ID: 1129644741

View in Genome Browser
Species Human (GRCh38)
Location 15:77419843-77419865
Sequence GTTCTGGGTGGCGCCGCCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 81}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129644741_1129644755 24 Left 1129644741 15:77419843-77419865 CCGGCGGCGGCGCCACCCAGAAC 0: 1
1: 0
2: 0
3: 6
4: 81
Right 1129644755 15:77419890-77419912 CCGCCCCGCCCGGATTCCCCCGG 0: 1
1: 0
2: 1
3: 16
4: 153
1129644741_1129644751 14 Left 1129644741 15:77419843-77419865 CCGGCGGCGGCGCCACCCAGAAC 0: 1
1: 0
2: 0
3: 6
4: 81
Right 1129644751 15:77419880-77419902 AGAACCCGCGCCGCCCCGCCCGG 0: 1
1: 0
2: 0
3: 8
4: 126
1129644741_1129644756 25 Left 1129644741 15:77419843-77419865 CCGGCGGCGGCGCCACCCAGAAC 0: 1
1: 0
2: 0
3: 6
4: 81
Right 1129644756 15:77419891-77419913 CGCCCCGCCCGGATTCCCCCGGG 0: 1
1: 0
2: 1
3: 10
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129644741 Original CRISPR GTTCTGGGTGGCGCCGCCGC CGG (reversed) Intronic
901045522 1:6393494-6393516 GCTCGGGGTGGGGCCGGCGCGGG - Intronic
902631229 1:17705792-17705814 GTTCTGTGTGGCCCCCCAGCTGG + Intergenic
907069335 1:51519421-51519443 GGTTTGGGCGGCGCCGCGGCCGG - Intergenic
915302915 1:154961759-154961781 GTTCCGGTTGCTGCCGCCGCTGG - Intronic
916224408 1:162475229-162475251 GTTCTGGCTGGCTCCACCACTGG + Intergenic
919678445 1:200409808-200409830 GGTCTGGGCGGCGGCGCGGCGGG - Intronic
920380130 1:205530365-205530387 GTTCTGGGTGGCCCTGCTCCCGG - Intronic
922471982 1:225882441-225882463 GTACAGGCTTGCGCCGCCGCGGG - Intergenic
922937284 1:229432394-229432416 GTTGTGGGTGACGCCGTCGCCGG + Exonic
924870006 1:248031586-248031608 GGTCTGGCTGGCACCACCGCAGG + Intronic
1066480911 10:35794827-35794849 CTTCTGGTTGGTGCCGCTGCAGG + Intergenic
1076395860 10:130136817-130136839 GGCCTGGGCGGCCCCGCCGCGGG + Intronic
1087672950 11:101128322-101128344 GCTCTGGGTGGCGCGGCGGCTGG - Exonic
1097186062 12:57197127-57197149 GCTGTGGGGGTCGCCGCCGCGGG - Exonic
1101175880 12:102151269-102151291 GGTCTGGGTGGGGGTGCCGCGGG + Intronic
1110705970 13:78602240-78602262 GTCGTGGGCGCCGCCGCCGCCGG + Exonic
1113575038 13:111389292-111389314 GGTCTGGATGGCGCCGCTCCAGG - Intergenic
1121279357 14:92688030-92688052 GTTCGCGGTGGAGCGGCCGCAGG + Exonic
1121546978 14:94769857-94769879 GTCCGAGGAGGCGCCGCCGCTGG + Exonic
1122145022 14:99684012-99684034 GTTCTGGGCGGAGCTGCTGCTGG + Intergenic
1127606343 15:60591947-60591969 GGTCGGGGAGGCGCCGCGGCCGG - Intronic
1129644741 15:77419843-77419865 GTTCTGGGTGGCGCCGCCGCCGG - Intronic
1131195584 15:90352318-90352340 GTTCTGGGAGGCACAGCCTCGGG + Exonic
1140475569 16:75237931-75237953 GTGCTGGGGGGCGCAGCAGCTGG + Intronic
1143464786 17:7129475-7129497 GTCCGGGGTGGCGCTGCTGCAGG - Intergenic
1147583232 17:41638469-41638491 GATCTGGGTGGGGCCGCCTGGGG - Intergenic
1147768599 17:42852660-42852682 GATCTGAGTGGTGTCGCCGCAGG - Exonic
1147771191 17:42868592-42868614 GATCTGAGTGGTGTCGCCGCAGG - Intergenic
1148771258 17:50068243-50068265 GTTCTGGGTGAAGCCACCGCTGG - Exonic
1151746495 17:76014450-76014472 GATCTGGCTGGGGCCGTCGCTGG + Exonic
1155209219 18:23586532-23586554 TTTCTGGGAGGTGCCGCTGCCGG + Exonic
1155872149 18:31042304-31042326 GCTCTGGCGGGCGCCGTCGCGGG - Intronic
1158601974 18:58863660-58863682 GTTCAGCGCGGCGCCGCCGGCGG - Intronic
1161072882 19:2271142-2271164 GTCCTGGGCGGCGCCGCCCGAGG + Intronic
1163715135 19:18868947-18868969 GTTCGGCGTCGCGCCGCGGCCGG + Exonic
1165153248 19:33773057-33773079 GTACTGAGGGGCGCCGCAGCTGG + Exonic
1168153547 19:54461338-54461360 TTGCTGGGTGCCCCCGCCGCAGG - Exonic
926218738 2:10921365-10921387 GTTCTGGGTGTGGCCACCCCAGG - Intergenic
934767657 2:96889041-96889063 GATCTGGGTGGTGCCCCCGCAGG + Intronic
943185177 2:184598352-184598374 GCTCGGGCTGGCGCGGCCGCGGG + Exonic
946250100 2:218406448-218406470 GGCCTGGGTGGGGCCGGCGCCGG + Intergenic
1175902891 20:62366955-62366977 GGTCTGGTTGGGGTCGCCGCCGG + Exonic
1176230540 20:64030472-64030494 GGTCTGGGTGCCGCCCCCACAGG + Intronic
1176430673 21:6573639-6573661 GTTCTGGGTGGGGGCACGGCAGG + Intergenic
1176548444 21:8211819-8211841 GTTCTCGGCGGCGTCGCGGCGGG + Intergenic
1176549793 21:8216197-8216219 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
1176556336 21:8256025-8256047 GTTCTCGGCGGCGTCGCGGCGGG + Intergenic
1176557684 21:8260426-8260448 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
1176567375 21:8394854-8394876 GTTCTCGGCGGCGTCGCGGCGGG + Intergenic
1176568718 21:8399231-8399253 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
1176575275 21:8439067-8439089 GTTCTCGGCGGCGTCGCGGCGGG + Intergenic
1176576632 21:8443466-8443488 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
1179544990 21:42107807-42107829 GTTCTGGGTGGGGCCAGCTCAGG + Intronic
1179546102 21:42113245-42113267 GTTCTTGGTGGCGCCTCAGATGG - Intronic
1179706067 21:43181101-43181123 GTTCTGGGTGGGGGCACGGCAGG + Intergenic
1182423028 22:30257685-30257707 GTGCTGCGTGGCGAGGCCGCTGG + Intergenic
1183328502 22:37207047-37207069 GTTCGGAGCGCCGCCGCCGCTGG + Exonic
1184445385 22:44544142-44544164 TCTCTGTGTGGCGCCGCCTCAGG - Intergenic
1185342938 22:50299727-50299749 GGGCTGGGTGGCGGGGCCGCCGG - Intronic
1203253326 22_KI270733v1_random:128122-128144 GTTCTCGGCGGCGTCGCGGCGGG + Intergenic
1203254682 22_KI270733v1_random:132523-132545 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
1203261381 22_KI270733v1_random:173201-173223 GTTCTCGGCGGCGTCGCGGCGGG + Intergenic
1203262738 22_KI270733v1_random:177602-177624 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
954093267 3:48301720-48301742 GTTCAGGGTGGCGGCCCGGCGGG + Intergenic
957448571 3:80346398-80346420 GTTCTGGCTAGCTCCACCGCCGG - Intergenic
984765735 4:183398982-183399004 GTTCTGGATGGAGCCGCAGCAGG - Intergenic
985757057 5:1725434-1725456 GTTCTGGGAGGAGCTGCAGCAGG - Intergenic
986306651 5:6521487-6521509 GGTCAGGGTGGCGCAGCCGCAGG + Intergenic
1006441341 6:34055636-34055658 GGTCTGGGTGGCTCTGCGGCAGG - Intronic
1016762303 6:147751022-147751044 GTTCTGGGTGCTGCTGCTGCTGG + Intergenic
1017873001 6:158502473-158502495 GTTCAGGGTGGCACTGCTGCAGG - Exonic
1024520963 7:50304096-50304118 GTACCTGCTGGCGCCGCCGCCGG - Intergenic
1029533865 7:101144132-101144154 GTTCAGGCTGGCCCCGCGGCTGG - Intergenic
1049109747 8:140635501-140635523 GTACATGGTGGCGCCGCCGAGGG + Exonic
1049406575 8:142454254-142454276 GTTTTGGGTGGCGTCGGGGCTGG - Intronic
1053919441 9:42973289-42973311 GGGCTGGAGGGCGCCGCCGCGGG + Intergenic
1057207916 9:93184487-93184509 GTCCTTTGTGGAGCCGCCGCCGG + Intergenic
1060897125 9:127225172-127225194 GTTCGGGGCGGCGCCGGGGCGGG + Intronic
1060941635 9:127546016-127546038 GCTCTGGGTGGTGACGCTGCTGG - Intronic
1062542060 9:137045886-137045908 GCCCTGCGTGGAGCCGCCGCCGG - Exonic
1062622238 9:137428342-137428364 CTTCTGGGTGGAGCCACCCCTGG - Intronic
1203469726 Un_GL000220v1:111269-111291 GTTCTCGGCGGCGTCGCGGCGGG + Intergenic
1203471083 Un_GL000220v1:115668-115690 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
1203477547 Un_GL000220v1:155241-155263 GTTCTCGGCGGCGTCGCGGCGGG + Intergenic
1203478904 Un_GL000220v1:159640-159662 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
1192434795 X:71136569-71136591 GTACTGGGTGGAGCAGCCCCCGG - Exonic
1192880121 X:75274457-75274479 GTTGAGGCTGGAGCCGCCGCAGG - Exonic
1198650434 X:138857658-138857680 GTTCTGGATGACGCCCCCCCTGG - Intronic