ID: 1129644697

View in Genome Browser
Species Human (GRCh38)
Location 15:77419725-77419747
Sequence CGGGGCCGCCGCCGAGGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 411
Summary {0: 1, 1: 0, 2: 5, 3: 48, 4: 357}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129644684_1129644697 11 Left 1129644684 15:77419691-77419713 CCAACTTTCCTTCCTCTGGGGGG 0: 1
1: 0
2: 0
3: 25
4: 233
Right 1129644697 15:77419725-77419747 CGGGGCCGCCGCCGAGGGAGGGG 0: 1
1: 0
2: 5
3: 48
4: 357
1129644678_1129644697 25 Left 1129644678 15:77419677-77419699 CCTCGCGGCAGGTCCCAACTTTC 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1129644697 15:77419725-77419747 CGGGGCCGCCGCCGAGGGAGGGG 0: 1
1: 0
2: 5
3: 48
4: 357
1129644677_1129644697 26 Left 1129644677 15:77419676-77419698 CCCTCGCGGCAGGTCCCAACTTT 0: 1
1: 0
2: 0
3: 4
4: 117
Right 1129644697 15:77419725-77419747 CGGGGCCGCCGCCGAGGGAGGGG 0: 1
1: 0
2: 5
3: 48
4: 357
1129644682_1129644697 12 Left 1129644682 15:77419690-77419712 CCCAACTTTCCTTCCTCTGGGGG 0: 1
1: 0
2: 1
3: 17
4: 241
Right 1129644697 15:77419725-77419747 CGGGGCCGCCGCCGAGGGAGGGG 0: 1
1: 0
2: 5
3: 48
4: 357
1129644687_1129644697 -1 Left 1129644687 15:77419703-77419725 CCTCTGGGGGGCGTCGCGCTCCC 0: 1
1: 0
2: 0
3: 4
4: 87
Right 1129644697 15:77419725-77419747 CGGGGCCGCCGCCGAGGGAGGGG 0: 1
1: 0
2: 5
3: 48
4: 357
1129644686_1129644697 3 Left 1129644686 15:77419699-77419721 CCTTCCTCTGGGGGGCGTCGCGC 0: 1
1: 0
2: 0
3: 1
4: 63
Right 1129644697 15:77419725-77419747 CGGGGCCGCCGCCGAGGGAGGGG 0: 1
1: 0
2: 5
3: 48
4: 357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129644697 Original CRISPR CGGGGCCGCCGCCGAGGGAG GGG Intronic
900096768 1:942970-942992 AGGGGCCGGCGCCGAGGGGAAGG + Exonic
900255035 1:1693441-1693463 CGGGGCCGCCGCGCGGGGTGAGG + Intronic
900263778 1:1746707-1746729 CGGGGCCGCCGCGCGGGGTGAGG + Intergenic
900322496 1:2092139-2092161 CGGGGCCGGAGCCAAGGGGGCGG - Intronic
900513464 1:3070719-3070741 CGGGCCCCGAGCCGAGGGAGCGG - Intronic
900629331 1:3625293-3625315 CGGGGCGGGGGCCGAGGGCGCGG + Intronic
901679365 1:10904247-10904269 TGGGGCTGCGGCAGAGGGAGTGG - Intergenic
903069102 1:20717828-20717850 CGGGGCCGCGGCGGGGGGCGGGG + Exonic
903233873 1:21937351-21937373 CGGGGCCGGCGCTGCGGGGGCGG - Intergenic
904410699 1:30323064-30323086 TGGGGCCACCGGAGAGGGAGGGG + Intergenic
904500120 1:30908526-30908548 CGGGGCCGGCGCCGGGGCCGGGG - Exonic
904528802 1:31155009-31155031 CGGGGCCGGAGTCGAGGGAGGGG + Intergenic
905862671 1:41361598-41361620 CAGGGCCGGCGCCCGGGGAGCGG + Intergenic
905912248 1:41662701-41662723 CGGGGCGGGCGCGGAGGGAGGGG - Intronic
907040089 1:51251334-51251356 CGGGGCCGGGGCCGAGGCCGCGG - Intronic
907341516 1:53739070-53739092 GCGGCCCGCGGCCGAGGGAGGGG - Intergenic
907540861 1:55214846-55214868 CGGTGCTCCCGCCGCGGGAGGGG + Exonic
910288226 1:85577204-85577226 CGGGACCCCTGCGGAGGGAGCGG - Intronic
912800181 1:112715314-112715336 CGGGGCCGCGGCCGAGGGCGGGG - Exonic
913144617 1:115976795-115976817 CGGGGCCGGGGCCGAGGCCGAGG + Intronic
915123147 1:153645111-153645133 CGAGGCCGTGGACGAGGGAGAGG + Exonic
915201780 1:154235270-154235292 AGGGGCCGTGGCCGAGGCAGAGG + Exonic
915213340 1:154325584-154325606 CGGGGCCGCAGCTGGGGGGGCGG + Intronic
915284458 1:154843946-154843968 CGGGGCAGTCACCGAGGCAGGGG - Intronic
916104952 1:161423464-161423486 CGGGGCGGCCGGCCAGGCAGAGG - Intergenic
916694399 1:167221326-167221348 CGGGGCCGGGGCAGAGGGAGAGG + Intronic
920352170 1:205344308-205344330 CGGAGCCGCCGCCGGGGAGGAGG + Exonic
921171966 1:212558520-212558542 GGGGGACGGCGCCGCGGGAGTGG - Intergenic
922503785 1:226115004-226115026 CGGGGCGGCCGGCCAGGCAGAGG + Intergenic
922632908 1:227133176-227133198 CGGGGCAGCCGGCCAGGCAGAGG - Intronic
922766297 1:228158244-228158266 CGAGGGCGCCGGCGAGGAAGCGG + Exonic
1062874008 10:931279-931301 CGGGGCCGGGGCCGGGGCAGGGG - Intronic
1066437377 10:35406886-35406908 CGGGGCGGCCGGCCAGGCAGAGG + Intronic
1070198099 10:74177189-74177211 CTGGGCCGCCCCCGGGGGCGCGG - Intronic
1073057140 10:100710089-100710111 CCGGAGCGCCGCGGAGGGAGGGG - Intergenic
1073099600 10:100999784-100999806 CGGGGGCGCCGCGGAGGCGGAGG + Exonic
1073324265 10:102633509-102633531 CGGGGCCCTGGCAGAGGGAGTGG + Exonic
1076857582 10:133124824-133124846 CGGGGCCGGGGCCGGGGGAAGGG - Intronic
1076879146 10:133231397-133231419 CAGCGCGGCCGCCGAGCGAGGGG + Exonic
1077103643 11:832862-832884 AGCGCCCGCCGCCGCGGGAGGGG + Exonic
1077250069 11:1557023-1557045 CGGGGCCGCCGGCGGGGCCGTGG + Exonic
1077253923 11:1572292-1572314 CGGGGCCGCCGGCGGGGATGAGG + Intergenic
1077385926 11:2269492-2269514 CTCAGCCGCCGACGAGGGAGGGG - Intronic
1079689409 11:23403540-23403562 CGCCGCCGCCGCCGCGGGACGGG + Intergenic
1080458475 11:32435075-32435097 CGCCGCCGCCACCCAGGGAGGGG + Exonic
1080592465 11:33736088-33736110 CGAGGCTGCCCCCGAGGGAATGG + Intronic
1081699964 11:45146768-45146790 GGCGGCCCCCGCGGAGGGAGCGG - Intronic
1081831478 11:46119889-46119911 CGGGGGCGCGGGCGGGGGAGGGG + Intronic
1081950345 11:47038480-47038502 CGGGGCGGCCGGCCAGGCAGAGG + Intronic
1083184978 11:61012341-61012363 GAGGGCCGTGGCCGAGGGAGGGG - Intronic
1083454759 11:62771378-62771400 CGGGGCCGGGGCCCCGGGAGAGG + Exonic
1083609633 11:63998805-63998827 CGGGGCCGCCGCACGGGGCGAGG + Intronic
1083672119 11:64305585-64305607 CGGCGGCGCCGCCGAGTGAGGGG + Intronic
1083999563 11:66288847-66288869 TGGGACCGCCGCCCAGGGCGGGG - Intronic
1084395054 11:68904058-68904080 CGGGACCGACCGCGAGGGAGCGG - Intronic
1084745651 11:71167821-71167843 CGGGGCGGCCGGCCAGGCAGAGG + Intronic
1084810344 11:71607920-71607942 CGGGTCCGCCGCCGAGAGCTGGG - Intergenic
1086455409 11:86955269-86955291 CCGGGCCGAGGCCGAGGGACAGG + Exonic
1090616770 11:128522273-128522295 CGAGGCAGCCGCCGGCGGAGAGG - Intronic
1091000924 11:131910524-131910546 CGGTGCCGCCTCGGAGCGAGCGG - Intronic
1091108488 11:132943978-132944000 CGGTGCCGCCTCGGAGCGAGCGG + Intronic
1091273050 11:134331743-134331765 CGGGGCCCCGGCCGGGGGCGGGG - Intergenic
1091550281 12:1530963-1530985 CGGGGCCGTCCCCGGGGGCGAGG - Intronic
1091740744 12:2959226-2959248 CGGGGCGGGCGGCGGGGGAGGGG - Intergenic
1092246758 12:6868107-6868129 CGCGGACGCCGGCGAGGAAGGGG - Intronic
1096796247 12:54079652-54079674 CCAGGCCGCCGGCGAGGCAGCGG - Intergenic
1097264414 12:57737508-57737530 CGCCGCCGCCGCCGGGGGAGGGG - Exonic
1098023139 12:66175129-66175151 CGGGGCGGCCGGCCAGGCAGAGG - Intergenic
1100555977 12:95694341-95694363 TGGAGGCGCTGCCGAGGGAGTGG - Intronic
1101910556 12:108857628-108857650 CGGTGGCGACGCCGAGGGGGAGG - Intergenic
1103107855 12:118246207-118246229 CGGGGCCGGGGCCGAGGCCGCGG + Intronic
1103433023 12:120904098-120904120 CGCCGCCGCCGCCGCGGGTGAGG - Exonic
1103749984 12:123151582-123151604 CCGGGCCGCGGCCCAGGGAACGG + Intergenic
1103930062 12:124445315-124445337 CGGGGCAGCCGCAGAGGGGCAGG - Intronic
1104049495 12:125186285-125186307 CGGGGCCGCGGCCGGGGGAGGGG - Intergenic
1104049575 12:125186533-125186555 CGGGGCAGCCGGCCAGGGCGCGG + Intergenic
1104957735 12:132474647-132474669 CGGGGTCACCGCGGAGGGAGGGG - Intergenic
1104957765 12:132474716-132474738 CGGGGTCACCGCGGAGGAAGGGG - Intergenic
1104957774 12:132474739-132474761 CGGGGTCACCGCGGAGGAAGGGG - Intergenic
1104957804 12:132474809-132474831 CGGGGTCACCGCGGAGGAAGGGG - Intergenic
1104957834 12:132474879-132474901 CGGGGTCACCGCGGAGGAAGGGG - Intergenic
1104957853 12:132474925-132474947 CGGGGTCACCGCGGAGGAAGGGG - Intergenic
1104957872 12:132474968-132474990 CGGGGTCACCGCGGAGGGAGGGG - Intergenic
1104957882 12:132474991-132475013 CGGGGTCACCGCGGAGGAAGGGG - Intergenic
1104957921 12:132475082-132475104 CGGGGTCACCGCGGAGGAAGGGG - Intergenic
1104957940 12:132475128-132475150 CGGGGTCACCGCGGAGGAAGGGG - Intergenic
1104957960 12:132475173-132475195 CGGGGTCACCGCGGAGGAAGGGG - Intergenic
1104957979 12:132475219-132475241 CGGGGTCACCGCGGAGGAAGGGG - Intergenic
1104958044 12:132475362-132475384 CGGGGTCACCGCGGAGGGAGGGG - Intergenic
1104958055 12:132475386-132475408 CGGGGTCACCGCGGAGGGAGGGG - Intergenic
1104983226 12:132583079-132583101 CGGGGCCCCCGCGGAGCGCGAGG + Exonic
1106109105 13:26761018-26761040 CGGGGCCGCCGGCTGGGGTGGGG - Intergenic
1106539086 13:30674197-30674219 AGCGGCCGCCGCGGGGGGAGAGG + Intergenic
1110219584 13:73059222-73059244 CGGGGCTGCCGGCGGAGGAGGGG - Exonic
1112506617 13:99980007-99980029 CGGGGACGCCGCGGGGGGCGGGG + Intergenic
1113493941 13:110713613-110713635 CGGGGCCGTTGCCGGGGGAGGGG + Intronic
1114259284 14:21025548-21025570 CGGGACCGCCGCTGAGGAGGCGG + Intronic
1115235833 14:31207803-31207825 CGGGGTCGCCGCCGGGGGAGTGG - Intronic
1116828331 14:49693367-49693389 CTGGGCCGCAGCCTCGGGAGCGG - Intronic
1117315250 14:54566468-54566490 CGTGGCCGCCGCCGGCGGGGAGG - Intergenic
1119519991 14:75278409-75278431 GGGGGCCGCGGCTGGGGGAGGGG - Intergenic
1120168030 14:81220940-81220962 CGCCGCCGCCGCCGAGAGACAGG + Intronic
1120941698 14:89955914-89955936 CGCGGCGGCCGCCGAAGGGGCGG + Intronic
1121074924 14:91060225-91060247 CGGGGCCGCAGCCGTGGGCGCGG - Intronic
1122140471 14:99660170-99660192 TGGGGCGGCCACGGAGGGAGGGG - Intronic
1122183416 14:99971746-99971768 GGGGGCCGCCGCCGGGGGATGGG - Intronic
1122204912 14:100143495-100143517 AGGGGCCGCCGCAGAAGGAATGG + Intronic
1122264100 14:100538674-100538696 CGGGGCCGCCACCGCGGCCGTGG + Exonic
1122444590 14:101760455-101760477 CGGGGCCGACGCCGGAGGAGAGG + Intergenic
1122978558 14:105181083-105181105 CCGGGCCGCCGGCGGGGGCGCGG + Intronic
1123423407 15:20148860-20148882 CGGCGCCGGCGCCGACGCAGAGG + Intergenic
1123710072 15:22980447-22980469 CGGGGCCGCGGCCGGGAGGGAGG - Intronic
1124500957 15:30225780-30225802 CGAGGCCGCCGCCGGGGGCAGGG - Intergenic
1124604600 15:31161055-31161077 TGGGGCTGCCGCCGAGTGTGTGG - Exonic
1124604603 15:31161073-31161095 TGGGGCTGCCGCCGAGTGTGGGG - Exonic
1124742613 15:32312887-32312909 CGAGGCCGCCGCCGGGGGCAGGG + Intergenic
1124929108 15:34101737-34101759 CGGGGCTGCTGCTGAGGGATCGG - Exonic
1125674306 15:41494214-41494236 CTGGGCCGCCGGAGCGGGAGAGG + Exonic
1125677856 15:41512067-41512089 CGGCGCCGGCGCCGGGGGCGAGG - Intronic
1125937522 15:43649326-43649348 CGGGGCCGGGGGCGAGGGCGCGG + Intronic
1127858811 15:62975663-62975685 CGGGGCCGTCTGCCAGGGAGAGG - Intergenic
1128067869 15:64775623-64775645 GGGGGCGGGCGCCGGGGGAGGGG + Intergenic
1128153544 15:65377856-65377878 CGGGGCCGGCGCCGGGGCCGGGG + Exonic
1128349535 15:66879871-66879893 GGGGGTCTCCGCTGAGGGAGGGG - Intergenic
1129440719 15:75579174-75579196 CGGGAGCGCGGCCGAGGAAGCGG - Exonic
1129503097 15:76059380-76059402 CGGGGCGCCCGGTGAGGGAGCGG - Intronic
1129644697 15:77419725-77419747 CGGGGCCGCCGCCGAGGGAGGGG + Intronic
1129764067 15:78149803-78149825 CAGGGCCGCAGCCGGGGAAGCGG - Intronic
1129810723 15:78507725-78507747 CGGGGTCGCCCCCGAGGGCAGGG + Intronic
1130261140 15:82355274-82355296 TGCTGCCGCCGCCGGGGGAGAGG + Intergenic
1130280095 15:82513744-82513766 TGCTGCCGCCGCCGGGGGAGAGG - Intergenic
1130301125 15:82680426-82680448 CGGGGCAGGAGGCGAGGGAGGGG + Intronic
1130471470 15:84229930-84229952 TGCTGCCGCCGCCGGGGGAGAGG - Intergenic
1130478964 15:84344501-84344523 TGCTGCCGCCGCCGGGGGAGAGG - Intergenic
1130492806 15:84443630-84443652 TGCTGCCGCCGCCGGGGGAGAGG + Intergenic
1130593764 15:85234557-85234579 TGCTGCCGCCGCCGGGGGAGAGG - Intergenic
1132527821 16:426186-426208 CGGGGCCGCTGCAGATGGCGGGG + Exonic
1132701895 16:1225540-1225562 CGGGGCCAGGGCTGAGGGAGGGG + Intergenic
1132734721 16:1379697-1379719 CGGGGCCAGCGCGGAGGGGGCGG - Intronic
1132736592 16:1389050-1389072 CGGGGCCGGGGCCGGGGGAGGGG - Intronic
1132838022 16:1964480-1964502 CGGGGCCGGGGCCGAGGCCGCGG - Exonic
1132897685 16:2236721-2236743 AGGGGCGGCCGCGGAGGGAAGGG + Exonic
1132902839 16:2267833-2267855 CGGGGCCGCTGCGGACGGAAGGG - Intronic
1132915188 16:2340331-2340353 GGGAGCCGACGCTGAGGGAGCGG + Intronic
1133054432 16:3138473-3138495 CGGGGCCTCCCCCGACGGTGGGG + Exonic
1133156424 16:3880034-3880056 GCGGGCGGGCGCCGAGGGAGAGG + Exonic
1133156609 16:3880561-3880583 CGGGGCGGGCGCCGAGGGCCGGG + Exonic
1133315641 16:4882138-4882160 CGAGGCCGCAGCAGAGGGTGGGG + Exonic
1134082788 16:11335985-11336007 CGGGGCGGCCGGCCAGGCAGAGG + Intronic
1135381247 16:21997901-21997923 CAGGGCCACTGCTGAGGGAGAGG + Intronic
1136153678 16:28368186-28368208 CGAGGCCGCCGCCGGGGGCAGGG - Intergenic
1136365187 16:29806433-29806455 CGGGGCCGGGGCCGGGGGCGGGG - Intronic
1136414670 16:30096011-30096033 GGGGGCGGGCGCCGGGGGAGGGG + Exonic
1136478309 16:30526595-30526617 CGGGGCCGCGGGCAGGGGAGGGG - Intronic
1137252361 16:46749370-46749392 CAGGGCTGCCCCCAAGGGAGGGG + Intronic
1137614565 16:49838915-49838937 CGGGGCCGCCCCCGCGGGCCGGG + Intronic
1137683313 16:50369096-50369118 CGGGGGCGGGGCCGAGGGCGGGG + Intergenic
1138016657 16:53434597-53434619 CGAGGCTGCCGCCGCCGGAGGGG - Exonic
1138590433 16:57996552-57996574 CAGTGCCGCCGCCGCGGCAGCGG - Exonic
1141531369 16:84648807-84648829 GGGCGCCGCGGCCGGGGGAGGGG + Intronic
1142009183 16:87705081-87705103 GAGGGCCGCAGCCGAGGGAAAGG + Intronic
1142295289 16:89217673-89217695 CGGGGCCGGCGCCGGAAGAGGGG - Intergenic
1142848242 17:2692295-2692317 CGGGGCAGCCGGCGGGGGCGGGG - Intronic
1142876223 17:2853469-2853491 CGGGGCCGCCGGCGGGAGTGCGG + Intronic
1143590622 17:7884592-7884614 CGGGGCCGCCGTCTGAGGAGGGG - Intronic
1143625980 17:8110355-8110377 CGGCGCCGCCGCCCCGGGATGGG - Intronic
1144527243 17:16000176-16000198 CGGGGCCGCTGCCGAGGACGGGG + Exonic
1144781349 17:17810024-17810046 CCCGCCCGCCGCCGAAGGAGAGG + Exonic
1145064625 17:19753727-19753749 CCCGGCCGCCCCGGAGGGAGTGG - Intergenic
1145750845 17:27353997-27354019 CCGGGCCGGCGAAGAGGGAGGGG + Intergenic
1147132922 17:38419489-38419511 GAGGGCCGCCACCGAGGGAGGGG + Intergenic
1147139532 17:38453626-38453648 AGGGGCCGCCCCGGAGGGGGAGG + Intronic
1147158590 17:38558197-38558219 TGGGCCCGCGGCGGAGGGAGGGG - Intronic
1148183111 17:45620684-45620706 CGGGGCCGCGGCCGGGGGCGCGG + Intergenic
1148265740 17:46225007-46225029 CGGGGCCGCGGCCGGGGGCGCGG - Intronic
1148370971 17:47099940-47099962 CGGGGCCGCGGCCGGGGGCGCGG - Intergenic
1148664079 17:49361855-49361877 CGGGGGCGCCGCCGCGGCGGTGG + Intronic
1148686990 17:49506636-49506658 CTGGGCCGACGCCGAGTGCGAGG + Exonic
1149166375 17:53757725-53757747 CGGGGCCGGGGCCGAGGCCGCGG - Intergenic
1149625025 17:58074238-58074260 CGGGGCGGCCGGCCAGGCAGAGG + Intergenic
1150214093 17:63457018-63457040 CGGGGCGGCCGGCCAGGCAGAGG - Intergenic
1151591551 17:75047595-75047617 CGGGGGCGCGCCCGAGGGCGGGG - Intronic
1151919144 17:77140862-77140884 CGCGGCCGCGGCCGAGGGAGCGG - Intronic
1151972862 17:77467740-77467762 CGCGGCCGGCACAGAGGGAGCGG + Intronic
1152069072 17:78126237-78126259 CGGGGCCGGGGCCGAGGCCGAGG + Intronic
1152069074 17:78126243-78126265 CGGGGCCGAGGCCGAGGCTGAGG + Intronic
1152345447 17:79748231-79748253 CGTGGCAGCCGGCGAGGGGGAGG - Intergenic
1152356514 17:79810171-79810193 CGGGGCCGCGGCCGGGCGAGCGG + Intergenic
1152560506 17:81076327-81076349 CGGGGCCTCCGTTGATGGAGAGG - Intronic
1152571223 17:81122085-81122107 CAGGGGCCCCGCCGAGGGCGAGG + Exonic
1152632603 17:81417265-81417287 GGGGGGCGGCGCCGAGGGAGTGG + Intronic
1152880555 17:82812312-82812334 CGGGGCGGCGGGCGAGGGGGAGG - Intronic
1153193744 18:2570967-2570989 GGGGGCGGGCGGCGAGGGAGTGG - Intronic
1153934966 18:9913609-9913631 CGGGGCCTTCGCCGAGGGCCTGG - Intergenic
1155053819 18:22169038-22169060 CGCCGCCGCCGCGGCGGGAGGGG - Intergenic
1155199350 18:23503588-23503610 CGGGGCCCCCGCCGCGGGCGCGG + Exonic
1160120926 18:76129955-76129977 CTGGGCCCACGCAGAGGGAGAGG - Intergenic
1160592533 18:79952145-79952167 CGGGGCCGTCGCCGGGGGGCCGG + Intergenic
1160630945 18:80246547-80246569 CGGGGGCGCGCCCGGGGGAGTGG + Intronic
1160725624 19:616690-616712 CGAGGCCGCCGCCGGGGGCAGGG - Exonic
1160873166 19:1286076-1286098 CGCCGCCGCCGCCGAGCGGGCGG - Intergenic
1161031893 19:2061441-2061463 CGCGGCCGCCGCCGGGGAGGGGG - Intergenic
1161210407 19:3062551-3062573 CGTGCGCGCCGCCGAGGGGGGGG + Intronic
1161251963 19:3285431-3285453 CGGGGCCGCAGCAGAGGGCGGGG - Intronic
1161412383 19:4123776-4123798 CGAGGGCGCCTCCGAGTGAGTGG - Exonic
1161583929 19:5094977-5094999 CGGGGGCGGCGCCGGGGGCGGGG + Intronic
1161801023 19:6416818-6416840 GGGGGCCGAGGCCGAGGAAGAGG - Exonic
1162033250 19:7926178-7926200 CGGGGCCGCCGCGGGGGGCGGGG + Intergenic
1162363038 19:10231009-10231031 CGGGTTCGCGGCCGAGGCAGTGG + Intronic
1162960105 19:14120545-14120567 GGAGGCCGCAGCCCAGGGAGGGG + Exonic
1163026778 19:14517585-14517607 CGGGGCCGCCTCGGAGGGTAAGG - Intronic
1163112615 19:15170575-15170597 CGGGGCTTCAGCCGAGGGCGGGG + Intronic
1163513082 19:17747720-17747742 CGCCGCAGCCGCGGAGGGAGGGG + Exonic
1163527579 19:17830859-17830881 CGGGGCCAGAGCCGTGGGAGGGG + Intronic
1163664851 19:18598386-18598408 TGGGGCTGGTGCCGAGGGAGGGG + Intronic
1163666550 19:18606463-18606485 GGGGGCAGCCGCGGGGGGAGGGG - Intronic
1164594928 19:29526404-29526426 CGGGCAAGCCGGCGAGGGAGCGG + Intergenic
1165349795 19:35269319-35269341 CGGGGGCGCCGCCGAGGCCGGGG - Intronic
1165420599 19:35720224-35720246 AGGGGCCGCGGCCGAGGTGGTGG + Exonic
1165939164 19:39406769-39406791 CGGGGCCGGGGCCGGGGGCGGGG - Intergenic
1166106692 19:40601246-40601268 CGCGGCCGCCGGGGAGGGAGTGG + Intronic
1166317494 19:41997302-41997324 CCGGGCCGCCGCCCAGGAACGGG + Intronic
1166375451 19:42324725-42324747 CGGGGCAGGGGCTGAGGGAGGGG - Exonic
1166529727 19:43535100-43535122 GGGGGCCGCCGGCGAGGCCGGGG - Exonic
1166861908 19:45816001-45816023 CCGGGCCGACGGAGAGGGAGAGG + Exonic
1167445291 19:49533890-49533912 CGGGGCCGGCGCGGAGAGGGTGG + Intronic
1167456297 19:49597936-49597958 CGGGGCCGGGGCCGAGGCCGGGG + Exonic
1167492842 19:49802024-49802046 CGGGGGTGCTGCCGGGGGAGGGG - Exonic
1167611762 19:50511159-50511181 CAGAGCCGCCGCCCAGGAAGGGG - Exonic
1167619971 19:50555328-50555350 CGGGGCAGCTGCGGTGGGAGAGG - Intronic
1167648915 19:50719346-50719368 CGGGGCCGGGGCCGCGGGAGGGG - Intronic
1167952427 19:53037968-53037990 CGGGGCCTCCGCGGAGTGGGGGG + Intergenic
1168294127 19:55370407-55370429 CTGGGCCGCGGCCTGGGGAGGGG + Intronic
1168332775 19:55579536-55579558 CGGGGCCGTGGCCGTGGCAGGGG - Exonic
1168332786 19:55579560-55579582 CGGGGCCGTGGCCGAGGCCGTGG - Exonic
925164123 2:1705206-1705228 CTGGGCCTCCCCTGAGGGAGAGG + Intronic
925492744 2:4413041-4413063 TGGGGCTGCCGCAGGGGGAGAGG - Intergenic
926035109 2:9630467-9630489 CGGGGCCGGGGCGGAGGGCGAGG + Exonic
926089993 2:10043517-10043539 CGGGGCGGCCGCGGAGGGAGCGG - Intronic
926154931 2:10448417-10448439 CCGGGACACCGCCGGGGGAGGGG + Exonic
927703441 2:25282531-25282553 CGGGGCCCCAGCAGAGGGAGAGG - Exonic
927714317 2:25342177-25342199 CCGGGGCGCCGCGGCGGGAGCGG + Intronic
928124588 2:28606796-28606818 CTGGGCCCCAGCAGAGGGAGAGG + Intronic
929151221 2:38750905-38750927 GGCAGCCGCCGCCGAGGGCGGGG + Intronic
929238330 2:39628434-39628456 CGGGGCAGCTGCCGGCGGAGAGG + Intergenic
929936411 2:46297325-46297347 CGGGGCGGGCGCGGAGGGCGGGG - Intronic
930821500 2:55651035-55651057 CGGGGCGGCCGGCCAGGCAGAGG - Intronic
931695172 2:64865710-64865732 CTGCGCCGCCGCCGAGGCCGCGG - Intergenic
932722463 2:74147939-74147961 GAGAGCCGCCGCCGTGGGAGAGG + Exonic
933659491 2:84915884-84915906 CGGGGCCGGGGTCGCGGGAGTGG + Intergenic
934067090 2:88350555-88350577 TGGGGCGGCCACCGGGGGAGGGG - Intergenic
940460724 2:153959728-153959750 CAGGGCTGCCTCAGAGGGAGAGG + Intronic
942946940 2:181682653-181682675 CGGGGCAGCTGCCGGGTGAGGGG - Intergenic
944244429 2:197516526-197516548 CGGGGCCGCTGAGGTGGGAGGGG + Intronic
945188952 2:207166644-207166666 CGGGGAAGCCGCCGAGGGCGCGG + Intronic
947817473 2:233047873-233047895 TGGGGCTGCCGCCAAGGGAATGG + Intergenic
947860565 2:233354707-233354729 CGGGGCTGCCGCGGCGTGAGGGG - Intronic
948208230 2:236173890-236173912 CGGGGCCGTCGTGGAGGCAGCGG - Intergenic
948302085 2:236915038-236915060 CAGGACTGCAGCCGAGGGAGTGG + Intergenic
948433200 2:237933845-237933867 CGGTGCCGCTGCTGAGGCAGGGG - Intergenic
1168769751 20:407949-407971 CGGGGCCGGGGCCGGGGGCGGGG - Intronic
1169065727 20:2693276-2693298 CGGGGCCGCGGTCGTCGGAGGGG - Intronic
1169195823 20:3681617-3681639 CTGGGCTGCCCCCGAGGGGGAGG + Intronic
1171034717 20:21705889-21705911 CGCCGCCGCCGCCGCGTGAGAGG - Exonic
1172117982 20:32583316-32583338 CCGGGCGGCCGCGGAGGGGGAGG + Intronic
1172848415 20:37944165-37944187 CGGGGCGGGCGCGGCGGGAGGGG - Exonic
1174576828 20:51542801-51542823 CGGGGCCGCCACCAGGGGACCGG + Intronic
1175199279 20:57266698-57266720 GGAGGCCGCCGGCGCGGGAGGGG - Intergenic
1175429262 20:58890969-58890991 CGCGGGCGCCGCCGAGGGGCTGG - Intronic
1175446498 20:59023835-59023857 CTGTGCCCCCGCCCAGGGAGTGG - Exonic
1175831875 20:61969225-61969247 CGGGGCTGCCACTGAGGCAGTGG - Intronic
1175962097 20:62642436-62642458 CGCCCCCGCCGCAGAGGGAGGGG - Exonic
1175992438 20:62796511-62796533 CCGGGCCGCGGCCATGGGAGAGG + Exonic
1176005755 20:62861595-62861617 CGAGGCGGCCGTCGAGGGCGCGG - Exonic
1176009622 20:62885981-62886003 CGGGGCAGCTGCCGAGGGGAGGG - Intronic
1176062644 20:63179010-63179032 CGGGGCGGCCCCCGCGGGACGGG + Intergenic
1176546632 21:8205154-8205176 GGTGGCAGCTGCCGAGGGAGGGG + Intergenic
1176554526 21:8249345-8249367 GGTGGCAGCTGCCGAGGGAGGGG + Intergenic
1176565583 21:8388201-8388223 GGTGGCAGCTGCCGAGGGAGGGG + Intergenic
1176573448 21:8432369-8432391 GGTGGCAGCTGCCGAGGGAGGGG + Intergenic
1178673909 21:34614960-34614982 CGGGGCCGCGGCGGAGGCGGCGG - Exonic
1179586421 21:42376515-42376537 CGGGGCCGCAGCGGTGGGCGAGG - Intronic
1179976964 21:44873761-44873783 CGGGGCAGATGGCGAGGGAGCGG - Exonic
1180782801 22:18530101-18530123 CCGGGCCGGCGCCGCGGGCGCGG + Intronic
1180950601 22:19718927-19718949 CGAGGCCGCTGCGGAGGGAAGGG - Intronic
1181126363 22:20704133-20704155 CCGGGCCGGCGCCGCGGGCGCGG + Intergenic
1181239691 22:21469439-21469461 CCGGGCCGGCGCCGCGGGCGCGG + Intergenic
1183149769 22:36028476-36028498 CGGGGCCGAGGCCCAGGGGGAGG - Intergenic
1183517026 22:38272715-38272737 CGGTGCGGCCGCGGAGGGAGGGG - Intronic
1184642209 22:45878677-45878699 CGGGGCCACAGCTGAGAGAGGGG - Intergenic
1184790001 22:46694554-46694576 CAGGGCAGCTGCCCAGGGAGAGG - Intronic
1185055401 22:48576251-48576273 GGGGGGCGCCGCGGAGGGGGCGG - Intronic
1185259658 22:49854203-49854225 CGGGGGCGGCGCCGACTGAGCGG + Intronic
1185343000 22:50299910-50299932 CGGTGCCGGCGCCGGGGGAGGGG - Intronic
1203251497 22_KI270733v1_random:121420-121442 GGTGGCAGCTGCCGAGGGAGGGG + Intergenic
1203259547 22_KI270733v1_random:166502-166524 GGTGGCAGCTGCCGAGGGAGGGG + Intergenic
949970248 3:9397678-9397700 CGCCGCCGCTGCCGGGGGAGGGG + Intronic
950000039 3:9649609-9649631 CGAGGACCCCGCCGAGGCAGCGG - Exonic
950316326 3:12004685-12004707 CGGGGGCGCCGCCGAGGCCGAGG - Exonic
950703555 3:14766557-14766579 AGGGGCAGCCGGCGAGGGGGAGG + Intronic
950729800 3:14947689-14947711 CGGGGGCGCCGCCGGGGTCGCGG - Intronic
950759301 3:15206383-15206405 CGGGAGCGCCGCGGAAGGAGCGG - Exonic
953385237 3:42502513-42502535 CGGGGCCGCCGCGCAGGTATGGG - Intronic
954004232 3:47578916-47578938 CGGGGCCGGCGCGGCGGGCGGGG - Exonic
954395105 3:50289349-50289371 CGGGGCAGCTGCCTAGGGAAGGG + Exonic
954664707 3:52245728-52245750 CGCGGGCGGAGCCGAGGGAGGGG - Intergenic
955368699 3:58332824-58332846 CGGGGCGGCGGCCGTGGGAAGGG + Intergenic
961666838 3:128497941-128497963 CGGGGCCGGGGCCGGGGCAGGGG - Intergenic
962498391 3:135965644-135965666 CGGGCCGGCCGCCGAGGGTGGGG + Intergenic
962804189 3:138915535-138915557 CGGGCCTGCCGCCGGGGGCGCGG - Intergenic
963240913 3:143001595-143001617 TGCTGCCGCCGCCGAAGGAGGGG + Exonic
964087382 3:152834887-152834909 CGGAGTCGGCGGCGAGGGAGAGG - Exonic
965648285 3:170908158-170908180 CGGGGCGGCGGCCGAGGGCTGGG - Intronic
966362827 3:179148521-179148543 CGGCGGCGGCGCCGAGGGAGAGG - Exonic
966696300 3:182793584-182793606 CGGGGCCGACGCCGCGGGATGGG + Exonic
968629823 4:1644567-1644589 CGGGGCTGGCGCCCAGGGACAGG - Intronic
968660140 4:1795428-1795450 CGGGGGCGCCGCCCCGGGGGAGG - Intronic
968674964 4:1872009-1872031 CGGGGCGGCCGCGGTGGGAGGGG + Intronic
968879767 4:3292972-3292994 CGGGGCCGAGGCCGGAGGAGGGG - Intergenic
971195687 4:24470712-24470734 TCGGGCCGCCGCCGCGGGTGGGG - Intergenic
972817183 4:42657147-42657169 GGGCGCCGGCGCCGGGGGAGGGG + Intergenic
975633041 4:76421113-76421135 CGGCGCCGCAGCCGAGGAGGAGG - Intronic
979231503 4:118352908-118352930 CGCGGCCGCCGCCAGGGGACAGG - Exonic
981315471 4:143336452-143336474 CGCGGCCGCCGAAGAGGGCGGGG - Intergenic
981782834 4:148445378-148445400 GGGGGGCGCCGAGGAGGGAGCGG + Intergenic
982053538 4:151526511-151526533 CGGGGCGGCCGGCCAGGCAGAGG + Intronic
984639300 4:182144620-182144642 GGGGGGCCCCGCCGAGGGAGCGG - Intronic
985472386 5:53941-53963 GGGGGCCGGGGCCGAGGGGGCGG + Intergenic
985504615 5:271850-271872 CGGGGCCGCCGCGGCGGAGGCGG - Intronic
985537435 5:473147-473169 CGGGGCCTGCGCCGGGGGCGGGG - Intergenic
985550136 5:528653-528675 CGGGGCGGCGGCCGGGAGAGGGG - Intergenic
985896359 5:2751797-2751819 CCGGGCCGCGGCCGGGGGAGGGG + Intergenic
987035507 5:14014631-14014653 TGGGGCAGGCGTCGAGGGAGGGG + Intergenic
988587925 5:32523879-32523901 CGGGGCTGCCCCCAAGGGATGGG - Intergenic
989102302 5:37834670-37834692 CGCGGCGGCGGCCGAGGGAGCGG + Exonic
989229989 5:39074476-39074498 CGCCGTCGCCGCCGAGGGGGCGG - Intergenic
990347446 5:54884123-54884145 CGGGGCCGCCGCGGCGGGATGGG - Intergenic
992039610 5:72816855-72816877 CCGGGCAGGCGCCGAGAGAGCGG - Intronic
993496672 5:88616153-88616175 CGGGGCGGCCGGCCAGGCAGAGG - Intergenic
994171535 5:96663083-96663105 CGGGGGAGCCGGCGAGGGCGCGG - Intronic
994197171 5:96934837-96934859 AGGGGCCGGGGCTGAGGGAGGGG + Intronic
995764596 5:115602053-115602075 GGGGGCCGCCGCCGGGGGCGCGG - Intronic
998239420 5:140427672-140427694 CGGGGCGGCCGGCCAGGCAGAGG + Intronic
998583505 5:143403832-143403854 CGGGGCCCGCGCGGAGGGCGTGG - Intronic
1001604164 5:172948156-172948178 CGGAGCGGCCCCCCAGGGAGTGG - Intronic
1002416378 5:179122924-179122946 TGGGGCTGCCCCCGAGGGTGGGG - Intronic
1003175698 6:3751250-3751272 CGGGGCCGGGGACGCGGGAGGGG - Intronic
1004216762 6:13711212-13711234 GGGGGCAGCCGCTGAGGCAGGGG + Exonic
1006458591 6:34145295-34145317 CGGAGCCGCCGCCAAGCGCGCGG + Intronic
1009964819 6:70567020-70567042 CGGGGCCACGGTCGCGGGAGGGG + Intronic
1010703299 6:79077760-79077782 CGGGGCCGCGGCCCGGGGCGCGG - Intronic
1010781163 6:79947382-79947404 CCGGGCCGCCGCCGTTAGAGGGG - Exonic
1013273526 6:108562072-108562094 AGGGGACGCCGGCGAGGGAAGGG + Intronic
1017793793 6:157823560-157823582 CGGGGACTCCACCGAGGAAGCGG - Intronic
1017877686 6:158537353-158537375 CGGGGGCGCCGCCAAGGGCTGGG + Intronic
1018400491 6:163415138-163415160 CGCCGCCGCCGCCGCCGGAGAGG - Exonic
1018828108 6:167423115-167423137 TGGGGGAGCCGCCGTGGGAGGGG - Intergenic
1019191876 6:170256035-170256057 CGTGGTCGCGGACGAGGGAGTGG - Intergenic
1019514382 7:1433303-1433325 CGGGGCCCCCGTGGAGGGAAAGG - Intronic
1019578024 7:1746811-1746833 CGGGGCCGCGGCCGGGTGAGTGG - Exonic
1022207595 7:28179747-28179769 CTCGGCCGCCTCCCAGGGAGAGG + Intronic
1026822133 7:73557139-73557161 CGGGGCCACTGCCCAGGAAGAGG + Intronic
1026840588 7:73668235-73668257 CGGAGCCACCCCCGGGGGAGGGG + Intronic
1028417508 7:90596071-90596093 AGGGGCCTTCGTCGAGGGAGGGG + Intronic
1029683402 7:102128369-102128391 CGGTGCTGCGGCCGAGGGAGGGG - Intronic
1030598000 7:111562333-111562355 CGGGGCCGACTCCCAGGGAAGGG + Intronic
1031043572 7:116862983-116863005 CGGGGCCTCCGCCGGGGCCGGGG + Intronic
1032174353 7:129611692-129611714 CGCCGCCGCCGCCGAGGAGGGGG - Exonic
1033253178 7:139777775-139777797 CGTGGCCGGCGCCGGGGGAGGGG + Intronic
1034439820 7:151080913-151080935 CGCGCCCGGCGCCGAGGGCGGGG + Intergenic
1034975930 7:155449320-155449342 CAGGGCCTCTGCTGAGGGAGCGG + Intergenic
1034984008 7:155496445-155496467 CAGGGCCGCCATCGAGGGTGTGG + Intronic
1035717196 8:1763640-1763662 CGGGGCGGCGGGCGCGGGAGGGG - Intronic
1036664628 8:10730592-10730614 CCGCGCCGACACCGAGGGAGGGG - Intronic
1036723726 8:11201066-11201088 CAGCGCCGCCGCCGACGGGGGGG - Exonic
1039595600 8:38787654-38787676 CGGGGCCGCCGGCGAGGACGAGG + Exonic
1039921458 8:41896779-41896801 CGCCGCCGCCGCCGCAGGAGAGG - Intergenic
1041906447 8:63038623-63038645 CGGGGCCGCAGCAGACGGGGAGG - Intronic
1043401769 8:79891628-79891650 GGGGGCGGCCTTCGAGGGAGCGG - Intergenic
1044306537 8:90646154-90646176 CGGGGCCGCGGGCGATGGGGCGG + Intronic
1047248006 8:123161022-123161044 CGGGGTCGCAGATGAGGGAGTGG + Intergenic
1047393721 8:124475031-124475053 CGGGGCCGCGGCCGGGGGCGGGG - Exonic
1049166481 8:141128927-141128949 CGGGGTCACCGCCGGGGGACCGG - Intronic
1049641736 8:143719052-143719074 CGGGGAGGTCGCCCAGGGAGCGG - Exonic
1049760984 8:144331977-144331999 CGGGGTCGCCGCCGAGGCTTTGG + Exonic
1049761484 8:144333797-144333819 GGGGGCCGCCGCCGAGGCTGTGG + Exonic
1051079690 9:13279657-13279679 CGGGGCTGCCGCGGAGGCGGTGG + Intergenic
1051876757 9:21802168-21802190 CGGGGCGGCCGCCGCGGCGGGGG - Intergenic
1053055192 9:34989762-34989784 CGGAGCCGGAGCCGGGGGAGGGG + Exonic
1060682423 9:125577526-125577548 CGGGGCGGCCGGCCAGGCAGAGG - Intronic
1061016049 9:127981183-127981205 CGGGCCCGCCTCCTAGGGCGGGG + Intergenic
1061128314 9:128690079-128690101 CGGGGGCGCCGCCGCGGGCCGGG - Intronic
1061307030 9:129738059-129738081 CGGGGCAGCCCCGCAGGGAGGGG + Intergenic
1061317069 9:129803089-129803111 CATGGCCGCCCCCAAGGGAGTGG + Intergenic
1061559676 9:131394349-131394371 CGCGGCCGCCGCCGGGGGCCCGG + Intronic
1062062152 9:134502435-134502457 CAGGGCCGCCGTTGAGGCAGTGG - Intergenic
1062389197 9:136327399-136327421 CGGGGCGGACGCGGGGGGAGGGG - Intergenic
1062414229 9:136439705-136439727 CGGGGACGCCGCTCGGGGAGAGG + Exonic
1062526024 9:136978452-136978474 CGGGGCCATCTCCGGGGGAGGGG + Intronic
1062558906 9:137130323-137130345 CTGGACCGGCGCCGAGCGAGGGG + Intergenic
1062733207 9:138120652-138120674 CGGGGCTGCCCCCGGGAGAGGGG + Exonic
1203467899 Un_GL000220v1:104571-104593 GGTGGCAGCTGCCGAGGGAGGGG + Intergenic
1203475720 Un_GL000220v1:148543-148565 GGTGGCAGCTGCCGAGGGAGGGG + Intergenic
1186496281 X:10015023-10015045 CGGAGCAGCCGGCGACGGAGAGG + Intergenic
1186669996 X:11758364-11758386 AGGTGCCGCCGCGGAGGGACAGG + Exonic
1187419544 X:19122528-19122550 CGGGGGCGGCGCCGAGGCCGCGG - Exonic
1189429716 X:40935718-40935740 CGGGGCCGGGGCCGAGGCCGCGG - Intergenic
1190984464 X:55488608-55488630 CGGGGCTGGGGCCGAGGGCGGGG + Exonic
1191835424 X:65457405-65457427 CGGGGCGGCCGGCCAGGCAGAGG - Intronic
1197754026 X:129982732-129982754 CGCCGCCGCCGCCGAGAGAGAGG + Intronic
1200165286 X:154031244-154031266 CGGGGACGCCCCAAAGGGAGCGG - Exonic