ID: 1129644738

View in Genome Browser
Species Human (GRCh38)
Location 15:77419835-77419857
Sequence TGGCGCCGCCGCCGGGGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 6, 3: 43, 4: 292}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129644738_1129644751 22 Left 1129644738 15:77419835-77419857 CCAGAGCCCCGGCGGCGGCGCCA 0: 1
1: 0
2: 6
3: 43
4: 292
Right 1129644751 15:77419880-77419902 AGAACCCGCGCCGCCCCGCCCGG 0: 1
1: 0
2: 0
3: 8
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129644738 Original CRISPR TGGCGCCGCCGCCGGGGCTC TGG (reversed) Intronic
900096445 1:941969-941991 TGGCGCCGCCGGCGGGGGCGGGG + Intronic
900252201 1:1676770-1676792 TGGGGCCGCAGCAGGGACTCCGG + Exonic
900262611 1:1739628-1739650 TGGGGCCGCAGCAGGGACTCCGG + Exonic
900269172 1:1778418-1778440 CGGCGCCGGCGCCGGGGTCCGGG - Intronic
901235365 1:7664728-7664750 TGGGGACGCCGCCGGCGCTTCGG - Exonic
901443399 1:9292947-9292969 AGGCGCCGGCGCCGGGGCCGGGG + Exonic
902920713 1:19664908-19664930 TCGCGGCGCCTCCCGGGCTCGGG + Intergenic
903115532 1:21176303-21176325 TGCCGCCGCCGCCGCCGCTCCGG + Exonic
903652269 1:24929540-24929562 GGGCGCCGGCCCTGGGGCTCCGG - Intronic
903976774 1:27155096-27155118 TGCCGCCGGGGCCGGGGCTAGGG - Intronic
904171041 1:28592427-28592449 GGGCGGCGCCGGCGGGGCCCCGG + Intronic
904181439 1:28669097-28669119 CGGCCGCGCCGCCGGGGCTCGGG + Intronic
904244987 1:29181494-29181516 TGGCGGCGCCTCGGGGGCGCGGG - Intronic
904822951 1:33256822-33256844 CGCCGCCGCCGCCGCCGCTCTGG - Intronic
905862636 1:41361483-41361505 TGCTGCCGCCGCCGCCGCTCCGG - Intergenic
905867135 1:41382459-41382481 TGCCGCCGCCGCCGGGCCGCTGG + Exonic
906306718 1:44724436-44724458 TGGCGCTGCCGGCGGGCCCCGGG + Intronic
908014226 1:59814877-59814899 TGGCAGCGCGGCCGGGGCCCAGG + Exonic
908534637 1:65066703-65066725 CGCCGCCGCCGCGGGGACTCCGG + Intergenic
908581971 1:65525760-65525782 TGGCGGCGGCGCCGGGGCTCGGG - Intronic
909931389 1:81503358-81503380 TGGCGCTGCTGCCGAGGCTCTGG - Intronic
915572213 1:156750953-156750975 TGGCGGCGGCGCCTGGGGTCGGG + Intronic
915920590 1:159972957-159972979 TGGCGACGCCCCCAGGGGTCTGG - Intergenic
919486996 1:198157558-198157580 TGCCGCCGCCGCCGTGGCCACGG - Intronic
922314919 1:224434292-224434314 TCCCTCCGCCGCCGAGGCTCGGG + Exonic
1062874086 10:931482-931504 TGGCGCGGCCGCCGGGCCCCGGG - Exonic
1063115418 10:3068522-3068544 CGGCGCCGCGGCGCGGGCTCCGG + Intronic
1063357246 10:5412735-5412757 AGGCGAAGCCGCCGGGCCTCTGG + Exonic
1065099867 10:22321790-22321812 CGGCGGCGCGGCCGGGGCGCGGG - Intronic
1065140534 10:22714662-22714684 CGGCGCCGCGGGCGGGGCACTGG + Intergenic
1069849613 10:71396713-71396735 CGGCGCCGCTCCCGGGGGTCCGG + Intergenic
1070398499 10:76032873-76032895 TGGCGTCTCCACCGGGGATCTGG + Intronic
1070746259 10:78935808-78935830 TGGTGCAGCCCCCAGGGCTCTGG + Intergenic
1071695471 10:87864235-87864257 TGCCGCCGCTGCCAGGCCTCTGG + Exonic
1072591629 10:96832734-96832756 CGGCGGCGGCGCCGGGGCGCCGG - Intronic
1072994285 10:100229509-100229531 TGGAGCGGCCCCCGGGGCTGCGG - Exonic
1073293387 10:102424322-102424344 TCGGGCCGCTGCAGGGGCTCTGG + Exonic
1074121641 10:110497967-110497989 TTGCGCCGCCGCTCGGGCGCCGG + Exonic
1074165815 10:110872512-110872534 CGGGGCCGAGGCCGGGGCTCCGG - Intronic
1076754827 10:132563913-132563935 TGACTCAGCCGCCAGGGCTCAGG - Intronic
1076877989 10:133225938-133225960 TGGGGCCGTGCCCGGGGCTCTGG - Exonic
1077144608 11:1039356-1039378 TGGAGCCCCCACCAGGGCTCGGG - Intergenic
1077194905 11:1274616-1274638 TGGAGCCTCAGGCGGGGCTCCGG - Exonic
1077293822 11:1814815-1814837 TGGCGCTGCCGTCGGGGGTCGGG - Intergenic
1077360989 11:2139991-2140013 TGGCGGGGGCTCCGGGGCTCCGG - Intronic
1078053475 11:7987399-7987421 TGGGGCCGCCGCCGGGACTGGGG - Exonic
1080844587 11:36015624-36015646 TGGGGGCACCACCGGGGCTCTGG - Intronic
1081636775 11:44727049-44727071 TGGGGCCGGGGCCGGGGCTGGGG - Intronic
1082986053 11:59172232-59172254 GCTCGCGGCCGCCGGGGCTCGGG + Intronic
1083595546 11:63916959-63916981 CGCCGCCGCCGCCGGTGCCCCGG - Intergenic
1083682814 11:64359129-64359151 TGGTGCCGCCTCCGGGGCCGAGG - Intronic
1083901777 11:65646807-65646829 GCGGGTCGCCGCCGGGGCTCAGG + Exonic
1083922209 11:65787077-65787099 TGGCGTCCCCGCCGCCGCTCGGG - Exonic
1083936640 11:65872938-65872960 TGGCGGCGCCGCGGGGGACCGGG - Intronic
1084040550 11:66540055-66540077 TGGCACCGCCTCCAGGGCTGAGG - Intronic
1084148558 11:67277639-67277661 TGGCGCGGCCGCAGCTGCTCTGG + Intronic
1084204412 11:67583679-67583701 TGCAGCGGCCGCCGGGGCTGGGG + Exonic
1084225363 11:67711783-67711805 AGGCGCCGCCCGCGGGGCCCAGG - Intergenic
1084284153 11:68120909-68120931 CTGCGCCGCGTCCGGGGCTCCGG + Exonic
1084650521 11:70486794-70486816 TGGCGCCGAGGCCAGTGCTCCGG - Intronic
1084758304 11:71252538-71252560 AGGAGCCGCCGCCGCGGCTCAGG + Intronic
1085574500 11:77589994-77590016 TGTCGCCGCTGCTGGGGCTCCGG + Exonic
1086590444 11:88508957-88508979 GGGCGCCGACGCCGGGGCTGGGG + Exonic
1089046325 11:115504320-115504342 CGGCGGCGCCTCCCGGGCTCCGG - Exonic
1090293887 11:125569548-125569570 CAGCTCCGCCGCCGCGGCTCCGG - Exonic
1090868140 11:130720374-130720396 TAACAGCGCCGCCGGGGCTCGGG + Intergenic
1091381884 12:67134-67156 TGCCGCCGCCGCCAGGGCCCAGG + Exonic
1091750625 12:3019452-3019474 TGGGGCAGCCGCCAGGGCACGGG - Intronic
1091776074 12:3185719-3185741 TGGGGCAGCCGCCTGGGCTTGGG + Intronic
1092001097 12:5033005-5033027 TGGGACCGCTGCCGGGGCTGGGG - Intergenic
1092727682 12:11500720-11500742 CGCCGCCACCGCCGGGGCCCAGG + Intronic
1092861513 12:12724039-12724061 AGGCGCGGCCGCCCGGGCGCGGG - Intergenic
1092894922 12:13001588-13001610 CGGCGCCACCGTCGGGGCTCAGG - Intergenic
1094155515 12:27333340-27333362 TGGGGTCGCCGCCGGCGCTCAGG + Intronic
1096495423 12:52037071-52037093 GGCCGCCGCCGCCGGGATTCCGG + Intronic
1096500905 12:52063329-52063351 TGGCGTGGCCGCAGGGGCTGGGG + Intergenic
1096675481 12:53223485-53223507 AGCCGCCGCCGCCAGGGCCCAGG - Intronic
1097267677 12:57755363-57755385 TGCTGCCACCGCCGGGGCTCCGG - Exonic
1100869317 12:98894541-98894563 TGGTGCCGCAGCCGGGGCAGAGG - Intronic
1101371767 12:104137701-104137723 TCGCGCCGCCGCCGGGGCTACGG + Intronic
1101970454 12:109309138-109309160 GGCCGCCGCTGCCGGCGCTCCGG + Exonic
1103989197 12:124786808-124786830 TGGCGGGGCCACCGGGGCCCTGG + Intronic
1105943642 13:25171586-25171608 CCCCGCCGCCGCCGCGGCTCCGG + Exonic
1106157495 13:27171785-27171807 CGTCGTCGCCGCCGGCGCTCAGG + Exonic
1106248390 13:27967020-27967042 TGACCCCGCGGCCTGGGCTCTGG + Intronic
1106269373 13:28138737-28138759 TGGTGGCCCCGCCGGGGGTCGGG + Exonic
1106340284 13:28820398-28820420 CGCCGCCGCCGCCGGCTCTCAGG + Exonic
1107123407 13:36819425-36819447 GGGAGCCGCAGCCGGGGCTAGGG - Exonic
1107624841 13:42272044-42272066 CGCCGCCGCCGCCGCAGCTCCGG - Intergenic
1112216315 13:97434311-97434333 CGCCGCCGCCGCCGGCGCCCAGG + Exonic
1113378792 13:109785510-109785532 TGCCGGCGCCGCCGGGGCCGAGG - Exonic
1115217312 14:31026192-31026214 TGGGGCCCCGGCCGGGGCGCAGG + Exonic
1117252804 14:53953116-53953138 TGGCCCGGCAGCCGGGGCGCTGG - Intronic
1118404982 14:65413405-65413427 TGGCGCAGCCCCGGGGGCGCGGG + Intronic
1119438528 14:74612809-74612831 TGGCGCCGCCGCCTTCGCTCTGG + Intergenic
1123964271 15:25439181-25439203 TGCCGTCGCCGCCGGCGCACGGG + Intergenic
1125685123 15:41559307-41559329 TGCCGCCGCCACCGCGGCTCGGG + Exonic
1125918647 15:43511110-43511132 TGCAGCCGCCACCGCGGCTCCGG - Intronic
1127328633 15:57918181-57918203 TGGCGCCACTGTCTGGGCTCTGG - Intergenic
1127922633 15:63505018-63505040 TGGCCCGGCCGTCGGGCCTCGGG - Intronic
1128153548 15:65377862-65377884 CGGCGCCGGGGCCGGGGCTGGGG + Exonic
1128454692 15:67825874-67825896 CAGCGCCGCCGCCGAGGCTCGGG - Intronic
1129295053 15:74595663-74595685 TGGCGCTGCTGCCGAGGCTCTGG - Exonic
1129644738 15:77419835-77419857 TGGCGCCGCCGCCGGGGCTCTGG - Intronic
1129675934 15:77632506-77632528 CGGAGCCGGGGCCGGGGCTCGGG + Intronic
1129823644 15:78620585-78620607 TGGCGCCGTCGCCGGGGACTCGG - Intronic
1132251968 15:100341298-100341320 CGTCGCCGCCGTCGGGGCCCGGG + Exonic
1132570558 16:642216-642238 TTGCGCAGCCGCCGGGACCCTGG + Exonic
1132571438 16:646100-646122 AGGCACCGCCCCAGGGGCTCTGG - Intronic
1132641872 16:981774-981796 CGCCGCCGCCGCCGAGGCTCGGG - Intergenic
1132788318 16:1670546-1670568 TGGGGCCGGGGCCGGGGCTAGGG + Intronic
1132851538 16:2027015-2027037 AGGCGCGGCCGCAGCGGCTCCGG - Exonic
1132889462 16:2196689-2196711 TGGCGCCGCCTCCCGGACGCCGG + Intergenic
1133784518 16:8963819-8963841 CGGCGTCGTCGTCGGGGCTCCGG + Intronic
1134149927 16:11797409-11797431 GCGCGTCGACGCCGGGGCTCCGG - Intergenic
1135586983 16:23679015-23679037 TGGAGCCGCCGCCGGAGCTCCGG - Exonic
1136141656 16:28292594-28292616 TGGAGCCGCAGCCGGAGCCCGGG + Exonic
1137738470 16:50742266-50742288 CGGCGCAGCCGCCTGGCCTCAGG + Intronic
1138179239 16:54931061-54931083 TGGCCCCGGCTCCGGGGCTCCGG - Exonic
1138360746 16:56425436-56425458 TGCCGCCGCCGCCGCCGCGCCGG + Exonic
1142029478 16:87831404-87831426 TGCCGCCCCCGCCTGGGCACCGG - Exonic
1142156358 16:88534375-88534397 CAGCGCCGGTGCCGGGGCTCCGG - Exonic
1142855103 17:2724698-2724720 TGGCGCCGGGGCCCGGGCGCGGG + Intergenic
1143519428 17:7437172-7437194 GGGCGCCGCCGCCCGGGTCCCGG - Exonic
1143747306 17:9003691-9003713 AGGCGCCGGGGCCGGGGCACCGG - Intergenic
1144109804 17:12020901-12020923 CGGAGCCGCCGCCGCCGCTCGGG - Exonic
1144760330 17:17703526-17703548 TGGCTCCGGCTCTGGGGCTCAGG + Intronic
1145243477 17:21252931-21252953 TGGGGGCGCGGCCGGCGCTCCGG - Intronic
1146058703 17:29593551-29593573 CGGCGCCGGAGCCGGGGCCCGGG - Exonic
1146438909 17:32876872-32876894 TGGCGCCAGCGCGGGGGCTCAGG + Exonic
1147130178 17:38403117-38403139 TGGCGCCACCTCCATGGCTCAGG - Exonic
1148556595 17:48582224-48582246 CGCCGCCGCCGCCGGTGCGCAGG - Intronic
1148755767 17:49972239-49972261 CGGTGCCGCCGCGGGGGATCTGG - Intronic
1149647264 17:58249581-58249603 GGGCGCCGCCAACAGGGCTCTGG + Exonic
1149995915 17:61405843-61405865 TGGCGCTGCCGCGGGGTCACAGG - Intronic
1150267882 17:63842605-63842627 TGGCGGCGGCGCCGTGGCTGCGG - Exonic
1151604776 17:75129509-75129531 TGGTGCCCCCTCCAGGGCTCTGG + Exonic
1151875957 17:76868476-76868498 TGGCTCCGCCGCCCGCGCTCTGG - Intronic
1152174924 17:78781605-78781627 CGGCGCCGCCGGCGAGGCGCGGG - Intronic
1152544197 17:80992436-80992458 CGGCAGCACCGCCGGGGCTCCGG - Intronic
1152677308 17:81648243-81648265 GGGCGCCGGGGCTGGGGCTCTGG - Exonic
1152789968 17:82273574-82273596 GAGCGCCGCCGCCGCTGCTCCGG + Exonic
1152834251 17:82519462-82519484 TGGCGCGGGCGCGGGAGCTCGGG - Intergenic
1153201901 18:2655724-2655746 CAGCGCCGCCGCCGGGACTGTGG - Exonic
1153488820 18:5628745-5628767 TGGCGCCGCCGCTGCGGATTCGG - Intronic
1156213839 18:34976943-34976965 CGCCGCCGCCGCCGCCGCTCCGG - Intronic
1156218522 18:35027443-35027465 TGGGGCCTCAGCTGGGGCTCTGG - Intronic
1157529482 18:48409323-48409345 CGGCGCGGCCGGCGAGGCTCGGG - Intronic
1158954158 18:62523597-62523619 TGCCGCCGCCGCCGCCGCCCCGG + Exonic
1160554320 18:79716248-79716270 TGGCCCCGCCTCCGGGGCTCAGG + Intronic
1161162206 19:2767813-2767835 AGGGGCCGCCGCCTGTGCTCTGG + Intronic
1163019547 19:14475022-14475044 TGGGGCCGCCTCCAGGCCTCTGG - Intronic
1165935475 19:39386086-39386108 TGGCGCTGCGGCTGTGGCTCCGG + Exonic
1166139661 19:40799306-40799328 TCGCGCCGGCGCCCCGGCTCCGG - Intronic
1166984142 19:46649575-46649597 AGGCGCCGCCGCCGGGGGGCGGG - Exonic
1167507345 19:49877918-49877940 TGGCCCCGCCCCCCCGGCTCAGG + Exonic
1167509794 19:49889988-49890010 TGGTACAGCCGCCGGCGCTCTGG - Exonic
1168280884 19:55304814-55304836 CGACGCCACCGCCGGGGCTGGGG - Exonic
1168309195 19:55452167-55452189 GGGCGCCGCCGCCCGGTCCCAGG + Intergenic
1168316454 19:55486732-55486754 TGGCACCGCCGCCGGGGCGTGGG + Exonic
926718620 2:15942693-15942715 AGGGCCCGCCGCCGGGGCACTGG - Exonic
926718637 2:15942739-15942761 TGCCGCCCCAGCCGGGGCCCCGG + Exonic
927215824 2:20667350-20667372 CGCCGCCGCCCCCTGGGCTCCGG - Exonic
927751346 2:25673354-25673376 TGCGGCCGCCGCCGGGGCTGTGG - Intronic
930730412 2:54723607-54723629 TGGCCCCGCCCCCGGAGCCCCGG + Intronic
931036629 2:58251486-58251508 TGGGACCGCCGCCGGGACTGGGG - Intergenic
931309573 2:61065795-61065817 TGGCTCCGCCGCTGCGGCGCTGG + Intergenic
931665928 2:64609509-64609531 TGGCGCGGCCGCCGGGCCTTGGG - Intergenic
932932815 2:76062399-76062421 AGGCTCCGCCCCCGGGGTTCAGG - Intergenic
933751189 2:85602814-85602836 TGACGCGGGCGCGGGGGCTCGGG - Intronic
934882329 2:97995374-97995396 AAGGGCCGCGGCCGGGGCTCCGG - Intronic
935112219 2:100104485-100104507 TACCGCCGCCGCCGAGGCTCGGG + Exonic
935196643 2:100820239-100820261 CGCCGCCGCCGCCGCGGCTGCGG - Exonic
936122758 2:109760663-109760685 CGCCGCCGCCGCCGAAGCTCGGG - Intergenic
936221935 2:110610810-110610832 CGCCGCCGCCGCCGAAGCTCGGG + Intergenic
937083462 2:119156548-119156570 TGCCGCCGCCTCAAGGGCTCGGG + Exonic
940640760 2:156342379-156342401 TGCCGCAGCCGCCGGGGGCCGGG - Intergenic
941366970 2:164621424-164621446 TGGCCTCGCCGCCTGCGCTCGGG + Exonic
942241109 2:173964676-173964698 CGCCGCCGCCGCCGGGGGGCGGG - Intronic
943060673 2:183038565-183038587 TGGCCTCGCCGCCGCCGCTCTGG + Exonic
946035489 2:216738901-216738923 TGGAGCAGCCGCTGTGGCTCTGG - Intergenic
946362835 2:219229409-219229431 GGGCGCCGCCGGCGGGGCGGGGG - Intronic
946416863 2:219544110-219544132 AGGCGCAGGAGCCGGGGCTCGGG - Intronic
946692563 2:222320114-222320136 CTGCACCGCCGCCTGGGCTCCGG + Intergenic
948046581 2:234950789-234950811 AGGGGCAGCCGCAGGGGCTCGGG + Intergenic
949014696 2:241702498-241702520 TGGCGCCCGCTGCGGGGCTCCGG + Intronic
1169214727 20:3786510-3786532 CGGCGCCGCCGCCGCCGCCCCGG + Exonic
1171994857 20:31723433-31723455 TGGCGCCCCCGGGAGGGCTCCGG + Intronic
1172083252 20:32358753-32358775 TGCCGCCGCCGCCGGGGAGAAGG + Exonic
1172274979 20:33674438-33674460 TGGCGCCGGCGCCGACGCGCGGG + Intronic
1172274981 20:33674444-33674466 CGGCGCCGACGCGCGGGCTCAGG + Intronic
1172983435 20:38962459-38962481 TGGCGCCGCGGCCGGCGCCCTGG + Intronic
1173411795 20:42817879-42817901 TGCCCCTCCCGCCGGGGCTCAGG - Intronic
1174494849 20:50931762-50931784 TGCCTCCGCCGCCGGCGCTGCGG - Intergenic
1175847371 20:62065825-62065847 CGCCGCCGCCGCCGCCGCTCGGG + Intergenic
1176029861 20:63006726-63006748 TGGCCGCGCCGCCTGGGCTCGGG + Exonic
1176034237 20:63028562-63028584 TGGGGCAGCGGCCGGGACTCAGG + Intergenic
1176107166 20:63394879-63394901 TGGAGCCCCCGCCTGGACTCAGG - Intergenic
1176217717 20:63956130-63956152 GGGCGCCGCCGCCTGGCCTCCGG + Intronic
1176283318 20:64327699-64327721 TGCCGCCGCCGCCAGGGCCCAGG - Intergenic
1176705827 21:10119593-10119615 TGGCGGCGACGCCGCGGCTGCGG + Intergenic
1178992482 21:37367203-37367225 CGCCGCCGCCGCCCGGGCCCCGG + Intronic
1179674987 21:42974965-42974987 AGGCGCCGCCGCCGCCGCGCTGG + Intronic
1180064420 21:45405389-45405411 AGGCGCCGCCGCCGCGGCCATGG - Intronic
1180132420 21:45835199-45835221 AGGCCCCGCCCCCGGGGCCCAGG - Intronic
1180559227 22:16601981-16602003 GGCCGCCGCCGCCGCTGCTCGGG - Intergenic
1181017702 22:20080556-20080578 TGGGGACGCCTCCGGGGCTGGGG + Intronic
1181941764 22:26483490-26483512 GGGCGCAGCCCCCGGGGCGCAGG + Intronic
1183055113 22:35300333-35300355 GGGTCCCGCCGCCTGGGCTCTGG + Intronic
1183486184 22:38088887-38088909 TGGCGCCCCCGCCGCCGCCCGGG + Exonic
1183601801 22:38844168-38844190 TGGGGGCGCCGCCGGGGATGCGG + Intergenic
1184412176 22:44331717-44331739 TGGGGCCGGGGCCGGGGCTGGGG + Intergenic
1185338277 22:50280431-50280453 CGGGGCGGCCGCAGGGGCTCTGG - Intronic
1185409485 22:50674525-50674547 CAGCGCGGCCGACGGGGCTCCGG + Intergenic
950040239 3:9915407-9915429 TGGGCCCGCTGCCGTGGCTCTGG + Exonic
950374290 3:12557332-12557354 TGCCGCCACAGCCGGGGATCCGG + Intronic
951080304 3:18444729-18444751 CGCCGCCGCCGCCGGAGCTGCGG + Intronic
951543636 3:23806122-23806144 CGGCCGCGCCGCCGGGCCTCGGG + Intronic
951881403 3:27484199-27484221 TGCCGCCGCCGCCGAGCCCCCGG + Intronic
951907893 3:27721907-27721929 CGCCGCCGCCGCCGCGGCTGCGG - Exonic
956774081 3:72550456-72550478 TGGCCCCGCCGCTGTGTCTCTGG + Intergenic
959530734 3:107431541-107431563 CGCCGCCGCCGCCGGGGCTCGGG + Intergenic
960096729 3:113696607-113696629 CCGCGCTGCCGCCGGGTCTCCGG - Exonic
961827254 3:129605646-129605668 TGGCGTCGCCGCCGGCGCCGTGG + Exonic
963236675 3:142963376-142963398 TGGCGCCGGCTCCCGGGCGCTGG + Exonic
963511134 3:146250897-146250919 TGGCGCGGGCGCCCGGGCTGCGG - Intronic
966732553 3:183162858-183162880 CGGCGCAGCCGCCGGGGCCCGGG + Exonic
966734626 3:183179258-183179280 TTCTGCCGCCGCCGAGGCTCCGG + Exonic
966919863 3:184604367-184604389 TCGCCCCGGCGCGGGGGCTCCGG - Intronic
967072094 3:185971226-185971248 TGGGCCCGGCGCCGTGGCTCAGG + Intergenic
967870496 3:194225296-194225318 AGGCCCCGCCGCCAGGACTCAGG + Intergenic
968433966 4:575726-575748 GGGGGCCGCGGCCGGGGCCCCGG - Intergenic
968756105 4:2417424-2417446 TGGCGCAGCCGCTGAGGCACGGG + Intronic
969492916 4:7510220-7510242 TGGAGCGGCCGGCGGGGCTGAGG + Intronic
969732166 4:8963875-8963897 AGGCGCCGCCCGCGGGGCCCAGG + Intergenic
969791759 4:9497960-9497982 AGGCGCCGCCCCCGGTGCCCAGG + Intergenic
970202880 4:13627489-13627511 CGCCGCCGCCGCCGGGCCCCGGG - Exonic
970456065 4:16226030-16226052 TGGCGCGGCCGCGGGGGCCTCGG + Intronic
972437246 4:39045335-39045357 GGGCGCCGGCTCCGGCGCTCGGG - Intronic
972621325 4:40750337-40750359 TGGGGACGCGGACGGGGCTCCGG + Intronic
972960768 4:44448927-44448949 TAGCGCCACCGTCGGCGCTCCGG - Intergenic
975118592 4:70705254-70705276 TGCTGCCGCCGCCGCCGCTCGGG - Intronic
976704520 4:88007429-88007451 GGGCGCCCGCGCCCGGGCTCCGG + Intergenic
980405040 4:132344822-132344844 TGGGGCCGGGGCCGGGGCTGGGG + Intergenic
982712275 4:158769191-158769213 TGATGCCGCCGCCGCAGCTCCGG - Exonic
983077498 4:163343916-163343938 TGCCGCCACCGCCGGGGTGCAGG + Intronic
984928319 4:184825847-184825869 CGGCGCCTCGGCCGGGGCCCGGG + Intronic
984972512 4:185203792-185203814 ACTCGCCGCCGCCTGGGCTCCGG + Intronic
986695868 5:10353939-10353961 GGGCGCCGACGCAAGGGCTCGGG - Intronic
986721191 5:10563019-10563041 TGGCGCAGCCGCTGGGGACCAGG - Intergenic
986733275 5:10650127-10650149 TGGCGCTGGGGCCGGGGCTGGGG + Exonic
987015085 5:13810093-13810115 TGCCGCCGCCAGCGGGGCCCGGG - Exonic
987050760 5:14144767-14144789 AGGCGCCGCCGCTGGGGTACCGG - Intronic
989198312 5:38737684-38737706 TGGCTCCTCCACCTGGGCTCTGG - Intergenic
991900558 5:71455808-71455830 CCGGGCAGCCGCCGGGGCTCGGG + Exonic
993502377 5:88678416-88678438 TGCCGCTGCCGCCGCGGGTCCGG + Intergenic
994107323 5:95961738-95961760 TGCCGCCGCCGCCGCCGCTCCGG + Exonic
995052738 5:107724771-107724793 GGCCGCCGCCGCCGGGGGCCGGG - Intergenic
995650411 5:114362363-114362385 CGCCCCCGCCGCCGGGGCACCGG - Exonic
996404292 5:123090636-123090658 CGGCGCCGGCGCCGGCGCCCCGG - Intronic
998428937 5:142053934-142053956 TGGCTCTGCCGCCTGTGCTCTGG + Intergenic
998517707 5:142770714-142770736 GCGCGCCTCCGCCGGGGCCCGGG - Exonic
1001381979 5:171311318-171311340 CGGGGCCGCCGGCGGGGCCCCGG - Intronic
1002286453 5:178165712-178165734 TGCGGGCGCTGCCGGGGCTCAGG + Intergenic
1002487654 5:179550628-179550650 TGGAGCCGGGGCCGGGGCCCGGG + Exonic
1002888035 6:1312854-1312876 TGGCGCCGCCGCCCGCGGCCGGG - Exonic
1002927302 6:1611774-1611796 CGCCGCCGCCGCCGTGACTCAGG - Exonic
1003645417 6:7910254-7910276 GGGCGCGGGCGCCGCGGCTCGGG - Intronic
1004396205 6:15248388-15248410 TGGCGCGGCCTGCGGGGCGCGGG + Intronic
1004650186 6:17600609-17600631 TGGAGCCGCCGCGCGAGCTCAGG + Exonic
1004864278 6:19837867-19837889 CGCCGCCGCCGCCGCGGCTGCGG - Exonic
1005522771 6:26614554-26614576 GGGCGCCGCCGCAGGGACTCAGG - Intergenic
1005987683 6:30884575-30884597 GGGAGGCGCCGGCGGGGCTCGGG - Intronic
1006677809 6:35776748-35776770 TGGCCCCGCCGCCGGGGCACTGG + Intronic
1006924975 6:37649090-37649112 TCCCGCCGCCGCCGAGGCGCCGG - Exonic
1008649024 6:53544803-53544825 AGGGGCCGCCGCCGGGGAGCCGG - Exonic
1010703259 6:79077610-79077632 TGCCGCCGCCGGCAGGGCGCGGG - Intronic
1015251832 6:131135534-131135556 TGCCGCTGCCGCGGGGGCTGCGG + Intergenic
1016010790 6:139135624-139135646 TGCGGCCGCCGCGGGGGCTGCGG + Exonic
1018634670 6:165850202-165850224 TGGAGCCGCCACCTGGACTCCGG + Intronic
1018754518 6:166837589-166837611 TGGCCCCGTGGCTGGGGCTCTGG + Intronic
1019408562 7:896858-896880 AGGGGCCGCCTGCGGGGCTCCGG - Intergenic
1019409940 7:901956-901978 TGGAGCCGACTCTGGGGCTCCGG + Intronic
1019474339 7:1236736-1236758 AGGCGCCGGGGCCGGGGCTGGGG - Exonic
1020004560 7:4775491-4775513 AGGTGCCGCGGCCGGGGGTCCGG - Intronic
1020309117 7:6855570-6855592 AGGCGCCGCCCCCGGGGCCCAGG - Intergenic
1021313485 7:19118287-19118309 TGGCCGCGCCGCGGGGGCTGAGG + Intergenic
1021716665 7:23468656-23468678 TGGAGCCGCGTCCGGGCCTCGGG - Intronic
1024043824 7:45574466-45574488 CGGCGCCGCCGCCCGCGCCCCGG + Intronic
1026951138 7:74347610-74347632 AGGCGTGGCCGCCAGGGCTCAGG - Intronic
1029432332 7:100539370-100539392 TGACCCCGCCGCCCGGGCCCGGG - Exonic
1029927140 7:104329399-104329421 AGGCGCCAGCGCCGGGGCTGGGG - Intronic
1031051882 7:116953440-116953462 CGCCGCCGCCGCCGCGGCCCGGG - Exonic
1031531920 7:122886381-122886403 GGGCGCAGCCGCCGGGGGTGAGG - Intronic
1031963551 7:128010861-128010883 TGGCGGCTCCACAGGGGCTCTGG - Intronic
1034147235 7:148884123-148884145 CGGCCCGGCCGGCGGGGCTCCGG - Intronic
1034182178 7:149147577-149147599 TCACGCGGCCGTCGGGGCTCGGG - Exonic
1034201428 7:149285326-149285348 TCGCGGGGCCGCCGGGGCTCGGG - Intronic
1035212335 7:157337340-157337362 TGGGGCCGGGGCCGGGGCTGGGG + Intronic
1035573257 8:687990-688012 TGGGGCTGCGGTCGGGGCTCGGG - Intronic
1035664671 8:1372174-1372196 TGGCGCCAACGCTGGGGCGCAGG + Intergenic
1039608589 8:38901704-38901726 GGTCGCCGCCGCCAGGGGTCGGG + Intronic
1040471220 8:47737525-47737547 TCGCGCCGCTGCCGGTACTCGGG + Exonic
1043052854 8:75404576-75404598 GGACGCGGCCACCGGGGCTCAGG - Intergenic
1043476637 8:80611649-80611671 TGGCGCCTCCTCCGGTGCACGGG + Intergenic
1044343159 8:91070685-91070707 CCGCGCCGCCGCCGGGGTGCAGG + Intronic
1045007429 8:97928558-97928580 TGGCTCAGCCCCTGGGGCTCAGG + Intronic
1045737921 8:105318457-105318479 CGGCGCCGCCGCCGCCGCTCCGG - Intronic
1046654120 8:116874440-116874462 TGGCGCCGCCGCTTGGGCGCCGG + Intronic
1048981678 8:139705876-139705898 TGGCGCCGCTGCCAGGGCGGCGG - Intergenic
1049369061 8:142254851-142254873 TGGTGCTGCACCCGGGGCTCTGG + Intronic
1049585306 8:143430169-143430191 CGCCGCCGCCGCCGGTGCCCGGG + Exonic
1049748544 8:144273104-144273126 TGGCGGCGCGGCCTCGGCTCAGG - Intronic
1049755917 8:144311262-144311284 TGGGGCCCCCGCCGGCCCTCTGG - Intronic
1049761484 8:144333797-144333819 GGGGGCCGCCGCCGAGGCTGTGG + Exonic
1049782637 8:144435872-144435894 CGGCCCCGCCCCCGGGGCACTGG - Exonic
1051482950 9:17579121-17579143 TCGTGCCGCCGCCGGGGCTATGG - Exonic
1052888795 9:33676860-33676882 TGCCGCCGCTGCCAGGCCTCTGG - Intergenic
1052991868 9:34523217-34523239 TGGCTCCGCCCCCGGGCCGCAGG - Intergenic
1055090984 9:72364790-72364812 TGGTGCCGCCGCCGCGGGCCGGG + Intronic
1056386280 9:86099585-86099607 TCGCGCCGCCGGCGCTGCTCGGG - Intronic
1057489129 9:95508310-95508332 TGCCGCCGCCGCCGCGGTCCTGG + Exonic
1057773160 9:97984461-97984483 GGGCGCCGCCGCCGCGGCACAGG - Intronic
1060549526 9:124478373-124478395 TGGGGCCGCTGTTGGGGCTCAGG - Exonic
1060700700 9:125747231-125747253 TTCCGCCGCCGCCGAGGCTGAGG - Intergenic
1060979856 9:127785817-127785839 GGGCGCCGGAGCTGGGGCTCGGG - Intronic
1061196662 9:129110569-129110591 CGCCGCCGCCGCCGCGGCTGGGG + Exonic
1061401492 9:130370766-130370788 TGGCGCCACAGGCTGGGCTCTGG - Intronic
1061559734 9:131394506-131394528 TGGCGGCGCCGCGCGGCCTCAGG + Intronic
1061840569 9:133356523-133356545 TGGAGCCGGGGGCGGGGCTCTGG - Intronic
1061843748 9:133375687-133375709 GGGCGCCGAGGCCCGGGCTCCGG + Intronic
1062397447 9:136358182-136358204 TGGCACTGCTGCTGGGGCTCGGG - Exonic
1202790861 9_KI270719v1_random:89682-89704 TGGCGGCGACGCCGCGGCTGCGG + Intergenic
1185457753 X:319231-319253 CGCCGCCGCCGCCGAGGCTCGGG - Intergenic
1187900947 X:24025867-24025889 CGGCGCCGCCGTCGGGGCTGAGG + Intronic
1189323038 X:40097646-40097668 TGCCGCCGCCGCCCGCGCTCGGG + Intronic
1189325694 X:40109513-40109535 TGGCTCCGCCGCCCGGGGCCGGG - Intronic
1189339288 X:40192398-40192420 TGGGGCCTCAGCTGGGGCTCTGG - Intergenic
1190732864 X:53236178-53236200 TGGCGCAGCGCCCAGGGCTCTGG + Intronic
1192152007 X:68718371-68718393 TGGGGCCGGGGCCGGGGCTGGGG - Exonic
1195599207 X:106726915-106726937 TGGGGCCGCCGCCTGGGGCCGGG + Exonic
1198550830 X:137743367-137743389 TGGGGGAGCCGCCGTGGCTCAGG - Intergenic