ID: 1129644858

View in Genome Browser
Species Human (GRCh38)
Location 15:77420300-77420322
Sequence TCTCCCTCAGCCCCAGCGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 264}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129644851_1129644858 -5 Left 1129644851 15:77420282-77420304 CCCCGGTCGTCTCCCAGGTCTCC 0: 1
1: 0
2: 1
3: 11
4: 125
Right 1129644858 15:77420300-77420322 TCTCCCTCAGCCCCAGCGGGAGG 0: 1
1: 0
2: 3
3: 36
4: 264
1129644846_1129644858 20 Left 1129644846 15:77420257-77420279 CCGTGAGCACGCGCGCGCTCACG 0: 1
1: 0
2: 1
3: 1
4: 50
Right 1129644858 15:77420300-77420322 TCTCCCTCAGCCCCAGCGGGAGG 0: 1
1: 0
2: 3
3: 36
4: 264
1129644853_1129644858 -7 Left 1129644853 15:77420284-77420306 CCGGTCGTCTCCCAGGTCTCCCT 0: 1
1: 0
2: 2
3: 24
4: 245
Right 1129644858 15:77420300-77420322 TCTCCCTCAGCCCCAGCGGGAGG 0: 1
1: 0
2: 3
3: 36
4: 264
1129644852_1129644858 -6 Left 1129644852 15:77420283-77420305 CCCGGTCGTCTCCCAGGTCTCCC 0: 1
1: 0
2: 0
3: 13
4: 195
Right 1129644858 15:77420300-77420322 TCTCCCTCAGCCCCAGCGGGAGG 0: 1
1: 0
2: 3
3: 36
4: 264
1129644845_1129644858 27 Left 1129644845 15:77420250-77420272 CCTGGAGCCGTGAGCACGCGCGC 0: 1
1: 0
2: 0
3: 12
4: 67
Right 1129644858 15:77420300-77420322 TCTCCCTCAGCCCCAGCGGGAGG 0: 1
1: 0
2: 3
3: 36
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129644858 Original CRISPR TCTCCCTCAGCCCCAGCGGG AGG Intergenic
900467034 1:2830890-2830912 TCTCCCGGAGCCCCGGCGAGGGG + Intergenic
900472190 1:2860485-2860507 TCTGCCCCAGCCCTAGCCGGGGG + Intergenic
900547335 1:3236238-3236260 TCTCCCACAGCCCCTGGGGCTGG + Intronic
900833202 1:4979916-4979938 GCTCCCTCACGCCCAGAGGGAGG + Intergenic
901192763 1:7422332-7422354 TCTCACCCACCCCCAGCAGGAGG - Intronic
901979752 1:13024571-13024593 TCTCCCTCAGCCTGAGCTGATGG - Intronic
902002331 1:13204367-13204389 TCTCCCTCAGCCTGAGCTGATGG + Intergenic
902021561 1:13350131-13350153 TCTCCCTCAGCCTGAGCTGATGG + Intergenic
903049037 1:20587410-20587432 AGGCCCTCAGCCCCAGCAGGAGG + Intergenic
905179101 1:36155837-36155859 TCTCCCCCAGTCCCCGCGGCGGG + Intronic
905656324 1:39688336-39688358 TCTCCCTCATCCCCGGGGTGTGG + Intronic
906282759 1:44565563-44565585 TCTCCCTCAGCCCAGGCAAGGGG + Intronic
907414067 1:54302020-54302042 TCTCCTACAGCTCCAGAGGGCGG + Intronic
907485476 1:54774976-54774998 TCTCTCTCAGCCCAAGCAGACGG - Intergenic
910508563 1:87977926-87977948 CCTCCCTCAACCCCAGAGGTTGG - Intergenic
911121277 1:94299728-94299750 GCTCCCTTATCCCCAGAGGGTGG - Intergenic
912384372 1:109263922-109263944 TTTCCCTCAGGCCCAACAGGTGG - Intronic
912793527 1:112675356-112675378 TGTCCCTCAGCCCCCGCGAGCGG - Intronic
915635539 1:157183988-157184010 TCTCACTCAGCCCCAGCCCAGGG + Intergenic
915662184 1:157413702-157413724 TCTCACCCAGCCCCAGCCTGAGG + Intergenic
916412398 1:164559256-164559278 TCTCCCCCAGCCGCGGCGGCAGG - Intronic
917594895 1:176519316-176519338 TCTCCCGCAGCCCTACAGGGAGG - Intronic
920379983 1:205529572-205529594 TCTCCCTGGGCCCCGCCGGGAGG - Intronic
920451176 1:206062356-206062378 TCACCCCCAGCCCCAGAGGCAGG + Intronic
920963023 1:210680946-210680968 TCTCCCTCAGGCAGAGCTGGAGG + Exonic
922728847 1:227939706-227939728 TCTCCCTCTGCCCCAGCCTGGGG - Intronic
922857808 1:228790154-228790176 TCTACCTTCGCCCCAGCAGGAGG - Intergenic
923749826 1:236737249-236737271 TGTGCCTCAGCCCCTGCGTGAGG - Intronic
1063856409 10:10259192-10259214 TCTCCCTTACACTCAGCGGGCGG - Intergenic
1064478819 10:15719771-15719793 TCTCCCTCCGCCCCGGTGGGTGG + Exonic
1069703378 10:70441808-70441830 TCTCGCCCATCCCCAGCAGGAGG - Intronic
1073146745 10:101286139-101286161 CCACCCCCACCCCCAGCGGGCGG - Intergenic
1075235779 10:120727556-120727578 TCTCCCTCACAGCCAGCGGGAGG - Intergenic
1076214222 10:128679830-128679852 TCTTCCACAACCCCAGCCGGAGG - Intergenic
1076345174 10:129774595-129774617 TCCCCCACAGCCACAGAGGGTGG + Intergenic
1076441600 10:130484529-130484551 TCCCCGCCAGCCCCAGCAGGAGG + Intergenic
1076599096 10:131645704-131645726 ATCCCCCCAGCCCCAGCGGGAGG + Intergenic
1077051312 11:568277-568299 CCCCCCGCAGCCCCCGCGGGAGG + Intergenic
1077465702 11:2732817-2732839 CCTCCCTGGGCCCCAGTGGGTGG - Intronic
1081528370 11:43942417-43942439 TCTCCCGGAACCCCCGCGGGCGG + Exonic
1081683620 11:45026253-45026275 TCACCCTGAGCCCCAGCTGTCGG + Intergenic
1081959826 11:47127512-47127534 TCTCCTTCAGCTCCAGCCAGTGG - Intronic
1082890362 11:58132693-58132715 TCTCCCTCATCCCCAGGGTGAGG + Intronic
1082986044 11:59172217-59172239 TCGCCGTCAGCCCCAGCTCGCGG + Intronic
1083624929 11:64067532-64067554 GGTCCCTGAGCCCCAGGGGGAGG - Intronic
1084001023 11:66295499-66295521 TCTTCCGCAGCCTGAGCGGGGGG + Exonic
1084054886 11:66625703-66625725 TTGCCCTAAGCCCCAGCTGGGGG - Intronic
1084103197 11:66963699-66963721 TCTTCCTCTGCCCCAGCTTGTGG + Intergenic
1084213762 11:67635735-67635757 TCTCCTTCAGCAGCACCGGGAGG - Intronic
1084275498 11:68049254-68049276 TCTCCCACAGCCCCAGCAACAGG + Exonic
1085399713 11:76228498-76228520 TCTTCCTCAGACCCTGCGAGTGG - Intergenic
1088904317 11:114142840-114142862 CCTCCCCCATCCCCATCGGGAGG + Intronic
1090754720 11:129779818-129779840 TCTCCCTCATCCCCACCTTGAGG + Intergenic
1091187503 11:133659366-133659388 TCTGCCTCAGCCTCAGTGTGAGG + Intergenic
1091351855 11:134904185-134904207 TCTCCTTCAGCCACAGAAGGTGG + Intergenic
1091986146 12:4911248-4911270 TCTCCCTCACGCCCAGGGGGAGG - Exonic
1092428465 12:8391478-8391500 TGTGCCTCAGCCCCGGCTGGGGG - Intergenic
1092429549 12:8397630-8397652 TGTGCCTCAGCCCCGGCTGGGGG - Intergenic
1092947601 12:13471600-13471622 TCTTCCTCAGCTTCAGCAGGGGG + Intergenic
1094536177 12:31324522-31324544 TGTCCCTCAGCCCCCTCGTGGGG - Intronic
1094835509 12:34320243-34320265 TCTCCAGCAGCCCCTGCGTGAGG - Intergenic
1095948880 12:47770723-47770745 TCTCCCCCAGCCCCAAGGGGAGG + Intronic
1103308832 12:119989022-119989044 TCTGCCTCACGCCCTGCGGGCGG - Intergenic
1103956734 12:124581634-124581656 ACTCCCTCATCCCCAGCCGCTGG - Intergenic
1105333363 13:19439131-19439153 GCTCCCTCAGCCCTAGGGGTAGG - Intronic
1105878353 13:24580661-24580683 GCTCCCTCAGCCCTAGGGGTAGG + Intergenic
1105921501 13:24968413-24968435 GCTCCCTCAGCCCTAGGGGTAGG - Intergenic
1106587510 13:31070059-31070081 TCTGCCTCCTCCCCAGTGGGTGG - Intergenic
1107711725 13:43157138-43157160 TCTCCCACAGCCACTGTGGGTGG + Intergenic
1107998287 13:45883160-45883182 TCTCCCTCAGCCTCAGGAGTGGG + Intergenic
1108808525 13:54189803-54189825 TCTTCGTCAGCCTCAGCTGGTGG + Intergenic
1113784032 13:112993112-112993134 TCTCCCTCCGCGGCAGCGCGTGG - Intronic
1114266359 14:21074736-21074758 TCTCCCACAGCCTCTGCTGGGGG - Exonic
1118849648 14:69573866-69573888 TCTCCCTCAGCCCCGGAATGCGG + Intronic
1118901311 14:69988076-69988098 TCTCCCTCCGCCCTGGCTGGTGG + Intronic
1119322860 14:73741909-73741931 TCACCCTCACCCCCAGCAAGAGG + Intronic
1122372131 14:101234647-101234669 TCTCCCGCAGCCCCACTGTGCGG - Intergenic
1122694221 14:103545049-103545071 TGTCCCACAGGCCCAGCGGTGGG - Intergenic
1124608650 15:31192716-31192738 TCTCCCCCAGACACAGGGGGAGG + Intergenic
1125525235 15:40370129-40370151 TCTCCCTCAGCGCCAGCCACAGG - Exonic
1127790718 15:62396575-62396597 TTTCCCTCTGCCCCAGGAGGTGG + Intronic
1128028864 15:64461542-64461564 TCCTCCTCAACCCCAGAGGGAGG - Intronic
1128587783 15:68866086-68866108 TCTCCCTCAACCCTGGCGGTAGG - Intronic
1129350865 15:74955387-74955409 TCTCCCTCTGGGCCAGCAGGGGG + Exonic
1129644858 15:77420300-77420322 TCTCCCTCAGCCCCAGCGGGAGG + Intergenic
1130115319 15:81001012-81001034 CCTCCGGCAGCCCCTGCGGGCGG + Exonic
1130670263 15:85905990-85906012 ACTCCCTCAGAGCCTGCGGGGGG - Intergenic
1131525694 15:93150803-93150825 TCTGGCTCAGCCCCACAGGGGGG + Intergenic
1132589970 16:722299-722321 TCTCCCTCAGCTCCCGCTGCTGG + Exonic
1132645447 16:997363-997385 TCTCCCTGGGCCCCCGAGGGAGG + Intergenic
1132880291 16:2159132-2159154 TCTCCCTCTGCTCCAGGGAGGGG - Intronic
1133236092 16:4388104-4388126 TGTCCCTCAGCCCCACCCGGGGG + Intronic
1133689414 16:8198952-8198974 TTTACTTCAGCCCCAGCAGGAGG + Intergenic
1133746200 16:8688580-8688602 TCTCCCTCATCCCCATCCTGTGG + Intronic
1133980217 16:10627735-10627757 TCTCCCGCAGCCGCAGCTTGAGG + Exonic
1134137928 16:11692004-11692026 TCTCCTTCAGCACCTGCGGCGGG - Exonic
1135593053 16:23718711-23718733 TCACCATCTGCACCAGCGGGTGG - Intergenic
1136249239 16:28993058-28993080 TCTACCTCAGCCCAAGCAGCGGG + Intergenic
1136381222 16:29896887-29896909 CCTCCCTCAGGCCCAAGGGGAGG + Exonic
1137288184 16:47033423-47033445 TCTGCCTCTACCCCAGCTGGGGG - Intergenic
1137531791 16:49282529-49282551 TGTCCCTCTGCCCCAGCCGGCGG + Intergenic
1137586282 16:49665631-49665653 TCACTCTCAGCCACAGTGGGTGG + Intronic
1137774519 16:51044149-51044171 GCTGCCTGAACCCCAGCGGGTGG - Intergenic
1138138252 16:54543503-54543525 TCTCCCTCAGCGCCTCAGGGTGG - Intergenic
1138284385 16:55797725-55797747 GCTCCTTGAGCCTCAGCGGGGGG + Intergenic
1138284617 16:55799262-55799284 GCTCCTTGAGCCTCAGCGGGGGG - Intergenic
1138530786 16:57633254-57633276 TCTCCCTAAACCTCAGCTGGAGG + Intronic
1139343654 16:66288377-66288399 TCTCCCTCAGCCTCAGCACCAGG + Intergenic
1139359215 16:66387127-66387149 CCTCCCTCATCCCCAGCCTGGGG + Intronic
1140455012 16:75099920-75099942 ACTCCCACAGCCCCAGGGGTGGG + Intronic
1141569054 16:84923128-84923150 TGTCCATCAGCCCCAGAGGGAGG + Intergenic
1142027354 16:87821698-87821720 TCTCCCTCTGCCCCCGCTGCAGG - Intergenic
1142286550 16:89173771-89173793 GCTCACTCAGCCCCACCCGGAGG + Intronic
1142642048 17:1289857-1289879 TCTTCCTGAGTCCCAGCTGGAGG + Intronic
1144527095 17:15999676-15999698 TCTCGCCCTGCCCCGGCGGGGGG - Exonic
1145916098 17:28574966-28574988 TCTCCATCAGTCCCAGCTAGAGG + Exonic
1147897283 17:43758880-43758902 TTTCCCTCAGCCCCGGAGGGAGG + Intergenic
1148894791 17:50833436-50833458 TCTCCATCAGCCCCAGGAGTGGG + Intergenic
1150266965 17:63838131-63838153 TCTCCCTCGGCCACAGAGGATGG - Intronic
1150851102 17:68704339-68704361 TCTGGCTCAGTCCCAGTGGGTGG + Intergenic
1151370320 17:73643451-73643473 GCACCCCCAGCCCCAGCGGCTGG + Intronic
1152209699 17:78996508-78996530 TCTCCCTGAACCCCAGCAGGGGG - Intronic
1152282844 17:79395652-79395674 TCTCCCCCAACCCCAACGGGTGG + Intronic
1152594430 17:81231530-81231552 TCTGCCTCAGCCCCAACCGTGGG - Intronic
1152729061 17:81961038-81961060 TCTCCGCCAGGCCCGGCGGGCGG - Exonic
1152798213 17:82318162-82318184 TCTCCCTCAGCCCCTGAAGCTGG - Intergenic
1154123462 18:11670090-11670112 TCTCCCCCAGCCCCAGCCTGTGG + Intergenic
1156499346 18:37547319-37547341 TCTCACTCAGCCACAGCCAGAGG + Intronic
1159369806 18:67516298-67516320 CCTCACTCAGCCCCAGAGCGGGG - Intronic
1160420599 18:78741316-78741338 TTTTCCTCAGGACCAGCGGGAGG - Intergenic
1160492594 18:79350464-79350486 GCTCCCTCAGCCCCAGTATGAGG + Intronic
1160747813 19:720074-720096 CCTCCCCCAGCCGCAGCGCGGGG + Intronic
1160967162 19:1751824-1751846 CCTCTCTCAGCCCCAGAGAGGGG - Intergenic
1161030150 19:2054251-2054273 TCTCCCACAGCCCCAGCAGGTGG + Intergenic
1161258053 19:3320605-3320627 TCACCCTCAACCCCAGAGAGGGG + Intergenic
1161850884 19:6737453-6737475 TCACCGTCAGCGCCAGCTGGTGG + Exonic
1162149585 19:8635407-8635429 TCTCCCTCAGTCCCAGCCCCTGG + Intergenic
1162592897 19:11604602-11604624 GCTCCTTCATCCCCAGTGGGAGG + Intronic
1163777398 19:19226524-19226546 TCCCCCTCATCCCCAGAGGATGG - Exonic
1163785988 19:19275181-19275203 TCTGCCTCAGCCACAGCGTCAGG + Intergenic
1166214423 19:41325981-41326003 TCGGCCTCAGCCCCGGCCGGGGG - Intronic
1167329054 19:48842980-48843002 CCTCCCTCACCCCAACCGGGTGG - Intronic
1167331422 19:48858909-48858931 CCTCCCCCAGCCTCAGAGGGAGG + Exonic
1167716389 19:51144972-51144994 GCTCCCCCAGCCCCAGGGAGGGG - Intronic
1167722090 19:51185982-51186004 GCTCCCCCAGCCCCAGGGAGGGG - Intergenic
1167774265 19:51544588-51544610 GCTCCCTCAGCCCCAGGGAGGGG + Intergenic
925074097 2:997706-997728 CCCCACTCAGCCCCAGAGGGGGG - Intronic
925426281 2:3751329-3751351 TGTCCCCAGGCCCCAGCGGGAGG + Intronic
926298447 2:11585217-11585239 TCTCCATCAGCTCCAGATGGTGG + Exonic
927000951 2:18793755-18793777 TCTCCCTCAGCTCCACCCTGAGG + Intergenic
928416533 2:31097050-31097072 TCTCCCTCTTCCCCAGCTAGAGG - Intronic
929588682 2:43131641-43131663 TCTCCCTCAGTCCCTGCTGAGGG + Intergenic
931955524 2:67419705-67419727 ACTCCCTCACCCCCACCAGGGGG + Intergenic
934068742 2:88364387-88364409 TCTCCCACAGCCCCTGCTGTGGG + Intergenic
937325205 2:120986163-120986185 TCACCCTCAGCCCCTCAGGGTGG + Intronic
937858050 2:126686913-126686935 TATCCCTCAGCTCCAGCAAGGGG + Intronic
938051921 2:128181572-128181594 TCCACTTCAGCCCGAGCGGGCGG + Intronic
938075260 2:128329076-128329098 TCTCCCTCTGCCCCACCATGGGG + Intergenic
938201616 2:129377164-129377186 TCTCCCTCTGCCTGAGCGGAAGG - Intergenic
940265101 2:151828225-151828247 TCCCCCTCAGCCTGAGCCGGGGG - Exonic
941826966 2:169909485-169909507 ACTCCCTCAGCCCCAGCTTCTGG - Intronic
943561886 2:189473600-189473622 TCCTCCTCAGCCCCAGCAGAGGG - Intronic
946217737 2:218198752-218198774 TCTCTCTCTGACCCAGAGGGTGG + Intergenic
946236604 2:218328143-218328165 TCTGTCTCAGCCACAGCTGGTGG + Intronic
948513317 2:238487684-238487706 TCTCCCTCAGGGCCTCCGGGAGG + Intergenic
1168924555 20:1568447-1568469 CCTCTCTCAGCCCCAGTGGGTGG + Intronic
1170428899 20:16259746-16259768 TCTCCCTCAGCCTCACCATGTGG + Intergenic
1171051640 20:21865022-21865044 TCTCCCTCAGAGACAGCGGCAGG - Intergenic
1171340188 20:24421323-24421345 CCTCCCCCAGCGCCAGTGGGCGG + Intergenic
1172100043 20:32479857-32479879 TCTCCCTCTGCCCCAGAGGCAGG - Intronic
1172704537 20:36873165-36873187 TCTCCCTGATCCCCAGAGAGGGG - Intergenic
1172967143 20:38844979-38845001 TCTCCTTCAGGCCCAGGGGGTGG - Intronic
1173875955 20:46371678-46371700 TCTCCCTCAGCTCCCTGGGGTGG + Exonic
1175037639 20:56015399-56015421 TCTGCCTCACCTCCAGCAGGCGG + Intergenic
1175327236 20:58138102-58138124 TTTCTGTCAGCCCCAGTGGGTGG - Intergenic
1175920943 20:62450469-62450491 TCTCCCTCATCACTAGCGGAGGG + Intergenic
1176066985 20:63203036-63203058 TGCCCCACAGCCCCAGCAGGTGG - Exonic
1176107855 20:63398004-63398026 TCTCCATCAGCCCGAGGTGGCGG - Intergenic
1176126827 20:63479266-63479288 TCTGCCTCAGCCCCTGCAGAGGG + Intergenic
1176739679 21:10589462-10589484 GCTCCCTCAGCCCTAGGGGTAGG + Intronic
1179916895 21:44483525-44483547 CCTCCCTCGGCACCAGTGGGAGG + Intergenic
1180044648 21:45299589-45299611 ACACACTCAGCCCCAGCGAGGGG - Intergenic
1180150643 21:45945494-45945516 CCTCCCACAGCCCCAGGGAGGGG - Intergenic
1180227553 21:46404489-46404511 TCTCCCCCAGCACCAGGGAGTGG - Intronic
1180957331 22:19746864-19746886 TGTCCTTCAGCCCCCGCAGGTGG + Intergenic
1181026984 22:20132198-20132220 ACTCCCCCAGCCCCAGCGGGTGG - Intronic
1181055815 22:20260105-20260127 TCCCCCATGGCCCCAGCGGGTGG + Intronic
1181759844 22:25050670-25050692 TCTCCCTCAGCCCCACAGTCGGG - Intronic
1182429949 22:30293556-30293578 TAACCCTCAGCCCCTGAGGGTGG - Intronic
1183686259 22:39362891-39362913 TCTCCCCCAGACCCAGGGAGAGG - Intronic
1185241238 22:49748817-49748839 TCAGCCTCAGCCCCAGAGGAAGG + Intergenic
949154876 3:815936-815958 TCTCCCTCAGTCCTAGCCAGTGG + Intergenic
950043874 3:9937622-9937644 CCTCACTCAGCTCCAGCAGGCGG - Exonic
950504883 3:13388540-13388562 TCAGCATCAGCCCCAGTGGGAGG - Intronic
950794687 3:15501329-15501351 TCTACTTCAGCCCCATCGGCAGG - Intronic
953311614 3:41886002-41886024 TCTCCCTCACCCTCAGCTGTGGG - Intronic
953311738 3:41887157-41887179 TCTCCCTCGCCCCCAGTGGTGGG - Intronic
953605631 3:44411445-44411467 TCTCCCTCTGCTCCAGCCAGGGG + Intergenic
953981288 3:47414446-47414468 TGTCCCTGTGCCCCAGTGGGTGG + Intronic
954131567 3:48563812-48563834 TCTCCCTCAGCCCCCTGGGGTGG + Intergenic
961713728 3:128845430-128845452 TCACCCTCAGCCCCAGGGAGCGG - Intergenic
962988914 3:140560753-140560775 TCTCAGTCAGCCACAGCGGGAGG + Intronic
965658328 3:171014586-171014608 TCTTCCTCAGCCCAAGGGGTTGG + Exonic
966355174 3:179071921-179071943 GCTCCCGCATCCCCGGCGGGCGG + Exonic
967904076 3:194486711-194486733 TCACCCTGAGCCGCAGCGCGCGG - Intronic
968553774 4:1237334-1237356 TTTCCCTGAGCCCCATCAGGAGG - Intronic
968553785 4:1237369-1237391 TTTCCCTGAGCCCCATCAGGAGG - Intronic
968553840 4:1237579-1237601 TTTCCCTGAGCCCCATCAGGAGG - Intronic
968553880 4:1237719-1237741 TTTCCCTGAGCCCCATCAGGAGG - Intronic
968553909 4:1237824-1237846 TTTCCCTGAGCCCCATCAGGAGG - Intronic
968943015 4:3648932-3648954 TGGCCCTCAGCCCAAGCGGCCGG + Intergenic
968948162 4:3676378-3676400 TGTCCCTGAGGCCCAGCAGGTGG - Intergenic
968955831 4:3718671-3718693 TCTCTCCCAGCCACAGAGGGTGG + Intergenic
968978200 4:3832856-3832878 CCTCCCTGAGCCCCAGGGTGAGG - Intergenic
969608296 4:8213052-8213074 TCTCCCACAGCCCCAGCAACAGG + Intronic
970456437 4:16227388-16227410 GCTCCCACCGCCCCAGCTGGTGG - Intronic
972671341 4:41215915-41215937 TCTCCCTCAGACCGAGCTGGAGG + Intronic
981017269 4:139987213-139987235 TCTCCCTCACTCCCAGAGGGAGG + Intronic
985515889 5:344315-344337 ACACCCTCCGTCCCAGCGGGTGG - Intronic
985590207 5:760589-760611 TCTCCCTCAGCATCACCAGGTGG - Intronic
985789630 5:1918639-1918661 TGTCCCTGATCCCCAGAGGGAGG + Intergenic
986471478 5:8080982-8081004 TCTCCTTCAGCTCCACAGGGGGG + Intergenic
988441166 5:31234988-31235010 ACTCCCTCACCCCCACAGGGAGG - Intronic
992484396 5:77180936-77180958 TCGCCGGCAGCCCCAGCGTGGGG + Intergenic
998148931 5:139746217-139746239 CTTCCCCCACCCCCAGCGGGGGG + Intergenic
999395465 5:151224058-151224080 TCGCCGGCAGCCCCAGCCGGCGG - Exonic
1002522067 5:179797557-179797579 TCTCCCTCTGCCCCTGCGGTTGG - Intergenic
1002791809 6:442456-442478 TAACCCTCAGCTCCAGAGGGAGG + Intergenic
1003377678 6:5594607-5594629 GTTCCCTCAGCCCCAGGGTGGGG - Intronic
1005851963 6:29828919-29828941 TCTCCCTCAGGACCAGAGGGAGG - Intronic
1005859348 6:29888843-29888865 TCTCCCTCAAGACCAGAGGGAGG - Intergenic
1005864499 6:29927553-29927575 TCTCCCTCAGGACCAGAGAGAGG - Intergenic
1005865717 6:29934386-29934408 TCTCCCTCAGGACCAGAGGGAGG - Intergenic
1005866915 6:29943644-29943666 TCTCCCTCAGGACCAGAGGGAGG - Intronic
1006402131 6:33823937-33823959 CCTCTCTCAGCCTCAGTGGGTGG + Intergenic
1007844071 6:44739423-44739445 GCTCCCACAGCCCCAGCGCTCGG - Intergenic
1009808670 6:68634840-68634862 TCGCCGCCAGCCCCAGCGGTGGG + Intergenic
1011712615 6:90069981-90070003 TCTTCCTCAGCTCCAGAGGGTGG + Intronic
1011796424 6:90958583-90958605 ACTCCCTCAGCCCATGAGGGAGG + Intergenic
1013283171 6:108657977-108657999 ACTCCCCCAGGCCCAGAGGGGGG - Intronic
1016662975 6:146602666-146602688 TGGTCCGCAGCCCCAGCGGGTGG - Intronic
1018172700 6:161154358-161154380 TCTCCAACAGCCCCGGCAGGTGG - Intronic
1019151044 6:170006101-170006123 TCTCCCACAGACCCACAGGGTGG - Intergenic
1019192729 6:170262582-170262604 CTTCCCTCAGCCCCATCGGCAGG + Intergenic
1019267704 7:127608-127630 TCTCCCCCAGCCCCAGATGAAGG - Intergenic
1019720813 7:2569485-2569507 TCTTCCTCACCCTCAGCAGGAGG + Intronic
1019732284 7:2634748-2634770 TTTCCCACAGCCCCAGGAGGTGG + Intronic
1019931726 7:4227871-4227893 TCTCCCCCCGCCCAAGCGGTAGG - Intronic
1023123057 7:36928735-36928757 TCTCCCACAGCCCTGGTGGGTGG - Intronic
1026853175 7:73737379-73737401 TCTCCCACAGCCAGAGCTGGTGG - Exonic
1027211131 7:76149948-76149970 CCTCCCACGGCCCCAGCTGGTGG + Intergenic
1029075242 7:97929287-97929309 TGTGCCTCAGCCCCGGCTGGGGG - Intergenic
1029495216 7:100892812-100892834 TCTCCCTCACCCCCAGGTGCTGG - Exonic
1030184779 7:106750798-106750820 TCTCCCTTAGACCCAAAGGGCGG - Intergenic
1030401143 7:109052149-109052171 TCTCCCTCTGCCCCCTCGGCTGG + Intergenic
1032011419 7:128350528-128350550 TCTCACTCAGCACCAGAGTGGGG + Exonic
1032021319 7:128408546-128408568 GCTCCCTGAGCCCAAGTGGGGGG + Intronic
1032414861 7:131728140-131728162 TCTCATTCAGTCCCAGCAGGAGG - Intergenic
1033243958 7:139703293-139703315 TCACCCTGAGCAGCAGCGGGAGG - Intronic
1034401174 7:150862591-150862613 GCTCCCTCAGCTCCAGAGGGAGG - Intergenic
1034449655 7:151130472-151130494 TCTCAGCCAGCCCCAGAGGGAGG - Intronic
1036259563 8:7229065-7229087 TGTGCCTCAGCCCCAGCTGGGGG - Intergenic
1036307057 8:7610459-7610481 TGTGCCTCAGCCCCAGCTGGGGG + Intergenic
1036311606 8:7687635-7687657 TGTGCGTCAGCCCCAGCTGGGGG - Intergenic
1036357904 8:8058446-8058468 TGTGCCTCAGCCCCAGCTGGGGG + Intergenic
1036695189 8:10969727-10969749 TCCAGCTCAGCCCCAGTGGGTGG - Intronic
1036751478 8:11446243-11446265 TTTTCCTCAGCCCCAGCCTGTGG + Intronic
1036830457 8:12016039-12016061 TGTGCCTCAGCCCCAGCTGGAGG - Intergenic
1036893044 8:12608500-12608522 TGTGCCTCAGCCCCGGCTGGGGG - Intergenic
1037904456 8:22707310-22707332 TCACTCTCTGCCCCAGCGAGTGG + Intergenic
1039568073 8:38565189-38565211 TCAGCCTCAGCCTCAGCGGCAGG + Intergenic
1040549969 8:48430160-48430182 TGTCCCTCTGCCCCAGGGAGGGG + Intergenic
1043395373 8:79830218-79830240 TCACACCCAGCCCCAGTGGGAGG - Intergenic
1044011340 8:86997786-86997808 TTTCCTTCAGACCCAGCGGGTGG + Intronic
1044340373 8:91040518-91040540 CCTTCCTCAGCCCAAGCGAGAGG + Intronic
1047493086 8:125390258-125390280 TCTCCCTCAGCCCTAGTGGGAGG - Intergenic
1049418298 8:142505482-142505504 TCGCCCTCAGCCCCAGTGCAGGG - Intronic
1049542118 8:143213392-143213414 TCTTCCTAAGCCCCTGCTGGGGG - Intergenic
1049574645 8:143384557-143384579 TGTCCCTCTGCCACAGAGGGGGG + Intergenic
1049580672 8:143409149-143409171 TTACCCTCAGCCCCAGCTGTTGG - Intergenic
1054455335 9:65427357-65427379 TCTGCCTCAGAACCAGCAGGGGG + Intergenic
1055332308 9:75197168-75197190 TCACCCTCACCCCCCGTGGGGGG + Intergenic
1056682248 9:88730041-88730063 GCTGCCTCAGACCCAGCTGGAGG + Intergenic
1056764427 9:89436222-89436244 TCTCACTCAACCCCAGTGAGGGG + Intronic
1057898760 9:98931135-98931157 TCTTCATCAGCCCGAGAGGGTGG - Intergenic
1059747916 9:117220679-117220701 TCTCCCTCAGAGCCTCCGGGAGG + Intronic
1061895111 9:133643112-133643134 GCTCCTGCAGCCCCAGTGGGAGG - Intronic
1061969273 9:134035203-134035225 TCTCCATCTGCCCGAGCAGGAGG + Intronic
1062434995 9:136543120-136543142 TCTTCCCCAGCCCCAGCCTGAGG + Intronic
1062729844 9:138102759-138102781 TCTTCCCCAGCCCCAGAGGCGGG - Exonic
1185528210 X:796045-796067 TCTGTCTCAGCCCCAGTGAGAGG - Intergenic
1186032958 X:5390551-5390573 GCGCACTCAGCCCCAGTGGGAGG + Intergenic
1187765009 X:22631886-22631908 TCTCACTCTGCCACAGCGAGTGG - Intergenic
1189848587 X:45157977-45157999 TCTCCCTCACCCCCAACAGCAGG - Intronic
1191861347 X:65668335-65668357 TTTCCCACAGCCTCACCGGGTGG + Intronic
1192148539 X:68697775-68697797 TCTCCCTCAGCCCCACATGGGGG - Intronic
1195100607 X:101551327-101551349 CCTCCCGCAGCCCCAGCGGTCGG - Intronic
1195688458 X:107605106-107605128 TCTCCCTCAGCCTCATGGAGAGG + Exonic
1195948642 X:110242709-110242731 CCTCCCTCTGCCCCAGCAGTTGG - Intronic
1198725057 X:139667995-139668017 TGTGCCTCAGCCCCAGCTGTAGG + Intronic
1200042728 X:153381424-153381446 TCTCCTTCAGCCCAAGCCAGAGG + Intergenic
1201293677 Y:12446119-12446141 TCTCCCACAGCCCTAGAGGCTGG - Intergenic
1201404711 Y:13638117-13638139 GCCCCCTCAGCCCCAGCTGCAGG + Intergenic
1202597979 Y:26563314-26563336 GCTCCCTCAGCCCTAGGGGTAGG + Intergenic