGATGGGGTCTGG + Intergenic
1064627295 10:17274150-17274172 TTTTTTGTAGCGATGGGGGGAGG + Intergenic
1064891196 10:20175649-20175671 TTTTTTGTAAAAATGGGGTCTGG - Intronic
1064891361 10:20177725-20177747 TTTTTTGTAAAAATGGGGTCTGG - Intronic
1064948280 10:20817187-20817209 TTTTTTGTAGAGACGGGGTTTGG - Intronic
1065093513 10:22259131-22259153 TTTTTTGTAGAGATGGTGGGCGG + Intergenic
1065094208 10:22264551-22264573 ATTTTTGTAGAGATGGTGGTCGG - Intergenic
1065376031 10:25042741-25042763 CGTTTTGGGAAGTTGGGGGTGGG + Intronic
1065502163 10:26392781-26392803 CTTTTTTTAGAGATGGGGTCTGG + Intergenic
1065699895 10:28414697-28414719 TTTTTAGTAGAGATGGGGTTTGG + Intergenic
1065875545 10:29994469-29994491 TTTTTTGTAGAGATGGGGTCTGG + Intergenic
1065962888 10:30748592-30748614 CTTTCTGTATTGAAGGGGGTGGG - Intergenic
1066111230 10:32198870-32198892 TTTTTAGTAGAGATGGGGTTTGG - Intergenic
1066131530 10:32399220-32399242 CCTTTTTTAAAGATGGGGTCTGG + Intergenic
1066424647 10:35295525-35295547 CTGTTTGTAATGATGAGGCTGGG - Intronic
1066447239 10:35494237-35494259 TTTTTTGTAGAAATGGGGGGGGG - Intronic
1066575339 10:36818705-36818727 TTTTTTGTAGCGATGGGGTTTGG + Intergenic
1067020270 10:42790670-42790692 TTTTTAGTACAGATGGGGTTTGG - Intronic
1067403478 10:45999318-45999340 TTTTTTGTACAGATGGGTATCGG + Intronic
1067544149 10:47179842-47179864 AATTTTGTAGAGATGGGGGTGGG - Intergenic
1067773014 10:49140584-49140606 GTGTTTGTAATGTTGGGGGTGGG - Intergenic
1068164629 10:53312842-53312864 CTTTTTGTTAAGGTGAGGATAGG + Intergenic
1068283027 10:54901139-54901161 TTTTTTGTAGAGATGGTGGAGGG - Intronic
1068585587 10:58794595-58794617 CTTTTTGTAGAAATGGGGTTTGG + Intronic
1068795612 10:61076358-61076380 ATTTTTGTATAGATCGGGGTGGG + Intergenic
1070012392 10:72489109-72489131 CTTTTAGTAGAGATGGGGTTGGG - Intronic
1070057249 10:72947415-72947437 TTTTTTGTGGAGATGGGGTTTGG + Intronic
1070795242 10:79212478-79212500 TTTTTTGCACAGATGGGGCTGGG + Intronic
1070958826 10:80484493-80484515 CTTTTTGTAGAGATGGTGTTTGG + Intronic
1071105967 10:82095326-82095348 TTATTTGTAAAGATGGTGTTGGG + Intronic
1071175519 10:82922538-82922560 CTGTTTATCAAGATGAGGGTGGG - Intronic
1071273575 10:84031378-84031400 GTATGTGTACAGATGGGGGTAGG - Intergenic
1071357881 10:84816739-84816761 ATTTTTCCATAGATGGGGGTTGG + Intergenic
1071688750 10:87792609-87792631 ATTTTTTTAGAGGTGGGGGTGGG - Intronic
1071953898 10:90735836-90735858 ATTTTTGTAGAGATGGGGGGTGG - Intergenic
1072292366 10:93975884-93975906 GTTTTTGTAGAGATGTGGGGGGG - Intergenic
1072376393 10:94820904-94820926 TTTTTAGTAGAGATGGGGCTTGG - Intronic
1072656852 10:97335377-97335399 TTTTTTGTAGAGACGGTGGTGGG + Intergenic
1072688149 10:97550993-97551015 CTGTTTGTTAAGATGTGGCTGGG + Intronic
1073003425 10:100302517-100302539 TTTTTTGTAGAGATGAGGTTTGG - Intronic
1073024105 10:100473746-100473768 TTTTTAGTAGAGATGGGGTTTGG - Intronic
1073106582 10:101035834-101035856 GTGTTTGTATAAATGGGGGTGGG + Intronic
1073182055 10:101589563-101589585 TTTTTTGTAGAGATGAGGTTTGG - Intronic
1073307241 10:102512889-102512911 TTTTCTGTAGAGATGGGGGAGGG - Intronic
1073386650 10:103130947-103130969 TTTTTGGAAAGGATGGGGGTTGG - Intronic
1073751922 10:106538717-106538739 TTTTTAGTAGAGATGGGGGGAGG + Intergenic
1073768267 10:106707366-106707388 CTTTTAGTAGAGATGGTGGGGGG + Intronic
1074152435 10:110769319-110769341 CTTTTTATAATGATGGGGGTGGG + Intronic
1074284028 10:112081009-112081031 TTTTTTGTAGAGACGGGGGTGGG - Intergenic
1074470523 10:113722560-113722582 CATTTTATAAATATAGGGGTGGG + Intronic
1074589393 10:114798558-114798580 ATTTTTGTAGACATGGGGGGGGG - Intergenic
1074663435 10:115690266-115690288 ATTTTTCTACAGATGGGGGTGGG + Intronic
1075093753 10:119457863-119457885 TTTTTTGTAGAGATGGGGGGGGG + Intronic
1075113362 10:119605818-119605840 CTTTTTGTACAGATTTGGGGGGG - Intergenic
1075290410 10:121225163-121225185 TTTTTTGTAGAGATGGGGGGGGG + Intergenic
1075364516 10:121873583-121873605 CTTTTTCTAAGTATAGGGGTAGG + Intronic
1075666233 10:124232992-124233014 TTCTGTGTAAAGATGGGGATAGG - Intergenic
1076332870 10:129683944-129683966 CCTTTTGTGATGATGGGGGCTGG - Intronic
1076880129 10:133235911-133235933 CTCTATGTAGAGCTGGGGGTGGG + Intergenic
1077030775 11:465755-465777 TTTTTAGTAGAGATGGGGGGGGG - Intronic
1077470469 11:2756626-2756648 GTTTTTGTAGAGATGTGGTTTGG + Intronic
1077601067 11:3575393-3575415 CTTTTAGTAGAGATGAGGTTTGG - Intergenic
1078149133 11:8743918-8743940 TTTTTTGTAGAGATGGGGGCGGG + Intronic
1078252446 11:9627451-9627473 TTTTTTGTAGAGATTGGGGGGGG + Intergenic
1079063932 11:17273592-17273614 CTTTTTGTAGAGACAGGCGTAGG + Intronic
1079228094 11:18625742-18625764 TTTTTTGTAGAGATTGGGGGGGG + Intronic
1079403933 11:20128657-20128679 TTTTTAGTAGAGATGGGGTTTGG - Intergenic
1080242876 11:30147241-30147263 ATTTTTCCACAGATGGGGGTGGG + Intergenic
1080473388 11:32567887-32567909 CTTTTAGTACAGATGGGGTTCGG - Intergenic
1080536117 11:33223469-33223491 TTTTTTGTAGAGATGGGGTCTGG + Intergenic
1081538516 11:44013455-44013477 CTTTTAGTAGAGATGGGGGGTGG + Intergenic
1081848634 11:46259694-46259716 TTTTTAGTAGAGATGGGGGAGGG - Intergenic
1081978895 11:47254040-47254062 CTCTTTGTAGGGATGAGGGTTGG + Intronic
1082824089 11:57565540-57565562 CTTTTTGTAGAGATGGGGTTTGG + Intronic
1082841384 11:57692950-57692972 CTTTTTCCACAGATGGGGGCTGG + Intronic
1083013058 11:59422511-59422533 CTTTGTTTAAAGATGGTGGTTGG - Exonic
1083125602 11:60562791-60562813 TTTTTTGTAGAGATAGGGTTTGG - Intergenic
1083142598 11:60734076-60734098 ATTTTTGTAGAGATGGCGGGTGG - Intronic
1083237160 11:61358546-61358568 TTTTTAGTAGAGATGGGGGCGGG - Intronic
1083363528 11:62127952-62127974 CTCTTTGTAGAGATGAGGCTAGG + Intronic
1083582140 11:63831854-63831876 TTTTTAGTAGAGACGGGGGTGGG + Intergenic
1083600798 11:63946380-63946402 ATTTTTGTAGAGACGGGGTTTGG + Intronic
1083877807 11:65533599-65533621 TTTTTTGTAGAGATGGGGTTTGG - Intronic
1083954408 11:65975581-65975603 TTTTTTGTAGAGATGGGATTTGG + Intronic
1084001569 11:66297978-66298000 TTTTTTGTAAAGACGGGGGTGGG - Intergenic
1084256987 11:67949967-67949989 CTTTTAGTAGAGATGAGGTTTGG - Intergenic
1084289024 11:68149972-68149994 TTTTTAGTAGAGATGGGGGTGGG - Intergenic
1084663516 11:70561703-70561725 CTTTTTGTAGAGATGGCAGGGGG + Intronic
1084753484 11:71220051-71220073 TTTTTTGTAGAGATGGGTGGGGG - Intronic
1085017971 11:73187813-73187835 TTTTTTGTAGAGATGGGGTGGGG + Intergenic
1085119977 11:73961107-73961129 TTTTTTGTAGAGATGGGGTTTGG - Intronic
1086399011 11:86445858-86445880 CTTTCTGTAAGGGAGGGGGTGGG - Intronic
1087334378 11:96824827-96824849 CAGTTTGTAAAGATGTAGGTGGG + Intergenic
1087388452 11:97504373-97504395 TTTTTAGTAGAGATGGGGTTTGG - Intergenic
1087994405 11:104785778-104785800 CTTTTTGTGAAGATGGGTGGGGG + Intergenic
1088259649 11:107932038-107932060 TTTTTTGTAAAGACAGGGTTTGG + Intronic
1088299235 11:108338169-108338191 TTTTTAGTAGAGATGGGGTTTGG - Intronic
1088314306 11:108491539-108491561 TTTTTTGTAGAGATGGTGGGGGG + Intronic
1088317818 11:108525275-108525297 CTTTTTGTCCAGATTGGTGTGGG - Intronic
1089026853 11:115279714-115279736 CTTTTTGTCAAGGATGGGGTGGG + Intronic
1089078246 11:115756140-115756162 TCTTTTGTAGAGATGGGGGGGGG + Intergenic
1089516451 11:119035349-119035371 ATTTTTGTAGAGATGGCGGGGGG - Intergenic
1089651994 11:119920533-119920555 CTTTTTGTAAATGGGGGGGTGGG + Intergenic
1090089705 11:123684197-123684219 CTTGTTGTGAAGATGGATGTGGG - Intergenic
1090102697 11:123817143-123817165 TTTTTTGTGGAGATCGGGGTCGG + Intergenic
1091476802 12:783080-783102 TTTTTTGTAGAGACGGGGGTAGG + Intronic
1092156769 12:6287638-6287660 TTTTTTGTAGAGATGGAGCTTGG - Intergenic
1092479722 12:8848939-8848961 CTTATGGGAAAGATGGTGGTGGG + Intronic
1093632886 12:21431168-21431190 TTTTTTGTAGAGATGAGGTTTGG + Intergenic
1094143871 12:27208663-27208685 ATTTTTGTAGAGATGAGGTTTGG + Intergenic
1094203608 12:27817564-27817586 TTTTTTGTAGAGATCGGGGTTGG + Intergenic
1094320561 12:29178414-29178436 TTTCTTGTAGAGATGGGGCTTGG - Intronic
1094609577 12:31980287-31980309 TTTTTAGTAAAGATGGGGTTTGG + Intronic
1094752459 12:33427451-33427473 CATTTCTTAAGGATGGGGGTGGG + Intronic
1095582146 12:43812834-43812856 CTTTTTGTAGAGATGGGGAGTGG - Intergenic
1095650855 12:44607242-44607264 CATTTTGCAAAGATGGCTGTAGG - Exonic
1095663479 12:44765940-44765962 CTTTTAGTAGAGATGGGGTTTGG - Intronic
1095987649 12:48010342-48010364 CTTTTTTTAAAGCAGGTGGTGGG + Intergenic
1096280886 12:50252400-50252422 TTTTTAGTAGAGATGGGGTTTGG - Intronic
1096300156 12:50419726-50419748 GTTTTTGTAGAGATGGGGTGTGG - Intronic
1096390263 12:51223303-51223325 TTTTTAGTAAAGACGGGGCTGGG - Intergenic
1096505422 12:52089422-52089444 GTTTTTGTAGAGATGGGGAAGGG - Intergenic
1096656343 12:53094877-53094899 TTTTTAGTAGAGATGGGGCTTGG + Intergenic
1096855224 12:54476597-54476619 TTTTTTGTAGAGATTGGGGGTGG + Intergenic
1096908044 12:54953839-54953861 CTTTTTTTAACGATGTGTGTTGG - Intronic
1097059767 12:56274011-56274033 TTTTTGGTAAAGATGGGGTCTGG + Intronic
1097238734 12:57558494-57558516 TTTTTAGTAGAGATGGGGTTTGG - Intronic
1097251383 12:57634089-57634111 TTTTTTGTAGAGACGGGGGGGGG - Intergenic
1097430279 12:59497291-59497313 CTTTTGGAAAAGATGGGGACAGG - Intergenic
1097882695 12:64700438-64700460 ATTTTTGTAAAGATGGAGTCAGG + Intergenic
1097951062 12:65428766-65428788 CAATTGCTAAAGATGGGGGTGGG - Intronic
1098170987 12:67747171-67747193 GATTGTGTAAAGATGGGCGTGGG + Intergenic
1098300278 12:69047326-69047348 ATTCTTGTAAAGATGGAGGATGG + Intergenic
1098404758 12:70112442-70112464 GTTTTAGTAGAGATGGGGTTTGG - Intergenic
1098427332 12:70379592-70379614 TTTTTTGTAGAGATGGGGTTTGG + Intronic
1100443550 12:94640359-94640381 TCTTTTGTAGAGATGGGGTTTGG + Intronic
1100989882 12:100240336-100240358 GTTTTTGTAGAGATAGGGGCAGG + Intronic
1101672030 12:106884498-106884520 CCTTTATTAAAGAAGGGGGTTGG + Intronic
1101977357 12:109371393-109371415 TTTTCTGTAGAGATGGGGTTTGG + Intronic
1102182197 12:110921049-110921071 GTTATTTTAAAGATGGTGGTCGG - Intergenic
1102226852 12:111234894-111234916 TTTTTAGTAAAGATGGGGTTTGG + Intronic
1102298574 12:111755578-111755600 TTTTTAGTAGAGATGGGGGACGG + Intronic
1102362385 12:112299443-112299465 TCTTTTGTAGAGACGGGGGTGGG - Intronic
1102388943 12:112534342-112534364 TTGTTTGTAGAGATGGGGGGTGG + Intergenic
1102475612 12:113186350-113186372 CTATGTGTACTGATGGGGGTGGG - Intronic
1102509313 12:113403539-113403561 TTTTTTGTAGAGATTGGGGGGGG + Intronic
1102539057 12:113605327-113605349 CTTTTTGCAGAGATGGGGCGGGG + Intergenic
1102596187 12:113994199-113994221 TTTTTTGTAGAGATGGGGGGCGG - Intergenic
1102653605 12:114461536-114461558 CTTGTTGTAGAGATGGTGCTGGG - Intergenic
1102837528 12:116079392-116079414 CCTTTTGCAGAGATGGGGGAGGG + Intronic
1102840315 12:116113457-116113479 TTTTTTGTAGAGATGGGGACTGG - Intronic
1103075990 12:117983117-117983139 ATTTTTGTAGAGACAGGGGTGGG - Intergenic
1103083242 12:118041931-118041953 TTTTTAGTAGAGATGGGGTTTGG + Intronic
1103091134 12:118098904-118098926 TTTTTTTAAGAGATGGGGGTTGG + Intronic
1103119069 12:118365408-118365430 TTTTTTGTAGAGATGGGCGGGGG + Intronic
1103259048 12:119569925-119569947 TTTTTAGTAGAGATGGGGTTTGG - Intergenic
1103406224 12:120677572-120677594 TTTTTTGTAGAGATGGGAGTGGG + Intergenic
1103628541 12:122240148-122240170 TTTTTGGTAGAGATGGGGTTTGG - Intronic
1103813472 12:123634261-123634283 TTTTTTGTAGAGATGGGGTCTGG - Intronic
1103887342 12:124212593-124212615 TTTTTAGTAGAGATGGGGTTTGG + Intronic
1103998171 12:124843277-124843299 CTTTCTGTGGAGATGGGGGGGGG + Intronic
1104009889 12:124922714-124922736 TTTTTAGTAGAGATGGGGGGGGG + Intergenic
1104462680 12:128968482-128968504 TTTTTAGTAGAGATGGGGTTTGG - Intronic
1104849624 12:131865790-131865812 CTTTTTGTAGAGATTGGGGGCGG - Intergenic
1105218419 13:18304054-18304076 CCTTTGGTTAGGATGGGGGTAGG - Intergenic
1105370419 13:19797280-19797302 ATTTTTATAGAGATGGGGGCAGG - Intergenic
1105427224 13:20304324-20304346 TTTTTAGTAGAGATGGGGTTTGG - Intergenic
1105449008 13:20482031-20482053 CTTTTGGTAGAGATGGGTGTGGG - Intronic
1105586584 13:21750711-21750733 TTTTTTGTAGAGACTGGGGTGGG + Intergenic
1106311044 13:28554581-28554603 ATTTTTTTAGAGATTGGGGTGGG + Intergenic
1106523443 13:30518917-30518939 ATTTTTGTAGAGATGGGGGCTGG + Intronic
1106733354 13:32565143-32565165 TTTTTAGTAGAGATGGGGTTTGG + Intergenic
1106775234 13:33002401-33002423 CTGTTTGTAAAGATGGGAGGTGG - Intergenic
1106812780 13:33376607-33376629 TTTTTTTTAAAGATGGGGTCTGG - Intergenic
1107052893 13:36070939-36070961 CTCTTTATAAAGATGGGGGCCGG - Intronic
1107131926 13:36905576-36905598 GTTTTTGTAGAGATGGGGTTTGG - Intronic
1107887794 13:44888822-44888844 TTTTTTGTAGAAATGGGGTTTGG + Intergenic
1108037082 13:46301955-46301977 TTTTTGGTAGAGATGGGGTTGGG + Intergenic
1108263785 13:48684099-48684121 CTTTTTGTAGAGATCGGGGGGGG + Intronic
1108354412 13:49617442-49617464 TTTTTTGTAGAGATTGGGGTGGG - Intergenic
1108388887 13:49928262-49928284 TTTTTTGTAGAGACGGGGTTTGG - Intronic
1108682672 13:52792859-52792881 CTATCTGTAAAAATGGGGATTGG + Intergenic
1109272563 13:60270874-60270896 CTCTATGTAAAGATTGGGGAAGG - Intergenic
1109656106 13:65392339-65392361 TTTTCTGTAAAAATGGAGGTAGG - Intergenic
1109657025 13:65406091-65406113 ATTTTTTTAAAGCTTGGGGTAGG - Intergenic
1110362046 13:74637414-74637436 TTTTTAGTAGAGATGGGGTTTGG + Intergenic
1110435019 13:75469591-75469613 TTTTTTGTAGAGATAGGGTTTGG - Intronic
1111592767 13:90371208-90371230 ATTTTTGTACAGATGGGTGAGGG + Intergenic
1111843551 13:93479609-93479631 TTTTTAGTAGAGATGGGGGGGGG - Intronic
1112371391 13:98796822-98796844 CTTTTTGGCTAGACGGGGGTGGG + Intronic
1112385318 13:98934072-98934094 ATTTTTGGAGAGATGGGGGCGGG + Intronic
1112797465 13:103072032-103072054 TTTTTTGTAAAGATGGGTGGGGG + Intergenic
1113543496 13:111127476-111127498 TTTTTTGTAGTGATGGGGGGAGG - Intronic
1114178197 14:20342903-20342925 TTTTTAGTAGAGATGGGGGGGGG + Intergenic
1114514790 14:23291598-23291620 TTTTCTGTAGAGATGGGGGACGG - Intronic
1115237897 14:31226042-31226064 TTTTTAGTAGAGATGGGGTTTGG - Intergenic
1115837770 14:37428411-37428433 TTTTTTGTAGAGATGGGGTTTGG - Intronic
1116005614 14:39287252-39287274 TTTTTTGTAGAGATGGTGTTTGG + Intronic
1116249931 14:42468499-42468521 TTTTTTTTAAAGATAAGGGTTGG + Intergenic
1116362037 14:44012114-44012136 TTTTTAGTAGAGATGGGGTTTGG - Intergenic
1116875013 14:50102386-50102408 TTTTTTGTAGTGATGGGGTTTGG - Intergenic
1116880762 14:50166404-50166426 TTTTTTGTAGAGATGGGGTTTGG + Intronic
1116951920 14:50886258-50886280 TTTTTAGTAAAGATGGGGTTTGG - Intronic
1117714185 14:58563726-58563748 CATTTTGTAGAGATGGGGTGGGG - Intergenic
1117903929 14:60565091-60565113 TTTTTTTTAGAGATGGGGGTTGG - Intergenic
1118278806 14:64410394-64410416 TTTTTTGTAAAGATGGGGGGGGG + Intronic
1118282195 14:64439712-64439734 TTTTTAGTAGAGATGGGGTTTGG - Intronic
1118285960 14:64472995-64473017 AATTTTGCAAAGCTGGGGGTTGG + Exonic
1118996923 14:70844815-70844837 TTATTTATAAAGATGTGGGTGGG - Intergenic
1119061089 14:71475428-71475450 CTCTTTGTGATGATGGTGGTGGG + Intronic
1119373444 14:74167706-74167728 TTTTTTATAGAGATGGGGGAGGG + Intronic
1119534816 14:75394439-75394461 TTTTTTGTAGAGATGGGGTTTGG + Intergenic
1120106648 14:80503047-80503069 ATTTTTGAAAATATGGGGATAGG + Intronic
1120596219 14:86440954-86440976 TTTTTAGTAGAGATGGGGTTTGG + Intergenic
1120877910 14:89391825-89391847 ATTTTAGTAGAGATGGGGTTTGG - Intronic
1120898956 14:89559200-89559222 TTTTTTGCAGAGATGGGGTTGGG - Intronic
1121013998 14:90537360-90537382 TTTTTTGTAGAGATGGGGGGGGG + Exonic
1121043586 14:90771414-90771436 TTTTTTGTAGAGATGGGGTTTGG - Intronic
1121242072 14:92438431-92438453 ATTTTTGTAGAGATGGCGGGGGG - Intronic
1121301349 14:92873956-92873978 TTTTTAGTAGAGATGGGGTTTGG - Intergenic
1121400902 14:93676235-93676257 TTTTTAGTAGAGATGGGGATTGG + Intronic
1121734067 14:96205748-96205770 CTTTATGCAAAGATAGAGGTAGG + Intronic
1121975337 14:98398415-98398437 TTTTTTGTAGAGATGGGGTTTGG - Intergenic
1122485307 14:102075581-102075603 TTTTTTGTAGAGATGGGGTGGGG - Intergenic
1122618564 14:103038702-103038724 TTTTTTGTAGAGACGGGGGGGGG + Intronic
1122730321 14:103792353-103792375 TTTTTTGTAGAGATGGGGTTTGG + Intronic
1202873593 14_GL000225v1_random:188230-188252 ATTTTTTTAGAGATGGGGGCAGG + Intergenic
1123701825 15:22919842-22919864 TTTTTTGTAGAGATGGGGTCTGG - Intronic
1123872432 15:24590407-24590429 TTTTTAGTAGAGATGGGGTTTGG + Intergenic
1124181429 15:27479246-27479268 CCTTTTGTAATTATGGGGATAGG + Intronic
1124389538 15:29241864-29241886 TTTTTTGTAAGGGTGGTGGTGGG - Intronic
1125440695 15:39700212-39700234 CATTTGGTATAGATGGGGGTGGG - Intronic
1125629774 15:41137662-41137684 TTTTTAGTAGAGATGGGGTTTGG + Intergenic
1125635642 15:41186292-41186314 TTTTTAGTAGAGATGGGGTTTGG - Intronic
1125693489 15:41615980-41616002 TTTTTTGTAGAGATAGGGTTTGG - Intergenic
1125961692 15:43835313-43835335 CTTTTTATAGAGATTGGGGTGGG - Intronic
1126045680 15:44637490-44637512 TTTTTAGTAGAGATGGGGTTTGG + Intronic
1126077147 15:44922477-44922499 TTTTTAGTAGAGATGGGGTTTGG - Intergenic
1126346831 15:47704539-47704561 TTTTTTGTAGAGATGGGGTTTGG - Intronic
1126739064 15:51759793-51759815 CTATTTACAAAGATGGGGGGAGG + Intronic
1127048059 15:55048769-55048791 TTTTTTGTAAAGAGGGGAGGTGG - Intergenic
1127349600 15:58137218-58137240 CTTTTTGCAAAGCTAGGGGAGGG + Intronic
1127386460 15:58471315-58471337 TTTTTAGTAGAGATGGGGGGGGG + Intronic
1127433013 15:58930305-58930327 TTTTTAGTAGAGATGGGGTTTGG + Intronic
1127448988 15:59098465-59098487 TTTTTAGTAGAGATGGGGTTTGG - Intergenic
1127520126 15:59735504-59735526 TTTTCTGTAGAGATGGGGTTTGG + Intergenic
1127550831 15:60036797-60036819 ATTTTTCTACGGATGGGGGTGGG + Intronic
1128096127 15:64957233-64957255 TTTTTAGTAGAGATGGGGTTTGG + Exonic
1128134925 15:65255687-65255709 CTTTTTGCAGGGAGGGGGGTTGG + Intronic
1128496822 15:68203485-68203507 CTTTTTGTACAGATAGATGTAGG + Intronic
1128594213 15:68929906-68929928 CTTCTTAAAAAGATAGGGGTAGG - Intronic
1129012365 15:72432478-72432500 ATTTTTGTAGAGATGGGGTTTGG + Intergenic
1129026008 15:72574906-72574928 TTTTTTGTAGAGATGGGCGGGGG - Intronic
1129225314 15:74167024-74167046 ATTTTTGTAGAGACGGGGTTTGG - Intergenic
1129428111 15:75479701-75479723 CCTTTTATAAAGATGGGTGGTGG - Intronic
1129643829 15:77411780-77411802 CTTTTTGTAAAGATGGGGGTTGG + Intronic
1130516372 15:84629032-84629054 CGTTTTGTAGAGATGAGGTTTGG - Intergenic
1130642176 15:85687742-85687764 ATTTTTTAAAAGGTGGGGGTGGG + Intronic
1131538448 15:93256337-93256359 CTTTTAGTAAAGATGGGGCCAGG + Intergenic
1131706232 15:94999365-94999387 ATTTTTGTAGAGATGGGGTTTGG - Intergenic
1131836352 15:96395529-96395551 TTTTTAGTAAAGATAGGGTTTGG + Intergenic
1131962774 15:97807075-97807097 GTTTCTGTGCAGATGGGGGTGGG - Intergenic
1132593772 16:738823-738845 TTTTTAGTACAGATGGGGGTTGG + Intronic
1132682158 16:1146944-1146966 TTTTTTGTAGAGACGGGGTTGGG + Intergenic
1133218703 16:4308740-4308762 TTTTTTGTAGAGATGGGGCAGGG + Intergenic
1133494485 16:6304109-6304131 ATTTTAGTGAAGATGGGGTTTGG - Intronic
1133754550 16:8752585-8752607 TCTTTTGTAGAGATTGGGGTTGG - Intronic
1133813900 16:9181858-9181880 TTTTTTGTAGAGATGGGTTTTGG + Intergenic
1133818835 16:9218429-9218451 TTTTTTGTAGAGATTGGGGTTGG - Intergenic
1133977311 16:10608492-10608514 ATTTTTCCACAGATGGGGGTTGG - Intergenic
1134135843 16:11675873-11675895 CTTTTTGTCAGGGTGAGGGTGGG + Intronic
1134286639 16:12867688-12867710 TTTTTTGCAGAGATGGGGGGGGG + Intergenic
1134423781 16:14118622-14118644 TTTTTTGTAGAGATGGGGTTTGG - Intronic
1134592653 16:15468321-15468343 TTTTTTGTAGAGATGGGGTTTGG + Intronic
1134636051 16:15792910-15792932 GTTTTTGTAGAGAGGGGGTTTGG + Intronic
1135040327 16:19113364-19113386 TTTTTAGTAGAGATGGGGGGCGG + Intergenic
1135069745 16:19341428-19341450 TTTTTTGTAGAGATGGGGTCTGG - Intergenic
1135135010 16:19880969-19880991 CCTTCTCTAAAGATGGCGGTAGG + Intronic
1135260985 16:20980549-20980571 CTTTTAGTAGAGATGGTGGGGGG + Intronic
1135261382 16:20983847-20983869 ATTTTTGTAGAGATAGGGGACGG - Intronic
1135640124 16:24112349-24112371 TTTTTTGTAGAGATGGGAGTTGG - Intronic
1135763576 16:25157374-25157396 TTATTTGTATAGATGGGGGGTGG - Intronic
1135835396 16:25820746-25820768 TTTTTTGTAGAGACGGGGTTTGG + Intronic
1135868270 16:26125268-26125290 TTTTTTCCACAGATGGGGGTGGG + Intronic
1136088893 16:27904245-27904267 TTTTTTGTAGAGATGGGGTTTGG + Intronic
1136104775 16:28022163-28022185 CTCAGGGTAAAGATGGGGGTAGG + Intronic
1136137691 16:28267217-28267239 TTTTTTATAAAGATGGGGTGGGG + Intergenic
1136138717 16:28275151-28275173 TTTTTTGTAGAGATGGGGGAGGG - Intergenic
1136588926 16:31205408-31205430 TTTTTTGTAGAGATGGGGTCTGG + Intergenic
1136597917 16:31264716-31264738 TTTTTTGTAGAGATGGGGTCTGG + Intronic
1136625817 16:31461683-31461705 TTTTTAGTAGAGATGGGGTTTGG + Intronic
1136637272 16:31532530-31532552 TTTGTTGTACAGATGGGGGTGGG - Intergenic
1137930713 16:52584668-52584690 CTTTTTGCAAAGATGTGAGCAGG - Intergenic
1138001768 16:53288205-53288227 CTTTTAGACAAGATGGGGGCTGG + Intronic
1138022050 16:53493482-53493504 TTTTTAGTAGAGATGGGGTTTGG + Intronic
1138526638 16:57612068-57612090 TTTTTGGTAGAGATTGGGGTGGG + Intronic
1139029945 16:62867816-62867838 TTTTTTGTAGAGATGAGGTTTGG - Intergenic
1139044988 16:63047092-63047114 TTTTTAGTAGAGATGGGGTTTGG + Intergenic
1139676781 16:68529441-68529463 GTTGTTGTAAAGACGGGGGTGGG + Intergenic
1139733377 16:68967091-68967113 ATTTTTGTAGAGATGGGGTCTGG + Intronic
1139795070 16:69476193-69476215 TTTTTAGTAGAGATGGGGTTTGG + Intergenic
1139795331 16:69478413-69478435 TTTTTTGTAGAGATGGGGTCTGG - Intergenic
1139838459 16:69859373-69859395 TTTTTTGTTGAGATGGGGTTTGG - Intronic
1140065704 16:71609517-71609539 TTTTTTGTAGAGATGGCGGGGGG - Intergenic
1140270224 16:73458649-73458671 CTTTTTGTCTTGATGCGGGTTGG + Intergenic
1140375528 16:74442657-74442679 TTTTTTGTAGAGATTGGGGGTGG + Intergenic
1140441325 16:74990100-74990122 TTTTTTATAGAGATGGGGTTTGG + Intronic
1140488943 16:75317938-75317960 TTTTTAGTAGAGATGGGGGGTGG - Intronic
1140507630 16:75483844-75483866 TTTTTAGTAGAGATGGGGTTTGG - Intronic
1141329911 16:83101614-83101636 TTTTTAGTAGAGATGGGGTTTGG - Intronic
1141574682 16:84956248-84956270 TTTTTAGTAGAGATGGGGTTTGG - Intergenic
1141597187 16:85104536-85104558 TTTTTAGTAGAGATGGGGGGAGG - Intronic
1141641364 16:85343569-85343591 TTTTTTGTAGAGATGGGGTCTGG - Intergenic
1141935552 16:87235865-87235887 CTTGTGGTGCAGATGGGGGTGGG + Intronic
1142178764 16:88657117-88657139 TTTTTTGTAGAGATGGGGGGGGG + Intronic
1142180224 16:88664891-88664913 TTTTTTGTAGAGATGTGGGGGGG + Intergenic
1142338218 16:89503999-89504021 CTTCTTTAAAAGATGGGGCTGGG - Intronic
1142636278 17:1259763-1259785 ATTTTTGTAGAGATGGGGGTGGG - Intergenic
1143463907 17:7122992-7123014 TTTTTAGTAGAGATGGGGTTTGG + Intergenic
1143892927 17:10116131-10116153 CTTTTAGTAGAGATGGGGTTTGG - Intronic
1143956012 17:10669724-10669746 TTTTTTGTAGAGATGGGGTCTGG - Intergenic
1144607417 17:16679072-16679094 GTTTTTGTAGAGATGGCGGGGGG + Intergenic
1145042124 17:19584781-19584803 ATTTTTGTAAAGATGGGGTCTGG + Intergenic
1145187865 17:20811270-20811292 CTTTTTGTAGATATGGGGTCTGG - Intergenic
1145404247 17:22571440-22571462 CTTTGTGAAAAGACGGGGGGTGG + Intergenic
1145928887 17:28669755-28669777 TTTTTAGTAGAGATGGGGTTTGG - Intronic
1146066827 17:29642596-29642618 CTGTTTTTATAGATGGGGGATGG - Intronic
1146082671 17:29795918-29795940 TTTTTAGTAGAGATGGGGTTTGG + Intronic
1146202247 17:30869012-30869034 TTTTTAGTAGAGATGGGGTTTGG + Intronic
1146224613 17:31054718-31054740 ATTTTTGTAGAAATGGGGGGGGG + Intergenic
1146867026 17:36346217-36346239 CTTTTTGTAGATATGGGGTCTGG + Intronic
1146945942 17:36873569-36873591 TTCTTTTTAAAGGTGGGGGTGGG - Intergenic
1147069896 17:37946826-37946848 CTTTTTGTAGATATGGGGTCTGG + Intergenic
1147081425 17:38026364-38026386 CTTTTTGTAGATATGGGGTCTGG + Intronic
1147097370 17:38150321-38150343 CTTTTTGTAGATATGGGGTCTGG + Intergenic
1147209879 17:38866751-38866773 CATTTTGTGGAGATGGGGGCAGG - Intergenic
1147271400 17:39274454-39274476 CTTTTTGTAGAGATGGGGTCAGG - Intronic
1147361332 17:39932540-39932562 TTTTTTATAGAGATGGTGGTTGG - Intergenic
1147482658 17:40781749-40781771 CTTTTTTTAATGCTTGGGGTGGG - Intronic
1147588115 17:41664656-41664678 TTTTTTGTAAAGGTGGGCGGTGG - Intergenic
1147832593 17:43307300-43307322 TTTTTTGTAGAGATGGGGGTTGG - Intergenic
1148045272 17:44739940-44739962 TTTTTTGTAGAGACGGGGTTTGG + Intronic
1148226307 17:45900136-45900158 CTTTTGGCAAAGATGGGCCTGGG + Intronic
1148244594 17:46022175-46022197 TTTTTTGTAGAGATGGGATTTGG - Intronic
1148399411 17:47341654-47341676 TTTTTTGTAGAGATTGGGCTGGG - Intronic
1148450217 17:47772699-47772721 TTTTTTGTAGAGATGGGGTTTGG + Intergenic
1148465387 17:47861866-47861888 CTTTTTGTAGAAATGGGGTCTGG - Intergenic
1148737674 17:49874018-49874040 CTTTTTATGGAGATGGAGGTGGG - Intergenic
1148813133 17:50307545-50307567 TTTTTGGTAGAGATGGGGGGGGG + Intergenic
1149113092 17:53058228-53058250 TTTTTAGTAGAGATGGGGTTTGG - Intergenic
1149617828 17:58016509-58016531 TTTTTAGTAGAGATGGGGTTGGG + Intergenic
1149786558 17:59440465-59440487 CTTTTTGTAGAGATGGGGAGGGG - Intergenic
1150048970 17:61940057-61940079 ATTTTAGTAGAGATGGGGTTTGG - Intergenic
1150079077 17:62220445-62220467 CTTTTTGTAGATATGGGGTCTGG + Intergenic
1150266471 17:63835298-63835320 TTTTTTGTAGAGATGGGGTCTGG + Intronic
1150319525 17:64200849-64200871 GATTCTGAAAAGATGGGGGTAGG - Intronic
1150666332 17:67142327-67142349 TTTTTTGTAGAGATGGAGTTTGG - Intronic
1150674551 17:67233866-67233888 TTTTTAGTAGAGACGGGGGTGGG - Intronic
1150763822 17:67987595-67987617 CTTTTAGTAGAGACGGGGTTTGG - Intergenic
1150765663 17:67999982-68000004 ATTTTAATAGAGATGGGGGTGGG + Intergenic
1150946650 17:69753693-69753715 CTTTTTGAAGTGGTGGGGGTGGG + Intergenic
1151016060 17:70554228-70554250 TTTTTAGTAGAGATGGGGTTTGG - Intergenic
1151296655 17:73191305-73191327 TTTTTTGTAAGGACGGGGTTTGG + Intergenic
1151447903 17:74179134-74179156 TTTTTAGTAGAGATGGGGTTTGG - Intergenic
1151493468 17:74445994-74446016 TTTTTTGTAGAGATGGTGGGCGG - Intronic
1151739653 17:75971562-75971584 TTTTTAGTAGAGATGGGGTTTGG - Intronic
1151822389 17:76503599-76503621 TTTTTTGTAGAGATGGTGGTGGG + Intergenic
1151891880 17:76955934-76955956 TTTTTTATAGAGATGGGGGTGGG + Intergenic
1151983606 17:77528472-77528494 CTTTTTGTCCAGCTGGGGCTGGG + Intergenic
1152149811 17:78591914-78591936 TTTTTTGTAGAGACGGGGGGGGG + Intergenic
1152414162 17:80147913-80147935 TTTTTTGTAGAGACGGGGTTGGG + Intergenic
1152539750 17:80969013-80969035 GTTCTTGTAAACATGGGGATGGG + Intergenic
1153057109 18:956777-956799 ATTTTTGTGGAGATGGGGTTTGG + Intergenic
1153121458 18:1732391-1732413 CTATTTGCAAAGATTAGGGTGGG + Intergenic
1153218704 18:2844086-2844108 TTTTTTGTAGAGATGGGCGGGGG - Intergenic
1153225513 18:2896814-2896836 TTTTTTTTGGAGATGGGGGTCGG + Intronic
1153419614 18:4890359-4890381 CTCTTTATCAAGATAGGGGTTGG + Intergenic
1153673735 18:7437118-7437140 TTTTTAGTAGAGATGGGGTTTGG + Intergenic
1153829524 18:8909593-8909615 TTTTTAATAAAAATGGGGGTTGG + Intergenic
1154384158 18:13878680-13878702 TTTTTTGTAAAGATGGGGGGCGG + Intergenic
1155047831 18:22118592-22118614 TATTTTTTAGAGATGGGGGTCGG - Intergenic
1155283416 18:24264576-24264598 CTTTTTGTGAAGATTTGGCTTGG - Intronic
1155291860 18:24350451-24350473 CTTTTTTTAGGGGTGGGGGTAGG + Intronic
1155309607 18:24510689-24510711 TTTTTTGTAGAGATGGGCGGGGG + Intergenic
1155473326 18:26213206-26213228 TTTTTAGTAGAGATGGGGTTTGG + Intergenic
1155518606 18:26647333-26647355 TTTTTAGTAGAGATGGGGGGGGG - Intronic
1155971012 18:32083732-32083754 ATTTTTGTAGAGATGGGGTTTGG - Intergenic
1156351271 18:36303341-36303363 CTCTCTGTGCAGATGGGGGTGGG + Intronic
1156688003 18:39673090-39673112 CTTTTCATAAATATAGGGGTGGG - Intergenic
1157263181 18:46194127-46194149 TTTTTTGTATAGATGGGGTCTGG + Intronic
1157513829 18:48296923-48296945 CTTTTAGTAGAGACGGGGTTTGG - Intronic
1157548011 18:48561059-48561081 TTTTTAGTAGAGATGGGGTTTGG - Intronic
1158457866 18:57623287-57623309 ATTTTTGTGGAGATGGGGGAGGG + Intergenic
1158459577 18:57634344-57634366 TTTTTTGTAGAGACGGGGTTTGG + Intergenic
1159023595 18:63163021-63163043 GTTTTTGTAGAGATGGGGTCTGG + Intronic
1159049441 18:63405778-63405800 GTTTTTGTAGAGGTGGGGTTTGG - Intronic
1159206961 18:65265415-65265437 TTTTTTAAAAAGTTGGGGGTTGG + Intergenic
1160522991 18:79519509-79519531 TTGTTTGTAGAGATGGGGGGTGG + Intronic
1160734308 19:655130-655152 TTTTTTGTAGAAATGGGGTTTGG - Intronic
1160938067 19:1606759-1606781 TTTTTAGTAGAGATGGGGTTTGG + Intergenic
1161032406 19:2064190-2064212 TTTTTAGTAGAGATGGGGTTTGG - Intergenic
1161074820 19:2280519-2280541 TGTTTTGTAGAGATGGGGGGCGG + Intronic
1161136536 19:2623146-2623168 TTTTTTGTAGAGATGGGGTCTGG - Intronic
1161143130 19:2660611-2660633 TTTTTTGTACAGATGGTGGTGGG - Intronic
1161191205 19:2957353-2957375 TTTTTTGTAGAGATGGGGTCTGG - Intergenic
1161204461 19:3033838-3033860 CTTTTTGTAGAGATGGGGGGTGG - Intronic
1161232793 19:3183340-3183362 TTTTTTGTAGAGACGGGGCTGGG + Intergenic
1161431016 19:4232543-4232565 TTTTTTCTACAGATGGGGGGGGG - Intronic
1161638299 19:5403236-5403258 TTTTTTGTAGAGATGGTGGAGGG + Intergenic
1161664749 19:5568418-5568440 GTTTTTGTAGAGATGGGGCCTGG + Intergenic
1161677155 19:5658173-5658195 TTTTTAGTAGAGATGGGGTTTGG + Intronic
1161686702 19:5706311-5706333 TTTTTTGTAGAGATGGGGCCAGG + Intronic
1161693529 19:5752008-5752030 TTTTTTTTAAAGCTGGGCGTTGG + Intronic
1161784552 19:6315690-6315712 TTTTTTGTACAGATGGGATTTGG + Intronic
1161870274 19:6864488-6864510 TTTTTAGTAGAGATGGGGTTTGG + Intergenic
1162339497 19:10083667-10083689 TTTTTTGTAGAGCTGGGGGCGGG - Intergenic
1162366061 19:10250440-10250462 TTTTTTGTAGAGATGGCGGGGGG - Intergenic
1162385969 19:10360930-10360952 TTTTTTGTAAAGATAGGGTCTGG + Intronic
1162389687 19:10381835-10381857 ATTTTTGTAGAGATGGGGTCTGG + Intergenic
1162466031 19:10841303-10841325 TATTTTGTAAAGATGGTGGTAGG - Intronic
1162774474 19:12970856-12970878 CTTTTTGTAGAGACGTGGTTTGG + Intronic
1162913021 19:13860030-13860052 TTTTTTGGAGAGATGGGGGTGGG - Intergenic
1162952018 19:14076864-14076886 TTTTTTGTAGAGATGGGGTGGGG - Intergenic
1163062267 19:14769218-14769240 TTATTAGTAAAGATGGGGGGGGG - Intronic
1163138948 19:15333054-15333076 CTTTTTTTAAAAAGGTGGGTTGG - Intergenic
1163277423 19:16294108-16294130 GTTTTTGTAGAGATGGGGGGAGG + Intergenic
1163462952 19:17449664-17449686 TTTTTTGTAGAGATGGGGTCTGG - Intronic
1163512311 19:17742648-17742670 TTTTTTGTAGAGATGGGGTTCGG + Intergenic
1163535786 19:17875594-17875616 TTTTTTGTAGAGATGGGGGCGGG - Intronic
1163562560 19:18028836-18028858 CTTTTTGTAAGGATGGAGGAGGG - Intergenic
1163567528 19:18060299-18060321 TTTTTAGTAGAGATGGGGTTTGG - Intronic
1163619059 19:18347283-18347305 TTTTTTGTAGAGATGGGATTTGG + Intronic
1163623003 19:18371941-18371963 TTTTTTGTAGAGATGGGGGGGGG - Intergenic
1163685742 19:18710786-18710808 ATTTTAGTAGAGATGGGGTTTGG + Intronic
1163795085 19:19333305-19333327 TTTTTTGTAGAGATGGGGTCTGG - Intronic
1163944841 19:20525673-20525695 CTTTTAGTAGAGATGGGGCCAGG + Intergenic
1164403113 19:27916475-27916497 TCTTTTGCAAAGATGGGGATTGG + Intergenic
1164635864 19:29791130-29791152 TTTTTTGTAGAGATGGGGTCTGG - Intergenic
1164660602 19:29963023-29963045 CTTTATGTGCAGCTGGGGGTAGG - Intronic
1164941692 19:32255998-32256020 TTTTTTGTAAAGATGGGGTTGGG - Intergenic
1164957775 19:32401952-32401974 TTTTTTGTAAAGATTGGGGGTGG - Intergenic
1164965783 19:32481591-32481613 TTTTTTGTAAAGATGGAGTCTGG + Intronic
1165048936 19:33129073-33129095 TTTTTAGTAGAGATGGGGTTTGG - Intronic
1165055079 19:33170681-33170703 TTTTTAGTAGAGATGGGGTTTGG - Intronic
1165589717 19:36957407-36957429 TTTTTAGTAAAGATGAGGTTTGG + Intronic
1165641011 19:37386670-37386692 CTATATGTAAAGATAGTGGTTGG + Intronic
1165695760 19:37899768-37899790 ATTTTTGTAGAGATGGGAGTGGG + Intronic
1165726514 19:38116674-38116696 TTTTTGGTAGAGATGGGGATGGG - Intronic
1165806108 19:38581774-38581796 TTTTTAGTAGAGATGGAGGTGGG + Intronic
1165834350 19:38745141-38745163 TTTTTTGTAGAGATGGGGCGGGG + Intronic
1165857005 19:38885271-38885293 ATTTTTGTAGAGATGGGGGGTGG + Intronic
1166070812 19:40386529-40386551 CTTTTTGTAGAGATAGAGATGGG + Intronic
1166116839 19:40661531-40661553 TTTTTTGTAGAGATCGGGGTGGG + Intergenic
1166187544 19:41151235-41151257 TTTTTAGTAGAGATGGGGTTTGG - Intergenic
1166211825 19:41311416-41311438 TTTTTTGTAGAGATGGGGTCTGG - Intronic
1166324311 19:42039800-42039822 TTTTTTGTAGAGATGGGGTCTGG - Intronic
1166531249 19:43544822-43544844 TGTTTTGTAAAGGCGGGGGTCGG + Intronic
1166626959 19:44366648-44366670 CTTTTTAAAAAAGTGGGGGTGGG - Intronic
1166684233 19:44785965-44785987 TATTTGGTAGAGATGGGGGTGGG + Intronic
1166797877 19:45439007-45439029 TTTTTAGTAGAGATGGGGTTGGG - Intronic
1167036185 19:46996279-46996301 TTTTTAGTAGAGATGGGGTTTGG + Intronic
1167064855 19:47177536-47177558 CTGTTTGTACAGATTGGGGCAGG + Intronic
1167075658 19:47247235-47247257 TTTTTTGTAGAGATGGGGGGGGG + Intergenic
1167128645 19:47569698-47569720 TTTTTTGTAGAGATGGGTGGGGG - Intergenic
1167276321 19:48542216-48542238 ATTTTTGTAGAGATGGGGTCTGG - Intergenic
1167459545 19:49617329-49617351 CTCATTTTAAAGATGGGGGCTGG + Intronic
1167462667 19:49634428-49634450 TTTTTGGTAGAGATGGGGGCGGG + Intergenic
1167585191 19:50370648-50370670 TTTTTTGTAGAGATGGGGGTGGG + Intronic
1167742288 19:51330977-51330999 CCTTTTGGAAAGGTGAGGGTTGG - Intergenic
1167872729 19:52386622-52386644 TTTTTAGTAGAGATGGGGTTTGG - Intergenic
1167923399 19:52803252-52803274 TTTTTAGTAGAGATGGGGTTTGG + Intronic
1167989610 19:53347218-53347240 CTTTTTGTATATTTGTGGGTTGG + Intronic
1168028421 19:53660848-53660870 TTTTTTGTAGAGACGGGGGCAGG - Intergenic
1168090958 19:54083647-54083669 TTTTTTGTAGAGATGGGATTAGG - Intergenic
1168142339 19:54396882-54396904 TTTTTTGTAGAGATGGGGTTTGG - Intergenic
1168234236 19:55051907-55051929 TTTTTTGTAGAAATGGGGTTTGG + Intronic
1168260304 19:55189814-55189836 TTTTTTGTAGAGATGGAGGTCGG - Intronic
1168443547 19:56392286-56392308 CTTTTTGTATATTTGGCGGTTGG - Intronic
1168530087 19:57120241-57120263 TTTTTTGTAGAGATGGGTGGGGG - Intronic
1168542406 19:57224084-57224106 TTTTTTGTAGAGATGGGGTCTGG - Intergenic
1202685839 1_KI270712v1_random:49149-49171 TTTTTAGTAGAGATGGGGTTTGG - Intergenic
925530519 2:4855756-4855778 ATTTTTCTATAGATTGGGGTAGG - Intergenic
925609560 2:5692215-5692237 TGCTTTGCAAAGATGGGGGTGGG - Intergenic
926190682 2:10725234-10725256 TTTTTAGTAGAGATGGGGTTTGG - Intronic
926243710 2:11106652-11106674 TTTTTTGTAGAGATGGAGGGCGG - Intergenic
926289842 2:11519958-11519980 TTTTCTGTAGAGATGGGGTTTGG - Intergenic
927144575 2:20154277-20154299 CTTTTTGTAGGGATGGGGACTGG - Intergenic
927233898 2:20852195-20852217 TTTTTAGTAGAGATGGGGTTTGG - Intergenic
927545926 2:23952754-23952776 TTTTTTGTAGAGATGGGGTCTGG + Intronic
927602407 2:24455494-24455516 TTTTTAGTAGAGATGGGGGGGGG + Intergenic
927785544 2:25971902-25971924 TTTTTTGTAGAGATGGGGTCTGG + Intronic
928294742 2:30072993-30073015 CTTTTTGTAGAGATGGGCCCAGG + Intergenic
928299714 2:30114444-30114466 ATTTTTGTAGAGATGGCAGTGGG + Intergenic
928436371 2:31257173-31257195 CTGTTTGCAGAGGTGGGGGTTGG + Intronic
928813893 2:35265559-35265581 CTTTTGGGAAAGTTGAGGGTTGG - Intergenic
929051519 2:37841001-37841023 CTTCATCTAAAGATGAGGGTAGG + Intergenic
929695642 2:44113046-44113068 TTTTTAGTAGAGATGGGGTTTGG + Intergenic
929950773 2:46408144-46408166 CTTTTTGTAATGATCGGATTGGG + Intergenic
929973689 2:46610161-46610183 CTTATGGGAAAGATGGGGTTAGG - Intronic
930065237 2:47322842-47322864 TTTTTTGTAAAGATTGGCGGGGG - Intergenic
930085157 2:47491560-47491582 ATTTTTTTAGAGACGGGGGTGGG - Intronic
930234487 2:48875668-48875690 CTTTAGGTAGAGATGGGGGAAGG + Intergenic
930688917 2:54338975-54338997 TTTTTAGTAGAGATGGGGGGGGG - Intronic
931311936 2:61089987-61090009 TTTTTTGTAGAGATGGGGTCTGG - Intronic
931421753 2:62134586-62134608 TTTTTTGTAGAGATGGGGGTAGG - Intronic
931543583 2:63355709-63355731 ATTTCAGTAGAGATGGGGGTTGG - Intronic
931913235 2:66925133-66925155 TATTTTGTAAAGAGGTGGGTAGG - Intergenic
932245594 2:70193641-70193663 TTTTTTGTAGAGATTGGGGGTGG + Intronic
932247487 2:70207730-70207752 TTTTTAGTAGAGATGGGGGGGGG + Intronic
932253432 2:70264140-70264162 TTTTTTGTAGAGATGAGGTTTGG + Intronic
932259478 2:70315066-70315088 CTTTTTTTAAAGATGGGATCCGG - Intergenic
932705167 2:74019079-74019101 TTTTTTGTAGAGATGAGGGTTGG - Intronic
933652403 2:84859936-84859958 TTTTTTGGAGAGATGGGGGGGGG + Intronic
933698951 2:85240592-85240614 TTTTTAGTAGAGATGGGGTTTGG - Intronic
934084150 2:88495725-88495747 GTTTTTTTAAGTATGGGGGTAGG + Intergenic
934295886 2:91742579-91742601 CCTTTGGTTAGGATGGGGGTAGG + Intergenic
934744940 2:96753216-96753238 ACTTTTGTAGAGATGGGGGCGGG + Intergenic
934841309 2:97625891-97625913 TTTTTAGTAGAGATGGGGTTGGG + Intergenic
934964709 2:98710635-98710657 TTTTTAGTACAGATGGGGGGCGG + Intronic
935206606 2:100901794-100901816 CTCTTTGTAAAGGTGTGGGTGGG - Intronic
935520333 2:104096574-104096596 ATTTTTGTAGAGATGAGGTTTGG - Intergenic
935733371 2:106085023-106085045 CTCTTTAAAAAGATGGCGGTAGG - Intergenic
935846115 2:107167140-107167162 TTTTTAGTAGAGATGGGGTTTGG + Intergenic
936745668 2:115573731-115573753 CTTTTAGTAGAGACGGGGTTTGG + Intronic
937172942 2:119895460-119895482 CTTTTAGTAGAGACGGGGTTTGG - Intronic
937190543 2:120093082-120093104 GATTTTGTAGAGATAGGGGTGGG - Intronic
937217427 2:120321545-120321567 TTTTTTGTAGAGATGGGGTGAGG + Intergenic
937730169 2:125221303-125221325 TTATTTGTAAAAATGGGTGTTGG + Intergenic
937841806 2:126532070-126532092 TTTTTTGTAGAGATGGGATTTGG - Intergenic
939139724 2:138339947-138339969 TTTTTTGTAAAGACGGGGTTTGG - Intergenic
939365703 2:141228101-141228123 TTTTTGGTAGAGATGGGGTTTGG + Intronic
939454805 2:142420410-142420432 TTTTTAGTAGAGATGGGGGTGGG + Intergenic
939528742 2:143329911-143329933 TTTTTTGTAGTGATGGGGGTTGG - Intronic
939611968 2:144321783-144321805 TTTTTTGTAGAGATGGGGTCTGG + Intronic
940427989 2:153552755-153552777 TTTTTTTAAAAGATGGTGGTTGG + Intergenic
940850627 2:158684949-158684971 TTTTTAGTAGAGATGGGGTTTGG - Intergenic
940943575 2:159590728-159590750 CTAATTGCAAAGATGGGGGTGGG + Intronic
941225569 2:162842714-162842736 CTTTTTCTATAGATGGGGTCTGG + Intergenic
941389006 2:164888901-164888923 TTTTTTGTAGAGATGGGGTGGGG + Intergenic
941612925 2:167683541-167683563 TTTTTTGTAGAGATGGAGTTTGG - Intergenic
942050865 2:172139515-172139537 TTTTTTGTAGAGATGGGGTTTGG + Intergenic
942317868 2:174711162-174711184 TTTTTAGTAAAGATGGGGTTTGG - Intergenic
942657779 2:178231839-178231861 CTTTTTGTAGAGATAGGGTCTGG + Intronic
942859748 2:180595456-180595478 TTTTTTGTAAAGATGGGGTCTGG + Intergenic
944069463 2:195653020-195653042 ATTTTTCCACAGATGGGGGTGGG - Intronic
944070831 2:195666637-195666659 TTTTCTGTAGAGATGGGGTTTGG + Intronic
944260369 2:197669522-197669544 GTTTTTCTACAGATGTGGGTGGG + Intronic
944400197 2:199317119-199317141 CTTTTTTTAAAGATCAGGGTGGG + Intronic
944562419 2:200953994-200954016 TTTTTTGTAGAGATGGGATTTGG + Intronic
944629325 2:201607477-201607499 TCTTTTGTAGAGATGGGGGCCGG - Intronic
944721544 2:202427798-202427820 TTTTTTGTAGAGATGGGGTTTGG - Intronic
945183841 2:207119878-207119900 CTTTTAGTAGAGACGGGTGTTGG + Intronic
945438234 2:209844769-209844791 TTTTTTGTAGAGATGGGGGTGGG + Intronic
945906050 2:215594464-215594486 TTTTTTGTAGAGATGGAGTTTGG - Intergenic
946383463 2:219365751-219365773 ATTTTTGTATAGATGGGGTTTGG + Intergenic
946853854 2:223933782-223933804 TTTTTTGTAGAGATGGGGGGGGG - Intronic
946941111 2:224771111-224771133 GTTTTTGTAGAGACGGGGGAAGG + Intronic
947214971 2:227741940-227741962 ATTTTTGTAGAGATGGGGTCTGG - Intergenic
947234903 2:227930546-227930568 TTTTTTGTAGAGATGAGGGCTGG + Intergenic
948445860 2:238032435-238032457 TTTTTTGTAGAGATGGGGTTTGG - Intronic
948459337 2:238121573-238121595 TTTTTTGTAGAGACGGGGTTTGG + Intronic
948670054 2:239562545-239562567 TTTTTAGTAGAGATGGGGTTTGG + Intergenic
948877656 2:240838598-240838620 TTTTTAGTAGAGATGGGGTTTGG - Intergenic
1169104254 20:2980676-2980698 TTTTTTGTAGAGATGGGGGGAGG - Intronic
1169234088 20:3914785-3914807 ATTTTAGTAGAGATGGGGTTTGG + Intronic
1169643523 20:7782031-7782053 TTTTTTGTAGGGATGGGGTTTGG - Intergenic
1169846071 20:9993065-9993087 TTTTTAGTAGAGATGGGGATGGG + Intronic
1169897407 20:10518745-10518767 TTTTTTGTAGAGACGGGGTTTGG + Intronic
1170619051 20:17978953-17978975 TTTTTAGTAGAGATGGGGTTTGG + Intronic
1170945282 20:20885783-20885805 TTTTTAGTAGAGATGGGGTTTGG - Intergenic
1171875399 20:30570608-30570630 CTTTTTAAAAAAGTGGGGGTGGG + Intergenic
1171996860 20:31738225-31738247 TTTTTAGTAGAGATGGGGGGGGG + Intergenic
1172068865 20:32241620-32241642 CTTTTGGTAGAGATGGAGGGGGG - Intergenic
1172261699 20:33572181-33572203 ATATCTGTAAAGATGGTGGTAGG + Intronic
1172367679 20:34362588-34362610 TTCTTTGTAGAGATGGGGATGGG - Intergenic
1172410528 20:34718681-34718703 TTTTTAGTAGAGATGGGGTTTGG + Intronic
1172432066 20:34900350-34900372 TTTTTAGTAGAGATGGGGTTTGG + Intronic
1172480936 20:35271027-35271049 CTTTTTTTTAAGATGGAGTTTGG - Intronic
1172523838 20:35585537-35585559 CTTTTTGTAGAGATGGGGTTTGG + Intergenic
1172986283 20:38993535-38993557 TTTTTAGTAGAGATGGGGTTTGG + Intronic
1173259672 20:41422466-41422488 TTTTTTGTAGACATGGGGGGTGG - Intronic
1173508847 20:43610111-43610133 TTTTTAGTAGAGATGGGGGTTGG - Intronic
1173515426 20:43662345-43662367 TTTTTTGTACAGACGGGGGCGGG + Intergenic
1173527814 20:43746237-43746259 CATTTAGTAAAAATGGGAGTGGG + Intergenic
1173636385 20:44562431-44562453 ATTTTTGTAGAGATGGCGTTTGG - Intronic
1173729733 20:45319873-45319895 TTTTTTGTAGAGATGGGGGAGGG - Intergenic
1173791809 20:45832962-45832984 TTTTTTGTAGAGATGGGATTTGG - Intronic
1173952982 20:47007794-47007816 TTTTTTGTAGAGACGGGGGGTGG + Intronic
1174088357 20:48026549-48026571 TTTTTTGTAGAGATGGGGTCTGG + Intergenic
1174208360 20:48857593-48857615 TTTTTTGTAAAGATGAGGCGAGG - Intergenic
1174346178 20:49931856-49931878 TTTTTTGTAGAGATGGGGGAGGG + Intergenic
1174440252 20:50545846-50545868 TTTTTTGTAGAGACGGGGGGAGG - Intronic
1174465674 20:50715369-50715391 CTGATTTTAAAGATGGAGGTGGG + Intergenic
1174794803 20:53513073-53513095 TTTTTTGTAGAGATTGGGGGGGG - Intergenic
1175600957 20:60272662-60272684 CTTTGTATAAAGAAGAGGGTTGG - Intergenic
1175727379 20:61328604-61328626 TTTTTAGTAAAGATGGGGTTTGG - Intronic
1176362665 21:6011292-6011314 CTTTTAGTAGAGATGGGGTTTGG + Intergenic
1178311366 21:31532776-31532798 TTTTTTGTAGAGATGGGATTTGG - Intronic
1178415932 21:32405116-32405138 ATTTTTCCAAAGATGGGGGTTGG + Intergenic
1178847051 21:36182649-36182671 TTTTTTGTAGAGATGGGGTCTGG - Intronic
1179109865 21:38437321-38437343 CTCTTTGGACAGGTGGGGGTGGG + Intronic
1179677169 21:42991305-42991327 TTTTTTGTAGAGATGGGGTCTGG - Intronic
1179760853 21:43527253-43527275 CTTTTAGTAGAGATGGGGTTTGG - Intergenic
1179776002 21:43663039-43663061 TTTTTTATAATGATGGGGTTAGG + Intronic
1179932952 21:44583017-44583039 TTTTTAGTAGAGATGGGGTTTGG + Intronic
1180284507 22:10731367-10731389 ATTTTTATAGAGATGGGGGCAGG - Intergenic
1180884133 22:19227773-19227795 TTTTTTGTAGAGATGGGGTTTGG + Intronic
1181311684 22:21948310-21948332 TTTTTGGTAGAGATGGGGGGTGG - Intronic
1181812218 22:25410370-25410392 CTTTTTGTAGAGATGAGGGGAGG + Intergenic
1181825156 22:25509017-25509039 CTTTTTGTAGAGATGGGATCTGG + Intergenic
1182203930 22:28603570-28603592 TTTTTTGTAGAGATGGGGTCTGG + Intronic
1182274828 22:29181184-29181206 TTTTTAGTAGAGATGGGGTTTGG - Intergenic
1182292702 22:29293740-29293762 TTTTTAGTAGAGATGGGGTTTGG + Intronic
1182540797 22:31040384-31040406 TTTTTTGTAGAGATGGGAGGGGG + Intergenic
1182729233 22:32474305-32474327 TTTTTTGTAGAGATGGGGGGGGG + Intergenic
1182869291 22:33632299-33632321 TTTTTAGTAGAGATGGGGTTTGG + Intronic
1183449031 22:37880581-37880603 TTTTTAGTAGAGATGGGGTTTGG + Intronic
1183496285 22:38146212-38146234 TTTTTAGTAGAGATGGGGTTTGG + Intronic
1183652336 22:39164397-39164419 TTTTTTGTAGAGATAGGGTTTGG + Intergenic
1184018668 22:41805251-41805273 TTTTTAGTAGAGATGGGGTTTGG - Intronic
1184706306 22:46215943-46215965 ATTTTTCCACAGATGGGGGTGGG - Intronic
1185177704 22:49339067-49339089 TTTTTAGTAGAGATGGGGTTTGG - Intergenic
949916713 3:8970411-8970433 CTTTTGGTAGAGACTGGGGTGGG - Intergenic
949967265 3:9368192-9368214 ATTTTTTAAAAGAGGGGGGTGGG - Intronic
950038605 3:9904914-9904936 TTTTTTGTAGAGATGGGGTTTGG - Intronic
950298895 3:11856881-11856903 TTTTTAGTAGAGATGGGGGATGG + Intergenic
950389956 3:12688842-12688864 TTTTTTGTAGAGATGGGGACTGG - Intergenic
950511693 3:13432744-13432766 TTTTTAGTAGAGATGGGGTTTGG - Intergenic
950750580 3:15124754-15124776 CTTTTAGTAGAGATGAGGTTTGG + Intergenic
951209355 3:19957473-19957495 TTTTTAGTAAGGATGGGGTTTGG - Intronic
951305703 3:21058574-21058596 CTTTTTTTTTCGATGGGGGTTGG + Intergenic
951645942 3:24891550-24891572 ATATTTATAGAGATGGGGGTGGG - Intergenic
952136435 3:30427544-30427566 TTTTTTGTAGAGATGGGGCCTGG - Intergenic
952186035 3:30969631-30969653 CTATTTGAAAAGATGAGGGAAGG - Intergenic
952923138 3:38300988-38301010 GTTTTTTTAGAGATGGGGGTTGG + Intronic
953083665 3:39645745-39645767 CTTTTTATAAACATGAGGTTGGG - Intergenic
953332222 3:42063388-42063410 TCTTTTGTAAAGGTGGGGCTGGG + Intronic
953371696 3:42393968-42393990 TTTTTAGTAGAGATGGGGTTTGG + Intergenic
954025932 3:47782864-47782886 TTTTTTGTAGAGACGGGGATGGG - Intergenic
954104262 3:48400949-48400971 GTTTTCGTAAAGATGGGGTCTGG + Intronic
954184132 3:48903963-48903985 TTTTTTTTAAAGATGTGGGGGGG - Intergenic
954300629 3:49699110-49699132 CATTTTGTGAAGATGGCTGTGGG + Intronic
955217894 3:56999626-56999648 ATTTTTGTAGAGATGGGGTCTGG - Intronic
955372753 3:58367860-58367882 TTTTTTATAGAGATGGGGTTTGG + Intronic
955386575 3:58485661-58485683 TTTTTTGTAGGGATGGCGGTGGG + Intergenic
955541652 3:59983114-59983136 TTTTTTGTAGACATGGGGTTTGG + Intronic
955898854 3:63730340-63730362 CTTTTTGTGAGGAATGGGGTAGG - Intergenic
956089356 3:65649202-65649224 ATTTTTTTAGAGATTGGGGTGGG - Intronic
956696961 3:71926703-71926725 CTGTTTCTAAAGATGTGGGCAGG + Intergenic
957297503 3:78352016-78352038 CTCTTTTTACAGTTGGGGGTGGG - Intergenic
958501720 3:94919245-94919267 TTTTTAGTAGAGATGGGGTTTGG + Intergenic
958738161 3:98034097-98034119 CTTTTTGGAAATATGGTGCTTGG + Intronic
958892932 3:99800586-99800608 TTTTTAGTAGAGATGGGGTTGGG - Intergenic
958946816 3:100371735-100371757 ATTTTTGCATGGATGGGGGTAGG + Intronic
958987717 3:100801850-100801872 CTTTTTGTCAAAATAGGAGTTGG - Intronic
959401456 3:105907041-105907063 CTTCCTGTAAAGAAGGGTGTGGG - Intergenic
959848757 3:111063912-111063934 ATTTTTGTAGAGATGGGGGGGGG - Intergenic
959852457 3:111105308-111105330 TTTTTTGTAGAGATGGGGTTTGG + Intronic
960212408 3:114985979-114986001 CTTTGTTTACAGAAGGGGGTGGG + Intronic
960235387 3:115275869-115275891 ATTTTTTTAAAGATGGGAGTAGG + Intergenic
960923231 3:122769856-122769878 TTTTTAGTAGAGATGGGGTTTGG + Intronic
961653944 3:128431295-128431317 TTTCTTGTAGAGGTGGGGGTGGG + Intergenic
961941263 3:130639513-130639535 TTTTTTGTAGAGATGGGGTTTGG - Intronic
962120214 3:132553192-132553214 TTTTTTGTAGAGATGGGGTTTGG + Intergenic
962353300 3:134672094-134672116 CATTTTTTACAGATGGGGTTTGG - Intronic
962406034 3:135100912-135100934 CCTTTTCTGAAGTTGGGGGTGGG + Intronic
962578397 3:136775323-136775345 TTTTTAGTAGAGATGGGGGGGGG + Intergenic
963707695 3:148708770-148708792 GTTTTTGTAAGGAGGGGCGTGGG - Intronic
964020187 3:152000705-152000727 TGTTTTATAAAGATGGGGATAGG + Intergenic
964020418 3:152003663-152003685 TGTTTTATAAAGATGGGGATAGG - Intergenic
964458777 3:156897773-156897795 GTTTTAGTAAAGATGAGGTTTGG - Intronic
964494392 3:157272640-157272662 ATTTTTGTAGAAATGGGGTTAGG + Intronic
965596200 3:170413818-170413840 TTTTTTATAGAGATGGGGGAGGG - Intergenic
966175420 3:177133106-177133128 TTTTTAGTAGAGATGGGGTTTGG - Intronic
966393963 3:179482078-179482100 TTTTTTGTAGAGACGGGGTTTGG + Intergenic
966444597 3:179987656-179987678 CTTTTTGTAAGGTTGGGGGTAGG - Intronic
966613664 3:181892305-181892327 CTTTTTTTAAAGAAGAGGGCCGG - Intergenic
966831702 3:184015953-184015975 CCTTTTTAAAAGGTGGGGGTTGG + Intronic
966833449 3:184030866-184030888 CTTTTTTGAAAGATGGCAGTAGG + Intergenic
966890435 3:184403762-184403784 TTTTTTGTAAAGATGGGGGGGGG + Intronic
967078695 3:186028791-186028813 CTTTTTGTAGGGATGGGGTCTGG + Intergenic
967184687 3:186934377-186934399 TTTTTTGTAGAGATGGCGGTGGG - Intronic
967292906 3:187938869-187938891 TTTTTTGTACAGATGGTGGGGGG + Intergenic
967892758 3:194374869-194374891 TTTTTAGTAGAGATGGGGTTTGG + Intergenic
967940665 3:194763779-194763801 TTTTTAGTAGAGATGGGGTTAGG + Intergenic
968124804 3:196151108-196151130 TTTTTAGTAGAGATGGGGGGTGG - Intergenic
968348806 3:198035021-198035043 TTTCTTGTAGAGATGGGGTTTGG - Intronic
969738446 4:9006594-9006616 CTTTTAGTAGAGATGAGGTTTGG + Intergenic
969931250 4:10633113-10633135 TTTTTAGTAGAGATGGGGTTTGG + Intronic
970845273 4:20530392-20530414 CTTCTTGGGGAGATGGGGGTGGG - Intronic
971312585 4:25538158-25538180 TTTTTAGTAGAGATGGGGTTTGG + Intergenic
971453097 4:26818404-26818426 TTTTTTGTAGAGATGGGGGTGGG + Intergenic
971725221 4:30303476-30303498 CTTTTAGTAGAGACGGGGTTTGG - Intergenic
972319090 4:37956186-37956208 TTTTTTGTAGAGATGGGAGCGGG + Intronic
972546512 4:40085219-40085241 TTTTTAGTAGAGATGGGGTTTGG + Intronic
972559703 4:40215740-40215762 TTTTTAGTAGAGATGGGTGTTGG - Intronic
972648430 4:40992348-40992370 TTTTTGGTAGAGATGGGGGGGGG + Intronic
972685467 4:41348469-41348491 GTTTTTGTAGAGATGGGTGGGGG + Intergenic
972765415 4:42149456-42149478 CTTGTTGGAAAGATGGGAATTGG - Intronic
973242650 4:47973242-47973264 ATTTTTGTAGAGATGGGGTGTGG + Intronic
973751091 4:54021821-54021843 CTTTTTTTAATGTTGGGAGTGGG - Intronic
973932278 4:55805145-55805167 ATTTTTGTAATGATGGGGAGTGG + Intergenic
973950670 4:56010183-56010205 TTTTTAGTAGAGATGGGGGTGGG - Intronic
974735886 4:65931539-65931561 TTTTTTGTAGAGATGGAGTTTGG + Intergenic
974910241 4:68108839-68108861 GTATTTGTAAGTATGGGGGTAGG + Intronic
975056318 4:69935359-69935381 TTTTTTGTAGAGACGGGGTTTGG - Intronic
975091710 4:70411718-70411740 TTTTTTGTAGAGATGGGGTCTGG - Intergenic
975641091 4:76500984-76501006 TATTTTGTAGAGATGGGGGGTGG + Intronic
975743264 4:77451213-77451235 ATTTTTGAATACATGGGGGTGGG + Intergenic
975919706 4:79370589-79370611 TTTGTTGTAATGATGGAGGTGGG - Intergenic
976223585 4:82777925-82777947 CTATTTGTAAATAGGGGGCTAGG - Intronic
976626625 4:87191289-87191311 CTTTTTGTAGAGAGGGGGTTTGG - Intronic
976670143 4:87643233-87643255 TTTTTTGTAGAGATGGGGGCTGG - Intergenic
976670714 4:87649757-87649779 CTTTGTGTGTATATGGGGGTGGG + Intergenic
976818737 4:89180512-89180534 TTTTCTGTAGAGATGGGGCTTGG + Intergenic
977021212 4:91762722-91762744 ATTTTTGTATAGAAGGGCGTGGG - Intergenic
977092033 4:92689666-92689688 ATGTTTCTAAAGATGGGGGTGGG - Intronic
978304044 4:107302722-107302744 AATTTTGTAGAGATGGGGTTTGG - Intergenic
978510846 4:109515870-109515892 TATTTGGTAGAGATGGGGGTGGG - Intronic
979024347 4:115549106-115549128 TTTTTTCTAAGGCTGGGGGTGGG - Intergenic
979269386 4:118742360-118742382 CTTTTTGGAAAAGTGGGGGGGGG + Intronic
979343996 4:119563796-119563818 CTGTTTGTAAAAATGGGGACTGG + Intronic
979964420 4:127060927-127060949 CTTTTGGTACACATGGGGATTGG - Intergenic
980554183 4:134381538-134381560 TTTTTAGTAGAGATGGGGTTTGG + Intergenic
980718875 4:136666679-136666701 CTTTTTAAAAATATGGGGCTTGG + Intergenic
980833139 4:138155689-138155711 TTTTTAGTAGAGATGGGGTTTGG + Intergenic
981098969 4:140810323-140810345 CTTTTTGTAGAGACAGGGTTTGG + Intergenic
982220849 4:153124028-153124050 CTTTTTGCAAGCATGAGGGTAGG - Intergenic
982696127 4:158603107-158603129 TTGTTTGTAGAGATGGCGGTGGG + Intronic
982776612 4:159448333-159448355 TTTTTAGTAGAGATGGGGTTTGG - Intergenic
983365283 4:166778834-166778856 CTGTTTTTTAAGTTGGGGGTAGG + Intronic
983550469 4:169012114-169012136 TTTTCTGTAGAGATGGGGGTCGG - Intergenic
984488034 4:180397404-180397426 TTTTTAGTAGAGATGGGGTTTGG + Intergenic
984850417 4:184147621-184147643 CGTTTTGTAGAGATGGGCATGGG - Intronic
984972284 4:185202369-185202391 TTTTTTGTAGAGGTGGGGTTTGG - Intronic
985112570 4:186561134-186561156 TTTTTTGTAGAGACGGGGATGGG - Intergenic
985689056 5:1296965-1296987 TTTTTAGTAGAGACGGGGGTGGG - Intergenic
986607063 5:9533003-9533025 CTATTTGTAAGCATGGGGGTTGG - Intronic
986744084 5:10729299-10729321 CTATTTTCAAAGATGGTGGTGGG - Intronic
987104363 5:14622849-14622871 TTTTTAGTAGAGATGGGGTTTGG - Intergenic
987205703 5:15622880-15622902 TTTTTAGTAGAGATGGGGTTTGG + Intronic
987309909 5:16672115-16672137 TTTTTAGTACAGATGGGGTTTGG - Intronic
987320949 5:16768851-16768873 TTTTTAGTAGAGATGGGGTTTGG + Intronic
987841049 5:23223115-23223137 TTTTTAGTAGAGATGGGGTTGGG - Intergenic
988367514 5:30319804-30319826 CTTTTAGTAAAAATGAGTGTTGG + Intergenic
988574288 5:32404993-32405015 TTTTTGGTAAAGATGGGATTTGG + Intronic
989060996 5:37411546-37411568 TTTTTAGTAGAGATGGGGTTTGG - Intronic
989374739 5:40748946-40748968 TTTTTAGTAGAGATGGGGTTTGG - Intronic
989472487 5:41836558-41836580 CTTTTTCCACAGATGGGGGTTGG + Intronic
989627949 5:43450169-43450191 TTTTTTGTAGAGATGGGGTCTGG + Intronic
989659895 5:43788155-43788177 CTTTTTCTAATGTTGGGAGTGGG - Intergenic
989834254 5:45965119-45965141 CTTTTTGTAGAGTTGGCGATGGG + Intergenic
990369954 5:55107690-55107712 CCATTTGTAAATATGGAGGTGGG - Intronic
990533519 5:56697409-56697431 TTTTTAGTAGAGATGGGGGGGGG - Intergenic
990806737 5:59671628-59671650 TTTTTTGTAGAGAAGGGGTTTGG - Intronic
991065451 5:62419814-62419836 CTTTTTGTAGAGATGGGGTCTGG - Intronic
991349397 5:65705268-65705290 CTTTTTGTTGAGATGAGGGGGGG - Intronic
991625242 5:68594299-68594321 ATTTTTCCACAGATGGGGGTGGG - Intergenic
991706950 5:69367720-69367742 ATTTTTGTAGAGACGGGGTTTGG + Intronic
992234697 5:74697546-74697568 TTTTTAGTAGAGATGGGGTTTGG - Intronic
992252979 5:74894149-74894171 TTTTTAGTAGAGATGGGGGTTGG + Intergenic
992756227 5:79908985-79909007 ATTTTTGTAGAGATTGGGGTGGG + Intergenic
993085253 5:83355813-83355835 TTTTTAGTAGAGATGGGGTTTGG + Intergenic
993148532 5:84128614-84128636 CCTTTTGTAAGGGTGAGGGTTGG + Intronic
993334439 5:86640137-86640159 ATTTTTGTAAAGAGGAGGGAGGG + Intergenic
993438917 5:87930987-87931009 CTTTTAGTATAGTTTGGGGTTGG - Intergenic
993469105 5:88285331-88285353 TTTTTTGTACAGATGGGGGGAGG - Intergenic
993574120 5:89580413-89580435 ATTTTTGTAGAGGTGGAGGTGGG + Intergenic
993663721 5:90669417-90669439 CTTATGGAAAAGATGGGGTTAGG + Intronic
993855261 5:93066379-93066401 ATTTTTCCACAGATGGGGGTTGG - Intergenic
994182974 5:96787750-96787772 CCTTTTGGGAAGATGGGGGAGGG + Intronic
994329462 5:98488612-98488634 ATTTTTATACAGATGGGGGTGGG + Intergenic
995280260 5:110327092-110327114 TTTTTTGTAAAGATGGTGTCTGG + Intronic
995608386 5:113882585-113882607 TTTTTGGTAGAGATGGGGTTTGG + Intergenic
996311425 5:122110596-122110618 CTTTTATTAAAGTTGGGGATTGG - Intergenic
996506654 5:124275577-124275599 TTTTTTGTGGAGATGGGGGCTGG - Intergenic
996526240 5:124482940-124482962 TTTTTAGTAGAGATGGGAGTTGG + Intergenic
996559836 5:124816821-124816843 CTTTTTGTAGAGATAGGGGGTGG - Intergenic
997317237 5:132947223-132947245 GTTTTAGTAGAGATGGGGTTTGG - Intronic
997506786 5:134424014-134424036 TTTTTAGTAGAGATGGGGTTTGG - Intergenic
997508098 5:134434334-134434356 TTTTTAGTAGAGATGGGGTTTGG - Intergenic
997810604 5:136964005-136964027 CTTTGTGTACAGATGGGTGGAGG + Intergenic
998013558 5:138714619-138714641 TTTTTTGAAGAGATGGGGGGGGG + Intronic
998162803 5:139822887-139822909 CTTTTTGAAGCGGTGGGGGTTGG + Intronic
998212732 5:140212787-140212809 TTTTTTGTAGAGATGGAGTTTGG - Intronic
998257860 5:140602584-140602606 ATTTTTGTAGAGATGGGGTTTGG - Intergenic
999128354 5:149263752-149263774 TTTTTTGTAGAGATGAGGGGGGG + Intergenic
999229028 5:150050656-150050678 GTTTTAGTAGAGATGGGGTTTGG + Intronic
999456806 5:151723682-151723704 TTTTTAGTAGAGATGGGGTTTGG + Intergenic
1000245327 5:159444255-159444277 TTATTTGTAGAGATGGGGGTGGG - Intergenic
1000405406 5:160882457-160882479 TTTTTTGTAGAGATGGGGTCTGG + Intergenic
1000470321 5:161631886-161631908 GTTTTTGTAGAGATGAGGTTTGG + Intronic
1001291829 5:170469035-170469057 CTTTGTTTAAAAATGGGGCTGGG - Intronic
1001644796 5:173272019-173272041 TTTTTTGTAGAGATGGGGGTGGG + Intergenic
1001792917 5:174475722-174475744 CCTTCTGCAAATATGGGGGTTGG - Intergenic
1001968057 5:175927862-175927884 ATTTTTATCAAGATGGAGGTTGG - Intronic
1002148758 5:177208871-177208893 TTTTTAGTAGAGATGGGGTTTGG + Intronic
1002283127 5:178144848-178144870 TTTTTTGTAGAGATGGGAGCAGG - Intronic
1002383712 5:178850008-178850030 TTTTTAGTAGAGATGGGGTTTGG + Intergenic
1002504066 5:179666641-179666663 TTTTTTGTAAAGATGGAGTCTGG + Intergenic
1002608945 5:180401233-180401255 TTTTTTGTAGATATGGGGTTTGG + Intergenic
1002712104 5:181201584-181201606 TTTTTTGTAGAGCTGGGGTTGGG - Intronic
1003433331 6:6060719-6060741 TTTTTAGTAGAGACGGGGGTGGG + Intergenic
1003526205 6:6899759-6899781 TTTTTTGTAGGGATGGGGTTTGG - Intergenic
1003530882 6:6936511-6936533 CTCTTTACAAAGATGGGGGCAGG - Intergenic
1003751571 6:9064252-9064274 CTTTTTGTCAAGAAGAGGGTGGG - Intergenic
1004201530 6:13553272-13553294 TTTTTAGTACAGATGGGGTTTGG - Intergenic
1004675931 6:17842226-17842248 TTTTTTGTAGAGATGGGGTCTGG + Intronic
1004780752 6:18905860-18905882 CTATTTATAAAGATGGAGGTAGG - Intergenic
1005138519 6:22599787-22599809 CTTTTTGTAAAGGTGTGGCAAGG + Intergenic
1005416468 6:25605178-25605200 ATTTTGGAAAAGTTGGGGGTGGG + Intronic
1005459815 6:26057126-26057148 CTCTTTTCATAGATGGGGGTGGG + Intergenic
1005580334 6:27228197-27228219 TTTTTAGTAGAGATGGGGGGGGG - Intergenic
1005963381 6:30709210-30709232 TTTGTTGTAGAGATGGGGTTTGG + Intronic
1006324438 6:33342782-33342804 TTTTTAGTAAAGATGGGGTTTGG + Intergenic
1006465466 6:34191493-34191515 TTTTTGGTAGAGATGGGGTTTGG - Intergenic
1006468831 6:34214082-34214104 TTTTTTGTAGAGATGGGGGAAGG - Intergenic
1006599807 6:35217831-35217853 CCTTCTGGAAAAATGGGGGTGGG - Intronic
1006680003 6:35790102-35790124 ATTTTTGTAGAGATGGGGAGGGG + Intronic
1007477261 6:42127130-42127152 TTTTTTGTAGAGATGGGGTTGGG + Intronic
1007594372 6:43042516-43042538 TTTTTAGTAGAGATGGGGTTTGG + Intronic
1007912533 6:45530215-45530237 CTTTTTATTAAAATGGTGGTAGG - Intronic
1008512489 6:52289691-52289713 TTTTTTGTAGAGATGGGGTCTGG + Intergenic
1008626143 6:53318559-53318581 GTTTTTGTAGAGATGGGGCGGGG - Intronic
1008958253 6:57239562-57239584 TTTTTTGTAGAGATGGGATTTGG - Intergenic
1008990868 6:57599963-57599985 TTTTTTGTAGAGATGGGTTTTGG + Intronic
1009179388 6:60498197-60498219 TTTTTTGTAGAGATGGGTTTTGG + Intergenic
1010123977 6:72411713-72411735 TTTTTTTTAGAGATGGGGGTCGG + Intergenic
1010234999 6:73567847-73567869 TTTTTAGTAGAGATGGGGTTTGG + Intergenic
1010468737 6:76200030-76200052 CTTTCTGTCAGGATGGGGGTGGG + Intergenic
1010979113 6:82349866-82349888 CTTGTTAGAAAGATGGGGGTGGG + Intergenic
1011362236 6:86539871-86539893 TTTTTTGTAGAGGTGGGGTTTGG - Intergenic
1011655819 6:89551155-89551177 CTTCTTGTTAGGAAGGGGGTGGG + Intronic
1012372061 6:98519850-98519872 GTATTTGAAAAGATGGGAGTTGG + Intergenic
1012673270 6:102083856-102083878 CTTTTAGTAGAGATGGCGGGGGG + Intergenic
1012903932 6:105042127-105042149 CTTGTGGTTTAGATGGGGGTGGG - Intronic
1013113569 6:107083440-107083462 TCTTTTGTAGAGATGGGGTTTGG - Intronic
1013247117 6:108297401-108297423 TTTTATTTAAAGATGGGGGCAGG - Intronic
1013562021 6:111315025-111315047 ATTTTTGTAGAGATGGGGTCTGG + Intronic
1013605433 6:111743142-111743164 TTTTTAGTAGAGATGGGGTTTGG + Intronic
1014552660 6:122807068-122807090 CCTATTGTAGAGATGGGGGGGGG + Intronic
1014734716 6:125078877-125078899 CTATTTGTGGAGATGGGGGAGGG - Intronic
1014919000 6:127190249-127190271 TTTTTAGTAGAGATGGGGTTTGG - Intronic
1015146793 6:129996019-129996041 TTTTTAGTAGAGATGGGGGGGGG + Intergenic
1015394527 6:132719556-132719578 CTTTTAATAAAGAGGGGGGCAGG + Intergenic
1015634748 6:135264253-135264275 CTATTTGTGAAGATGGGCCTAGG - Intergenic
1015671978 6:135700662-135700684 TTTTTAGTAGAGATGGGGTTTGG + Intergenic
1015739526 6:136438844-136438866 CTTTTAATTAAGCTGGGGGTTGG - Intronic
1015792989 6:136982541-136982563 TTTTTTGTAGAGATGGGGATGGG - Intergenic
1015933693 6:138387196-138387218 ATTTTTGTAGAGATGGTGGGGGG - Intergenic
1016081974 6:139867226-139867248 TTTTTAGTAAAGACGGGGTTTGG - Intergenic
1016340640 6:143058814-143058836 CATTTTGTAACAATGGGGTTGGG + Intergenic
1016406989 6:143741313-143741335 TTTTTAGTAGAGATGGGGTTTGG - Intronic
1016629183 6:146207669-146207691 CTATTTTAAAAGATGGGGTTTGG - Intronic
1016947309 6:149546666-149546688 TTTTTTGTAGAGATGGCGGTCGG + Intergenic
1017269782 6:152492226-152492248 CTTTTTCTAATGTTGGGAGTGGG - Intronic
1017517245 6:155167662-155167684 GTTTTTGTAGAAATGGGGATGGG + Intronic
1017607498 6:156149392-156149414 CCTTTAGTAGAGATGGGGGTGGG - Intergenic
1018072765 6:160180119-160180141 CTTTTTGTATTGTTGGTGGTGGG + Intronic
1018176141 6:161180986-161181008 CTATCTGTAAAGATGGAGGAGGG + Intronic
1018310233 6:162500986-162501008 TTTTTTGTAAGGATGGGGTCTGG - Intronic
1018464955 6:164035477-164035499 TTTTTTGCAGAGATGGGGGAGGG + Intergenic
1018942999 6:168322123-168322145 TTTTTAGTAGAGATGGGGCTTGG + Intergenic
1018971675 6:168534072-168534094 TTTTTTGTAGAGATGGTGGGGGG - Intronic
1019004033 6:168781252-168781274 TTTCTTGTAGAGATGGGGTTTGG - Intergenic
1019228185 6:170532773-170532795 TTTTTTGTAGAGAGGGGGTTTGG + Intergenic
1019508634 7:1405988-1406010 TCTTTTGTAGAGGTGGGGGTGGG - Intergenic
1019985119 7:4650072-4650094 ATTTTTGTAGAGATTGGGGTGGG + Intergenic
1020066037 7:5189437-5189459 TTTTTTGTAGAGATGGGGTGGGG - Intergenic
1020174450 7:5871174-5871196 TTTTTTGTAGAGACGGGGGGGGG - Intergenic
1020253080 7:6484584-6484606 ATTTTTGTAGAGACGGGGGGTGG - Intergenic
1020580487 7:9993065-9993087 ATTTTTGTAGAGTTGGGGGGGGG - Intergenic
1020653466 7:10902969-10902991 CTTTTTGTAGAGATAGGGTCTGG + Intergenic
1021365349 7:19772287-19772309 CTTTGTTTAAAGGTGGGGGTGGG - Intronic
1021711479 7:23420286-23420308 ATTTTTGTAGAGATGGGGTTTGG - Intronic
1021925120 7:25526816-25526838 TTTTTTGTAAAGACAGGGTTAGG + Intergenic
1022159258 7:27692436-27692458 TTTTTTGTAGAGATGGAGTTGGG - Intergenic
1022528677 7:31053606-31053628 CCTTTTTGGAAGATGGGGGTGGG + Intronic
1022842644 7:34179471-34179493 CTATTTGTAAAGGTGTGAGTGGG - Intergenic
1023237599 7:38106849-38106871 TTTTTAGTCAAGATGGGGTTTGG - Intergenic
1023282727 7:38588129-38588151 CTTTTTCTAGAGATGGGGTTTGG + Intronic
1023317558 7:38955832-38955854 CTTTTTGAAAAGATTTGGGTTGG - Intergenic
1023428911 7:40069054-40069076 TTTTTTGTAGAGACGGGGTTTGG - Intronic
1023434122 7:40124826-40124848 TTTTTTATAGAGATGGGGCTTGG - Intergenic
1023573543 7:41599193-41599215 CTTTTTGTACAGATGGGATCGGG - Intergenic
1025099063 7:56120765-56120787 TTTTTGGTAGAGATGGGGGCGGG - Intergenic
1026157666 7:67841347-67841369 GTTTTTGTAGAGACAGGGGTAGG - Intergenic
1026185602 7:68080541-68080563 TTTTTTTTAAAGATGGAGTTTGG - Intergenic
1026191607 7:68133580-68133602 TTTTTTGTAGAGATGGGGGGGGG - Intergenic
1026326877 7:69318114-69318136 TTTTCTGTAGAGATGGGGGTGGG + Intergenic
1026631709 7:72043589-72043611 TTTTTTGTAAAGATGAGGTCTGG - Intronic
1026693450 7:72570460-72570482 TTTTTAGTAGAGATGGGGGGAGG - Intronic
1026823220 7:73563887-73563909 TTTTTTTTAGAGATGGGGGGGGG + Intergenic
1026908721 7:74079987-74080009 TCTTTTGTAGAGATGGGGGGGGG - Intergenic
1026914213 7:74110174-74110196 TTTTTTGTAGAGATGGGATTGGG - Intronic
1026920384 7:74151212-74151234 TTTTCTGTAGAGATGGGGGATGG - Intergenic
1026995312 7:74612111-74612133 TTTTTTGTAGAGATGGGATTTGG - Intergenic
1027155049 7:75761133-75761155 TTTTTTATAAAGATGGGAATAGG - Intergenic
1027185753 7:75969639-75969661 CTTTGAGTAGAGATAGGGGTTGG + Intronic
1027201732 7:76068236-76068258 TTTTTTGTAGAGACCGGGGTGGG + Intergenic
1027212628 7:76163551-76163573 TTTTTGGTAGAGATGGGGGTGGG - Intergenic
1027597963 7:80200144-80200166 TTTTTTGTAGAGATGGTGGGGGG - Intronic
1027608107 7:80325264-80325286 TATTTGGTAAAGATGGGGTTTGG - Intergenic
1027951156 7:84818035-84818057 CATTTTTTAAAGATGAGAGTGGG + Intergenic
1028317328 7:89419688-89419710 CTTATTGTAAGGATGGGAATTGG + Intergenic
1028707457 7:93866658-93866680 TTTTTTGTAGAGATGGGGTCTGG + Intronic
1029140085 7:98403009-98403031 TTTTTTGCAGAGATGGGGGTGGG - Intergenic
1029199235 7:98827495-98827517 TTTTTTGTAGAGATGGGTGGGGG - Intergenic
1029478245 7:100797947-100797969 GTTTTTGTAGAGATGGGGGCGGG + Intergenic
1029521115 7:101063151-101063173 CTTTTGGTAGAGATTGGGGCAGG - Intergenic
1029523037 7:101076419-101076441 TCTTTTGTAGAGATGGGGGGGGG - Intergenic
1029547992 7:101221399-101221421 TTTTTTGTAGAGATGGGGTTTGG + Intronic
1029598903 7:101552435-101552457 ATTTTTATAGAGATGGGGGTGGG - Intronic
1030051949 7:105545979-105546001 TTTTTAGTAGAGATGGGGGATGG + Intronic
1030272197 7:107681933-107681955 TTTTTTGTAGAGATTGGGGCGGG - Intronic
1030717986 7:112833085-112833107 TATTTTTTAAAAATGGGGGTTGG - Intronic
1031085635 7:117299163-117299185 CATAATATAAAGATGGGGGTGGG - Intronic
1031218323 7:118927396-118927418 CTTTTTGTAAGGGTTGGAGTGGG - Intergenic
1031470304 7:122160484-122160506 CTTTTATTAAAGATGGTGGATGG - Intergenic
1031502617 7:122538831-122538853 CTATTTATAACGATGGGAGTTGG + Intronic
1031648488 7:124256575-124256597 TTTTTAGTAGAGATGGGGTTTGG - Intergenic
1031991260 7:128200810-128200832 TTTTTTTTAAAGATGGGGCGGGG - Intergenic
1032062631 7:128737716-128737738 TTTTTTGTAGAGATAGGGGGAGG + Intergenic
1032064588 7:128756896-128756918 TTTTTTGTAAAGACGGGGTCTGG - Intronic
1032126483 7:129198127-129198149 TTTTTTGTAGAGATGGGGTTTGG + Intronic
1032789943 7:135235047-135235069 TTTTTTGTAGAAATGGGGTTTGG + Intronic
1033038051 7:137893470-137893492 CTTTGTGTGCAGCTGGGGGTGGG + Intronic
1033089882 7:138375798-138375820 TTTTTTGTAGAGATGGGGTCTGG - Intergenic
1033328565 7:140398962-140398984 TTTTTTGTAGAGATGGGGTCTGG - Intronic
1033360160 7:140633339-140633361 ATTTTTATAGAGATGGGGTTTGG + Intronic
1033629457 7:143142329-143142351 CTTTTTGTAGAGATTGGGCAGGG + Intergenic
1033658176 7:143387225-143387247 CTCTGGGTACAGATGGGGGTCGG + Intronic
1034214484 7:149394609-149394631 CTGTTTGTGAGGTTGGGGGTGGG - Intergenic
1034708556 7:153170546-153170568 CTTTGTGTAGAGATGGGGAGGGG + Intergenic
1034754863 7:153606766-153606788 CTTTTAGTAGAGACGGGGTTTGG - Intergenic
1035457208 7:159016345-159016367 CTTTGTTTAAAAATTGGGGTCGG - Intergenic
1035461888 7:159044941-159044963 CTTTTAGTAGAGATGGGGTGGGG + Intronic
1035825728 8:2642495-2642517 TTTTTGGTAGAGATGGGGTTTGG + Intergenic
1036397076 8:8378680-8378702 TTTTTTGTAGAGATGGGATTTGG - Intronic
1036702668 8:11023439-11023461 TTTTTTGTAGAGATGGGGTCTGG + Intronic
1036824030 8:11962468-11962490 TTTTTTATAGAGATGGGGGGAGG - Intergenic
1037041429 8:14240147-14240169 TTTTTAGTAGAGATGGGGTTTGG - Intronic
1037403697 8:18519494-18519516 CTTTATGGAAAGGTGGGGGAAGG + Intergenic
1037441914 8:18925207-18925229 TGTTTTGTAGAGATGGGGTTTGG - Intronic
1038048227 8:23785246-23785268 TTTTTAGTAGAGATGGGGTTTGG + Intergenic
1038297229 8:26305357-26305379 CTTTTTATATATATGGGGTTCGG + Intronic
1038446199 8:27605856-27605878 TTTTTTGTAAACATGGGGTTTGG - Intronic
1038642581 8:29339832-29339854 TTTTTGGTAGAGATGGGGGGGGG - Intronic
1039465008 8:37778784-37778806 TTTTTTGTAGAGACGGGGGGTGG - Exonic
1039466987 8:37791623-37791645 TTTTTAGTAGAGATGGGGGGTGG + Intronic
1039478688 8:37855771-37855793 TATTTTGTAGAGATGGTGGTGGG + Intergenic
1039520561 8:38167519-38167541 TTTTTTGTAAAGACAGGGTTTGG + Intronic
1039584611 8:38695654-38695676 CTTTTTGGTTAGATGGGGCTTGG - Intergenic
1039827992 8:41191165-41191187 ATTTTTGTAAAGTTGGGGTCTGG + Intergenic
1039997089 8:42542797-42542819 TTTTTTTTAAAGACGGGGGTGGG - Intronic
1040800960 8:51339280-51339302 TTTTTAGTAGAGATGGGGTTTGG - Intronic
1041194991 8:55392611-55392633 CTTTTTGTAGAAATAGGGTTTGG - Intronic
1041246040 8:55889378-55889400 TTTTTTGTAGAGATGGGGTTTGG + Intronic
1041255359 8:55975809-55975831 TTTTTTGGTAAGGTGGGGGTGGG + Intronic
1041913581 8:63116101-63116123 TTTTTTGTACAGATGGGGTCTGG + Intergenic
1042330855 8:67579231-67579253 TTTTTAGTAGAGATGGGGTTTGG - Intronic
1042552642 8:70007915-70007937 TTTTTTGTAGAGATGGGGTCTGG - Intergenic
1042619579 8:70690517-70690539 TATTTAGTAGAGATGGGGGTGGG + Intronic
1042737268 8:72003616-72003638 TTTTTAGTAGAGATGGGGTTTGG + Intronic
1042831564 8:73034441-73034463 TTTTTTGTAGAGGTGGGGTTTGG + Intronic
1044064953 8:87687945-87687967 CCTTTTCCACAGATGGGGGTTGG + Intergenic
1045129796 8:99138302-99138324 TTTTTAGTAGAGATGGGGTTTGG + Intronic
1045399172 8:101794401-101794423 CTTTTTTTGAGGTTGGGGGTTGG - Intronic
1045447057 8:102277555-102277577 ATTTTAGTAGAGATGGGGTTTGG + Intronic
1045460149 8:102418398-102418420 TTTTTTGTATAGATGGGGTCTGG - Intergenic
1045540937 8:103084528-103084550 TTTTTTGTAAAGATGGGGTCTGG - Intergenic
1045920293 8:107521280-107521302 TTTTTAGTAGAGATGGGGTTTGG - Intergenic
1046090203 8:109494031-109494053 GTTTTTTTAAAAATGGTGGTGGG - Intronic
1046605232 8:116364367-116364389 TTTTTTGTAGAGATGGGGTCTGG - Intergenic
1046699137 8:117380460-117380482 CATTTTGAAAATGTGGGGGTAGG - Intergenic
1046890184 8:119414366-119414388 CTTCTTGGAAAGAGTGGGGTGGG - Intergenic
1047027924 8:120844747-120844769 TTTTTTGTGGAGATGGGGTTTGG + Intergenic
1047272244 8:123373207-123373229 TTTTTTGTAGAGATGGGGCGGGG + Intronic
1047422211 8:124716592-124716614 CTTTTTGTTGATCTGGGGGTGGG - Intronic
1047434918 8:124828270-124828292 GTTTTTGTAGAGATGGGTGGGGG + Intergenic
1047466317 8:125118166-125118188 TTTTTAGTAGAGATGGGGTTTGG - Intronic
1047738794 8:127790338-127790360 TTTTTTGTAGAGATGGGGTTTGG + Intergenic
1048110729 8:131465377-131465399 CATTTTGTAGAGATGGGGTTTGG - Intergenic
1048833789 8:138499385-138499407 TTTTTTGTAGAGATGGGGTCTGG + Intergenic
1049116782 8:140695586-140695608 TTTTTAGTAGAGATGGGGTTTGG + Intronic
1050172893 9:2841385-2841407 TTTTTAGTAGAGATGGGGTTTGG - Intronic
1050173502 9:2846569-2846591 ATTTTTGTAGAGATGGGGTTTGG - Intergenic
1050179358 9:2903629-2903651 GTTTTGGTAGAGATGGGGTTGGG + Intergenic
1050208146 9:3220633-3220655 GTTTTTTTAAAGGGGGGGGTAGG - Exonic
1050228110 9:3484916-3484938 CTTTCTGTAGAGATGGGGTGGGG - Intronic
1050454643 9:5822074-5822096 TTTTTTGTAGAGATGGGGTTTGG - Intronic
1050549480 9:6736871-6736893 TTTTTTGTAGAGACGGGGTTTGG - Intronic
1050784109 9:9377605-9377627 TTTTATGTAAAGCTGGGGGTTGG - Intronic
1051134946 9:13909752-13909774 CTTTTTGAAAAGATATGTGTGGG - Intergenic
1051446653 9:17147134-17147156 CTTTTTGTAAGGCTTGGGGAAGG + Intronic
1051835303 9:21330744-21330766 TTTTTAGTAGAGATGGGGTTAGG - Exonic
1052926409 9:34020501-34020523 TTTTTAGTAGAGATGGGGTTTGG + Intronic
1053382361 9:37659376-37659398 CCTGTTGTACAGATGTGGGTGGG + Intronic
1055280240 9:74665962-74665984 CTTTTTGTAGAGATGGGGTTTGG - Intronic
1055564849 9:77557994-77558016 CCATTTGTAAAAATGGGGCTGGG - Intronic
1055709574 9:79045394-79045416 CTGCCTGTAGAGATGGGGGTTGG - Intergenic
1055967850 9:81882717-81882739 CTGTTTACAAAGATGTGGGTGGG - Intergenic
1056164079 9:83925025-83925047 GTTTCTTTAAAAATGGGGGTGGG + Intergenic
1057103593 9:92388652-92388674 CTTTTAGTAGAGATGGGTGTTGG - Intronic
1057332139 9:94125311-94125333 TTTTTAGTAGAGATGGGGTTTGG - Intergenic
1057396840 9:94688316-94688338 ATTTTTGTAGAGATGGGGTCTGG - Intergenic
1057782098 9:98058092-98058114 TTTTTTGTAGAGATGGGGTTTGG + Intronic
1058038915 9:100283137-100283159 TTTTTTGTAGAGATGGGGAGGGG - Intronic
1058040144 9:100293988-100294010 CTTTTTGTAGAGACGGAGTTTGG - Intronic
1058891129 9:109361704-109361726 TTTTTTGTAGAGATGGGGTGTGG - Intergenic
1059084455 9:111285000-111285022 TTTCTTGTGAAGATGGGGGAAGG - Intergenic
1059204376 9:112450256-112450278 CTATTGGTAGAGATGGGGGGGGG - Intronic
1059308876 9:113375039-113375061 CTTTTTGTAGAGATGTGGGGTGG + Intronic
1059578266 9:115515713-115515735 CTTTTTGTAGAGATCGGGAATGG + Intergenic
1060342613 9:122790265-122790287 TTTTTTGTAGAGATGGTGGGGGG - Intergenic
1060651912 9:125335380-125335402 TTTTTTTTAAAAATGGGGCTGGG + Intronic
1060901228 9:127259862-127259884 TTTTTTGTAGAGATGGGCGGGGG - Intronic
1061044746 9:128159212-128159234 CTTTCTGTAGAGACGGGGGTGGG + Intergenic
1061123486 9:128658899-128658921 GTTTTTGTAGAGATGGGGGCAGG + Intergenic
1061197777 9:129117222-129117244 TTTTTTGTAGAGATGGGGTTTGG + Intronic
1061494546 9:130964504-130964526 ATTTTTGTAGAGATTGGGGTGGG + Intergenic
1061663490 9:132146676-132146698 CTTTTTGAAAAGAGGGGCTTGGG + Intergenic
1061675820 9:132215063-132215085 TTTTTTGTAGAGATTGGGGGGGG + Intronic
1061692433 9:132344387-132344409 TTTTTTGTAGAGATGGGGGAGGG + Intronic
1061723612 9:132569227-132569249 TTTTTTGTAGAGATGGGGGGAGG - Intronic
1062411518 9:136427783-136427805 TTTTTAGTAGAGATGGGGGGGGG + Intergenic
1062576861 9:137212857-137212879 CTTTTTGTAAAAGTGGGGACCGG - Intronic
1203730863 Un_GL000216v2:88307-88329 ATTTTTTTAGAGATGGGGGCAGG - Intergenic
1185454435 X:301450-301472 TTTTTTGTAGAGATGGGGTCTGG + Exonic
1185645731 X:1614382-1614404 TTCTTTGTAGAGATCGGGGTGGG - Intergenic
1185789014 X:2914405-2914427 TTTTTTGTAGAGATGGGGGGGGG + Intronic
1186007347 X:5087567-5087589 CTTTTTGTAGAGATGAGGTTTGG + Intergenic
1186151141 X:6675965-6675987 TGTTTTGTAGAGATGGGGGCAGG - Intergenic
1186173510 X:6902050-6902072 TTTTTTGTAAAGATGGCGGGGGG + Intergenic
1186358632 X:8814565-8814587 CTTTTGGTAAATATGGGTGTTGG - Intergenic
1186401248 X:9261924-9261946 TTTTTAGTAGAGATGGGGTTTGG + Intergenic
1186788746 X:12976373-12976395 GCCTTTCTAAAGATGGGGGTGGG - Intronic
1186857856 X:13642908-13642930 TTTTTAGTAGAGATGGGGTTTGG - Intergenic
1187056843 X:15748727-15748749 TTTTTTTTAGAGATGGGGGTTGG - Intronic
1187314486 X:18179997-18180019 TTTTTAGTAGAGATGGGGTTTGG - Intronic
1187414201 X:19078376-19078398 TTTTTTGTAGAGATGGAGGGGGG - Intronic
1187454145 X:19426470-19426492 CTGTTGGTAAAGGTGGTGGTGGG - Intronic
1187860592 X:23678755-23678777 TTTTTTGTAGAGATGGGGTGTGG - Intronic
1187904912 X:24056678-24056700 TTTTTTGTAGAGATGGGGTTTGG - Intronic
1188119909 X:26291799-26291821 TTTTTTGTAGAGATGTGGTTTGG - Intergenic
1188379247 X:29471156-29471178 CTTTTTCCAAAGGAGGGGGTGGG + Intronic
1188615411 X:32152255-32152277 GATTTTTTAAAGATGGGGGGTGG + Intronic
1189114848 X:38331757-38331779 ATTTTTGTAGAGATGGGGTTTGG + Intronic
1189204122 X:39223021-39223043 ATGTTTGTAAGGATTGGGGTGGG - Intergenic
1189343139 X:40219778-40219800 TTTTTTGTAGAGATGGGGGAGGG + Intergenic
1189368331 X:40407372-40407394 TTTTTTGTAGAGATCGGGGCTGG + Intergenic
1189421018 X:40857825-40857847 TTTTTAGTAGAGATGGGGTTTGG - Intergenic
1189680294 X:43508878-43508900 CTATTTATAAAGATGTGGGTGGG - Intergenic
1189758822 X:44300006-44300028 CTTTTTGTAACGCTGATGGTGGG - Intronic
1189827238 X:44932270-44932292 TTTTTAGTAGAGATGGTGGTGGG + Intronic
1189989217 X:46578581-46578603 TTTTTTGCAAAGATTGGGGATGG + Intronic
1190317474 X:49160527-49160549 ATTTTTGTAGAGACTGGGGTGGG - Intergenic
1190710217 X:53062718-53062740 GTTTTTGTAGAGATGGGATTTGG + Intronic
1190782964 X:53616086-53616108 TTTTTGGTAGAGATGGGGTTTGG + Intronic
1190868394 X:54404348-54404370 ATTTTTGTAGAGATGGGGTCTGG - Intergenic
1190887990 X:54546030-54546052 ATTTTTGTAGAGATGGGGGGAGG + Intronic
1191015103 X:55800961-55800983 TTTTTAGTAAAGACGGGGTTTGG - Intergenic
1191825520 X:65361731-65361753 CTTTTTTTAATGTTGGGAGTGGG - Intergenic
1193109990 X:77719092-77719114 CTTTTATTAAAAATGGGGCTGGG - Intronic
1193658216 X:84224410-84224432 TTTTTTGTAGAGATGGGGTCTGG + Intergenic
1193728367 X:85071363-85071385 ATTTTTGTACACATGAGGGTAGG + Intronic
1194119103 X:89938234-89938256 TTTTTTGTAGACATGGGGTTTGG - Intergenic
1194417788 X:93635213-93635235 TGTTTTCTAAAGATGGGGATGGG + Intergenic
1194652950 X:96537444-96537466 TTTTTTGTAGAGATGGGGTTTGG - Intergenic
1194876563 X:99196302-99196324 ATATTTGTAAAGATGGGGCCTGG + Intergenic
1195157497 X:102138963-102138985 TTTTATGTAAAGGTGGGAGTGGG + Intergenic
1195506860 X:105668037-105668059 CTTTTTGTGAATATGGGGTGGGG + Intronic
1195765845 X:108296124-108296146 AAATTTGTAAAGATGGTGGTAGG + Intronic
1195862347 X:109395562-109395584 CTTTTAGCCAAGAAGGGGGTAGG + Intronic
1196084027 X:111664703-111664725 TTTTTTGTAGAGATGGGGGGGGG - Intergenic
1196321216 X:114342236-114342258 TTTTTAGTAGAGATGGGGTTTGG + Intergenic
1196585091 X:117419678-117419700 CTTTTTTTAATGTTGGGAGTGGG - Intergenic
1197008182 X:121529375-121529397 ATTTTTCTACAGATGGGGGCAGG - Intergenic
1197029161 X:121792790-121792812 CTTTTAGTAAAGATGGGAGGGGG - Intergenic
1197041756 X:121944503-121944525 CAGTTTGTAAAGATGGGGAGAGG + Intergenic
1198052524 X:132962592-132962614 TTTTTAGTAGAGATGGGGTTTGG + Intergenic
1198271297 X:135058766-135058788 ATTTTTCCAAGGATGGGGGTTGG - Intergenic
1198643113 X:138778025-138778047 CTTATTGAAAAGGTGGGGGTAGG + Intronic
1198954925 X:142118464-142118486 TTTTTTTTAAAGATGGGGTCTGG + Intergenic
1199729008 X:150612518-150612540 TTTTTTGTAGAGATGGTGGGGGG - Intronic
1199734171 X:150668514-150668536 TTTTTTGTAGAGATGGAGGAGGG - Intronic
1199989171 X:152975241-152975263 TTTTTTGTAGAGGTGGGGTTTGG + Intergenic
1200087958 X:153619317-153619339 TTTTTTGTACAGATTGGGGGGGG + Intergenic
1200422142 Y:2983008-2983030 TTTTTTATAGAGATGGGGTTGGG + Intergenic
1200471980 Y:3595794-3595816 TTTTTTGTAGACATGGGGTTTGG - Intergenic
1200610409 Y:5321788-5321810 TTTTTTGTAGAGATGGGTCTCGG - Intronic
1200787206 Y:7271749-7271771 TTTTTGGTAGAGATGGGGGCTGG + Intergenic