ID: 1129647062

View in Genome Browser
Species Human (GRCh38)
Location 15:77445905-77445927
Sequence AACTTCCCATTTAATATTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1325
Summary {0: 1, 1: 19, 2: 200, 3: 401, 4: 704}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129647062 Original CRISPR AACTTCCCATTTAATATTTT TGG Intronic
900076182 1:819786-819808 AATTTTTCATTTAATGTTTTTGG - Intergenic
900470240 1:2850051-2850073 AAGTTTCCATTTGATATTTTTGG - Intergenic
901256234 1:7829694-7829716 AATTTTCCATTTACTATTTTTGG + Intronic
901697158 1:11016911-11016933 AACATCCGATTTAATAGTGTTGG + Exonic
903449958 1:23446385-23446407 AATTTTCCATTTAATATTTTTGG - Intronic
903496684 1:23773168-23773190 AAATTTCCATTTAATATTTTTGG + Intergenic
903627118 1:24739078-24739100 AATTTTCCATTTAATATCTTTGG - Intergenic
904343760 1:29854997-29855019 AATTTTCCATTTAATATTTTGGG + Intergenic
904794657 1:33050413-33050435 ATTTTCCCATGTAATATTTTTGG + Intronic
905833664 1:41097046-41097068 AATTATCCATTTATTATTTTAGG - Intronic
906175370 1:43766813-43766835 AACCTCCCATTTTAAATTCTAGG - Intronic
906556870 1:46720914-46720936 GACTTCCCAATTGATATTTCAGG - Intergenic
906573558 1:46866533-46866555 CATTTTTCATTTAATATTTTTGG + Intergenic
906598306 1:47100372-47100394 CATTTTTCATTTAATATTTTTGG - Intronic
906828289 1:49005305-49005327 AATTTTTTATTTAATATTTTTGG - Intronic
906912609 1:49971153-49971175 AATTTTCCATTTAATATTTTTGG - Intronic
907164742 1:52400413-52400435 AATTTTCCATTTAATATTTTTGG + Intronic
907279380 1:53336197-53336219 AATTTTCCATTTAATATCTTTGG - Intergenic
907530792 1:55094574-55094596 AATTTGCCTTTTAATATATTGGG - Intronic
908408507 1:63839634-63839656 AAAATCACTTTTAATATTTTGGG + Intronic
908417920 1:63931517-63931539 AATCTTCCATTTAATATTTTTGG - Intronic
908594691 1:65674601-65674623 AATTTTCCACTTAATATTTTTGG - Intergenic
908698792 1:66875208-66875230 CAGTTCCCAATTAATATTGTGGG - Intronic
908996109 1:70156865-70156887 AATTTTCCGTTTAATATTTTCGG + Intronic
909039630 1:70633326-70633348 CACTTCCCAATTAATCCTTTGGG - Intergenic
909350771 1:74650749-74650771 ATTTTTCCATTTAATATTTTTGG + Intronic
909514223 1:76489403-76489425 ACCATCCCTTTAAATATTTTAGG + Intronic
910001037 1:82342583-82342605 AACTGCCCAATAAATCTTTTTGG + Intergenic
910123211 1:83813163-83813185 AAATTTCCACTTAATACTTTTGG + Intergenic
910127452 1:83859947-83859969 AATTTCATATCTAATATTTTAGG - Intergenic
910496678 1:87837119-87837141 GACTTTCAGTTTAATATTTTTGG + Intergenic
910782858 1:90959879-90959901 AATTTTCCATTTAATATTTTTGG - Intronic
910815261 1:91285742-91285764 AAATTTTCATGTAATATTTTCGG - Intronic
910882828 1:91937902-91937924 AACTTTCCATATAATATTTTTGG - Intergenic
910958025 1:92728723-92728745 AACTTTCTGTTTAATATTTTTGG - Intronic
910961310 1:92766750-92766772 AATTTTCCATGTAATATTTTTGG - Intronic
911067594 1:93804686-93804708 AATTTTCCACTTAATATTTTTGG + Intronic
911205793 1:95090478-95090500 AACTTTTCATTTAATATTTTTGG - Intergenic
911409504 1:97484549-97484571 ATCTTCTCATTTTATATTGTTGG + Intronic
911464122 1:98230407-98230429 AATTTTCCTTTTAGTATTTTGGG - Intergenic
911772102 1:101758029-101758051 AATTTTTCATCTAATATTTTGGG - Intergenic
911950192 1:104163746-104163768 TTCTTTCCATTTTATATTTTTGG - Intergenic
912010585 1:104956441-104956463 AACTTTCCATTTAATATTTTAGG + Intergenic
912124290 1:106514186-106514208 AAAGTTCCATTTACTATTTTAGG - Intergenic
912485325 1:110022719-110022741 TACCTCCCTTTAAATATTTTAGG - Exonic
912594242 1:110858234-110858256 AATTTTCCACTTAATATTTTTGG - Intergenic
912875339 1:113352283-113352305 AATTTCCCATTCAATATTTTTGG - Intergenic
912883173 1:113439262-113439284 AATTTTCCATTTAATATTTTTGG + Intronic
913073361 1:115320669-115320691 AATTTACCATTTAATATTTTCGG + Intronic
914326922 1:146627278-146627300 AATTTTTTATTTAATATTTTTGG + Intergenic
914339700 1:146749423-146749445 AAATTCCAATTTAAGATTATAGG + Intergenic
914405182 1:147363493-147363515 CTCTTGCCATCTAATATTTTTGG + Intergenic
914734817 1:150405696-150405718 AATTTTCCATTTAATATTTTAGG - Intronic
914910974 1:151786494-151786516 AACTTCCCATTTAATCTTTTTGG + Intronic
915122698 1:153640868-153640890 AACTTCCCTGTTAATATTAAAGG + Intronic
915144268 1:153785662-153785684 CACTTCCCCTTTACTAGTTTTGG + Intergenic
915228993 1:154431934-154431956 AATTTCCCATTTAATATTTTTGG + Intronic
916147733 1:161755555-161755577 AAATTCCAATTAAACATTTTAGG - Intronic
916335592 1:163667561-163667583 AACTTCCAATTCAATATTTTGGG + Intergenic
916699450 1:167276089-167276111 GATTTTCCGTTTAATATTTTTGG - Intronic
916799142 1:168198393-168198415 TTTTTCCCATTTAAGATTTTTGG - Intronic
916895539 1:169158448-169158470 AATTTTCCATTTTATATTTTTGG + Intronic
917132043 1:171752971-171752993 AAGTTCCAAGGTAATATTTTTGG + Intergenic
917170866 1:172172527-172172549 AATTTTTCATTTAATATTTTTGG + Intronic
917210358 1:172625566-172625588 AACTTTCCATTTCATGATTTAGG + Intergenic
917439315 1:175052959-175052981 ATCTCTCCATTTAATATTATTGG - Intergenic
917439840 1:175057663-175057685 AACATCCCATTTGTTAGTTTTGG - Intergenic
917857766 1:179115425-179115447 AATTTTCTATTTAATATTTTTGG - Intronic
917999381 1:180477213-180477235 AATTTTCCACTTAATATTTTTGG + Intronic
918000258 1:180487310-180487332 AATTTTCCATTTAATATTTTGGG - Intronic
918346084 1:183608573-183608595 AATTTTCCATGGAATATTTTGGG + Intergenic
918608631 1:186460216-186460238 AATTTTTCATCTAATATTTTTGG - Intronic
918693818 1:187516946-187516968 AATTTTCCATTTAATATTTTTGG - Intergenic
918797426 1:188919640-188919662 AATTTTCTATTTAATATTTTTGG - Intergenic
919066950 1:192704044-192704066 ATCTTTCCATTTAATATTTTTGG + Intergenic
919101508 1:193102790-193102812 AATTTTCCATGTAATGTTTTTGG - Intronic
919151938 1:193712366-193712388 AACTTTCTACTTAATATTTTTGG + Intergenic
919348326 1:196415973-196415995 AATTTTCCTTTTAATATTATTGG - Intronic
920540076 1:206771531-206771553 AACTCCCCTTTTGATTTTTTTGG - Intronic
920593439 1:207244900-207244922 AGCTTTGCATTTAATATTTCTGG - Intergenic
920601381 1:207328377-207328399 CACTTTCCATTCAATCTTTTTGG - Intronic
921618904 1:217305033-217305055 AACTTCACGTTTAACATTTTAGG + Intergenic
921695880 1:218209612-218209634 AATTCTTCATTTAATATTTTTGG - Intergenic
922142844 1:222907433-222907455 AAATTCCCATTTAGTAGTTCTGG - Intronic
922307203 1:224354497-224354519 AATTTTCCATTTAACATTTTAGG - Intergenic
922394915 1:225188208-225188230 AATTTTCCATTTAATGTTTTTGG - Intronic
922395076 1:225190480-225190502 AATTTTCCATTTAATATTTTTGG + Intronic
922660176 1:227423207-227423229 AGTTTTCCATTTAATCTTTTTGG + Intergenic
922660212 1:227423527-227423549 GCCCTGCCATTTAATATTTTTGG + Intergenic
923158039 1:231295607-231295629 AATTTTCCATTGAATATTTTTGG + Intergenic
923424768 1:233858177-233858199 ATTTTTCCATTTAAAATTTTTGG + Intergenic
923615326 1:235532653-235532675 AACTTTCCATTTAATATTTTTGG + Intergenic
924076066 1:240338498-240338520 AATTTTCCACTTAATATTTTTGG - Intronic
924124222 1:240833364-240833386 AATTTTCCATTTAATATTTTTGG + Intronic
924478706 1:244406475-244406497 AATTTTCAATGTAATATTTTTGG - Intergenic
924543159 1:245000361-245000383 AATTTTCCATTTAATATATTTGG + Intronic
1063021693 10:2135402-2135424 AATTTTGCATTTAATATTTTTGG + Intergenic
1063125449 10:3132986-3133008 AATTTTCCATTTAATATTTGTGG + Intronic
1063191994 10:3704279-3704301 AACTTTACCTTTAATATTATGGG + Intergenic
1063799567 10:9557820-9557842 AACTTCCCAAAAATTATTTTTGG - Intergenic
1064635783 10:17365439-17365461 AAGGTTCCATTTAATATTTTTGG - Intronic
1064948885 10:20824423-20824445 AACTTCCAATTTAACTGTTTTGG - Intronic
1065154378 10:22854355-22854377 AATTTTCTGTTTAATATTTTTGG + Intergenic
1065354101 10:24822333-24822355 AATTTTCTAATTAATATTTTTGG + Intergenic
1066024058 10:31335152-31335174 AATTTTCCATTTAATATTTTCGG - Intronic
1066241735 10:33543054-33543076 AATCTTCCATTTAACATTTTTGG + Intergenic
1066501031 10:35994803-35994825 ATCATCCCTTTTAATATTTCTGG - Intergenic
1066686760 10:37988826-37988848 AAATGACCACTTAATATTTTTGG + Intergenic
1067243182 10:44513700-44513722 AATGTTCCATTTAATATGTTTGG - Intergenic
1067315762 10:45160584-45160606 AATTCCCCATTTAATATTTTTGG + Intergenic
1068049981 10:51937820-51937842 AATTTTCCATTTAATATTTTCGG - Intronic
1068065522 10:52126083-52126105 AATTTTCCATTTAATATTTTTGG + Intronic
1068254501 10:54492552-54492574 AATTATCCATTTAATAATTTTGG - Intronic
1068379447 10:56231472-56231494 AATTTTCTATTTAATATTTTCGG - Intergenic
1068486295 10:57663346-57663368 AATTTTCCATTTAAGATTTCTGG - Intergenic
1068506757 10:57910095-57910117 AATTTTCCATTTAATATTTTTGG + Intergenic
1068554356 10:58441799-58441821 AACCTTTCACTTAATATTTTTGG + Intergenic
1069298799 10:66880813-66880835 AGCTTCCAATTTAGCATTTTAGG - Intronic
1069435678 10:68380440-68380462 AACTCCACCTTCAATATTTTTGG + Intronic
1069816714 10:71200977-71200999 AATTTTTCATTTAATATTTTTGG - Intergenic
1069817084 10:71204355-71204377 AATTTTCTATTTAATATTTTTGG + Intergenic
1069817221 10:71205971-71205993 AATTTTTCATTTAATATTTTTGG + Intergenic
1069968880 10:72147551-72147573 AACTTAAAATTTATTATTTTAGG - Intronic
1070017557 10:72549002-72549024 AATTTGCTATTTAAAATTTTTGG - Intronic
1070572189 10:77648714-77648736 AACTTTCCATTGAATATTTTTGG + Intergenic
1070836623 10:79451370-79451392 AATTTTCCATTTAATATTTTTGG + Intergenic
1071165705 10:82803897-82803919 AACTGTCCACTTAATATTTTTGG - Intronic
1071233687 10:83619241-83619263 AATTTTATATTTAATATTTTTGG + Intergenic
1071446862 10:85756672-85756694 AATTTACCATTTAATATTTTGGG + Intronic
1071966794 10:90859537-90859559 AAATTTCCATTTAATATTTTCGG - Intergenic
1072000547 10:91191468-91191490 AACTTTCCATTTAATATTTTTGG + Intronic
1072006723 10:91257723-91257745 AATTTTCCATTTTGTATTTTTGG + Intronic
1072267296 10:93742949-93742971 AACTTTCCATTTAATATTTTTGG - Intergenic
1072279956 10:93856729-93856751 AATTTTCCATTTGATATTTTTGG - Intergenic
1073166447 10:101457489-101457511 AAATTTCCATTCAATATTTTAGG + Intronic
1073815513 10:107202175-107202197 AATTTTTCATTTAATATTTTTGG - Intergenic
1073849709 10:107600567-107600589 AATTTTCCACTTAATATTTTTGG + Intergenic
1073917264 10:108420023-108420045 ATTTTTTCATTTAATATTTTTGG + Intergenic
1074143896 10:110700070-110700092 AATTTTCCATGTAATATTTTTGG + Intronic
1074307207 10:112290049-112290071 AATTTTCCATTTAATATTTTTGG - Intronic
1074746460 10:116538505-116538527 AATTTTCCAGTTAACATTTTTGG - Intergenic
1074758187 10:116643503-116643525 AATTTCCCATTTCCTATTTTGGG + Intronic
1074922643 10:118032688-118032710 AATTTTCCATTTAATATTTTTGG - Intronic
1074941571 10:118240890-118240912 AATTTTCCATTTAATTTTTTGGG + Intergenic
1075498440 10:122949653-122949675 AATTTTCCATTTAATATTTTTGG + Intronic
1076279934 10:129237809-129237831 AACTTTCTTTTTAATATTATGGG - Intergenic
1076321571 10:129586141-129586163 AATTTTCCAGTTAATATTTTTGG + Intronic
1076597540 10:131634342-131634364 AATTTTCCATTTAATACTTTTGG - Intergenic
1076802529 10:132837207-132837229 AATTTTCCATTTGTTATTTTGGG - Intronic
1078184604 11:9040859-9040881 AATTTTCCATTTGATATTCTTGG + Intronic
1078294292 11:10050874-10050896 AATTTTCCATTTAATATTTTTGG + Intronic
1078543929 11:12232857-12232879 AATTTTCCTTTTAATATTTTTGG - Intronic
1078714872 11:13830357-13830379 AAATTCCCACCTAATAATTTTGG - Intergenic
1079053376 11:17183252-17183274 AATTTTCTATTTAATATTTTTGG - Intronic
1079061943 11:17256729-17256751 AATTTTCCATTTAATCTTTTTGG + Intronic
1079146336 11:17855659-17855681 AATTTTCCATTGAGTATTTTCGG + Intronic
1079561651 11:21828852-21828874 GACTTCCCATTCAATCTTATGGG - Intergenic
1079568942 11:21918766-21918788 AATTTCCCATTTAATCATTGGGG + Intergenic
1079592950 11:22203166-22203188 AACTTCCTATATATTTTTTTTGG - Intronic
1079643241 11:22832351-22832373 AATTTTCCATTTAATATTTTTGG - Intergenic
1079999432 11:27330922-27330944 AACTTAGAATTTAATAATTTTGG - Intronic
1080226385 11:29965822-29965844 AACTTTCTATATAATATTTGTGG + Intergenic
1080292029 11:30681581-30681603 AATTTTCCATTCAATATTTTTGG - Intergenic
1080866696 11:36201784-36201806 AACTGCCTCTTTTATATTTTGGG - Intronic
1080904805 11:36532584-36532606 AATTTTCTATTTAATATTTTTGG - Intronic
1081480729 11:43486217-43486239 AATTTTCCATTTAATATTTTTGG - Intronic
1082918134 11:58461590-58461612 AACTTCCCAAATTATTTTTTAGG + Intergenic
1083391514 11:62354724-62354746 AATTTTCCATTTAATAATTTGGG + Intronic
1083973754 11:66100225-66100247 AAATTCCAATGTAACATTTTAGG + Intronic
1084123529 11:67083470-67083492 AATTTTCCATTTAATAGTTTTGG - Intergenic
1085009383 11:73127286-73127308 AACATTCCATTTGATCTTTTTGG - Intronic
1085104939 11:73834167-73834189 AACTCAACATTTAATAATTTGGG + Intronic
1085332099 11:75661330-75661352 ATCTACCCATTTAATTTTATAGG + Intronic
1085886554 11:80529514-80529536 AATTTTTCATTTATTATTTTTGG + Intergenic
1085977158 11:81671547-81671569 AAGTTCCTATTGCATATTTTTGG + Intergenic
1086057326 11:82662223-82662245 AAATTGTAATTTAATATTTTAGG + Intergenic
1086256640 11:84884797-84884819 AATTTTTCATTTAATATTTTTGG - Intronic
1086387982 11:86329031-86329053 AACTAAACATTTAATACTTTTGG - Intronic
1086472758 11:87133184-87133206 AATATTCCATTGAATATTTTTGG + Intronic
1086581030 11:88398648-88398670 GAATTTTCATTTAATATTTTTGG + Intergenic
1086776766 11:90845207-90845229 AATTTTCCACTTAATCTTTTAGG - Intergenic
1086898904 11:92344215-92344237 AATTTTCCATTTGATATGTTGGG - Intergenic
1087217122 11:95506124-95506146 AATTCTCCATTTCATATTTTTGG - Intergenic
1087256395 11:95959563-95959585 AATTTTCCATTTAATATTTTTGG - Intergenic
1087364875 11:97205763-97205785 AACTTTCCATTTAATACTTTTGG - Intergenic
1087413085 11:97816986-97817008 AAATTCTCATTTAAGACTTTTGG - Intergenic
1087554302 11:99695235-99695257 AACTTCCCACTTTCTGTTTTGGG + Intronic
1087853680 11:103064213-103064235 ATACTCTCATTTAATATTTTTGG + Intronic
1088031762 11:105259734-105259756 AATTTTCTATTTAATATTTTTGG + Intergenic
1088073281 11:105815767-105815789 AAGTTCTCAATAAATATTTTAGG + Intronic
1088326897 11:108610006-108610028 AAGTTTCCATTTAATATTTTCGG + Intergenic
1088504928 11:110518287-110518309 AAATTCCCACCTAATAATTTTGG + Intergenic
1088962116 11:114679162-114679184 AACCACCCATTTACTTTTTTAGG - Intronic
1089038105 11:115417764-115417786 AATTTTCTATTTAATCTTTTTGG + Intronic
1089881218 11:121775523-121775545 AATTTTCCATTTAATATTTTTGG + Intergenic
1089975966 11:122731722-122731744 AATTTTTCACTTAATATTTTTGG + Intronic
1090568998 11:128026958-128026980 AATTTTCCATTTAATATTTTTGG + Intergenic
1090856698 11:130615127-130615149 AACTTGTCTTCTAATATTTTTGG - Intergenic
1091359381 11:134963015-134963037 AATTTTCTATTTAATATTTTTGG - Intergenic
1091474966 12:763628-763650 AATTTTCCATTTAATATTTTTGG + Intronic
1092174708 12:6395434-6395456 AATTTTCCATTTAATATTTTTGG - Intergenic
1092462890 12:8701673-8701695 AAATTCCTAATTAATGTTTTCGG - Intronic
1092507896 12:9123599-9123621 AATTTTCCATTTAATATTTTTGG + Intergenic
1092513047 12:9178177-9178199 AATTTGCCATTTAATATGTTTGG - Intronic
1092519588 12:9254373-9254395 ATCTTGCCAATTAATTTTTTTGG - Intergenic
1092633007 12:10405634-10405656 AGTTTTCCTTTTAATATTTTTGG + Intronic
1092794515 12:12096827-12096849 AACTTCATAGTTAACATTTTTGG - Intronic
1092894456 12:12999568-12999590 AATTTTCCATTTAATAGTTATGG + Intronic
1092979159 12:13776440-13776462 AACTTCCCATTTTATAAATTGGG + Intronic
1093445236 12:19249509-19249531 GATTTTCTATTTAATATTTTTGG + Intronic
1093710612 12:22326045-22326067 GAATTTCCATTTAATATTTTTGG + Intronic
1093879110 12:24383458-24383480 AATTTTCCATTGAAGATTTTTGG - Intergenic
1094088672 12:26623206-26623228 AGTTTTCCATTTCATATTTTAGG - Intronic
1094365669 12:29677570-29677592 AATTTTCCATTTCCTATTTTTGG - Intronic
1094401307 12:30062851-30062873 AACTCTCCATTTATTCTTTTGGG - Intergenic
1094478977 12:30865117-30865139 ACCATCCCATTTTATATATTAGG - Intergenic
1094733349 12:33203454-33203476 AAATTTCCAATTTATATTTTTGG + Intergenic
1095235341 12:39788548-39788570 AATTGCCCGTTTAATATTTTTGG + Intronic
1095325961 12:40893017-40893039 ATGTTTCTATTTAATATTTTTGG - Intronic
1095460336 12:42436875-42436897 AGTTTTCCATTTAATATTTTTGG + Intronic
1095461457 12:42448828-42448850 AATTTTCCATCTAATATTTTTGG - Intronic
1095545668 12:43365579-43365601 ACCTTCTCATTTAGTATTTCTGG - Intronic
1095753579 12:45737522-45737544 ATATTCAGATTTAATATTTTAGG + Intronic
1095770002 12:45943282-45943304 AATTTTCCACTTAATATTTTTGG - Intronic
1095994806 12:48072118-48072140 AATTTTCCATTTAATATATTTGG - Intronic
1096065105 12:48733476-48733498 AATTTTCCATTTAATATTTTTGG - Intergenic
1096395868 12:51266162-51266184 AAATTTCTATTTAATGTTTTCGG - Intronic
1096452903 12:51759534-51759556 AATTTTTTATTTAATATTTTTGG + Intronic
1096901762 12:54890394-54890416 AATTTCCCATATAATACTTTTGG - Intergenic
1096988739 12:55780897-55780919 AATTTCCCATTTAATATTTTAGG + Intronic
1097453130 12:59760820-59760842 AATTTTCCATTTAATATTTTTGG + Intronic
1097651799 12:62307617-62307639 AATTTCCCACTTAATATTTTTGG - Intronic
1097770938 12:63584472-63584494 AACTTTTCGTTTAATGTTTTTGG - Intronic
1098038616 12:66332395-66332417 AATTTTCCATTTAATATTTTTGG - Intronic
1098204827 12:68097443-68097465 AATTTTCCATTTAATATTTTTGG - Intergenic
1098336061 12:69405791-69405813 AATTTTCCATGGAATATTTTTGG + Intergenic
1098381417 12:69873720-69873742 AATTTTCCATTTAATATTTTTGG + Intronic
1098543302 12:71683925-71683947 AATTTTCTTTTTAATATTTTCGG + Intronic
1098584588 12:72141075-72141097 TACATCCCATTTAATATTTGGGG + Intronic
1098766276 12:74494144-74494166 AATTTCACATGTAAAATTTTTGG - Intergenic
1098990768 12:77062963-77062985 AATTTTCCATGTGATATTTTTGG - Intronic
1099249055 12:80229936-80229958 AAATTCTCATGTCATATTTTTGG - Intronic
1099301037 12:80894525-80894547 AATTTTCGATTTAATAATTTTGG + Intronic
1099303164 12:80922728-80922750 AATTTTCCATTTAATATTTTTGG - Intronic
1099412373 12:82347202-82347224 AATTTTCCATTTAATATTTTTGG + Intronic
1099413026 12:82355325-82355347 ATTTTTCAATTTAATATTTTTGG - Intronic
1099440939 12:82699002-82699024 AATTTTCCTTTTAATATTTTTGG + Intronic
1099689468 12:85934222-85934244 AATATTCCATTTAATATTTTTGG + Intergenic
1099810819 12:87580022-87580044 TACTTAGCATTTAAAATTTTTGG + Intergenic
1099816999 12:87662117-87662139 AATTTTTCATTTAATATCTTTGG + Intergenic
1099857661 12:88187662-88187684 AACTTGCTATATAATGTTTTAGG - Intronic
1100146718 12:91687362-91687384 AATTTACAATTTAATATTTTAGG + Intergenic
1100154196 12:91777674-91777696 GATTTTCCATTTAATATTTTTGG - Intergenic
1100424021 12:94465512-94465534 AATTTTCCATTTAGTATTTTTGG + Intergenic
1101042163 12:100767706-100767728 AATTTTTCATTTAATAATTTTGG + Intronic
1101056074 12:100915243-100915265 ATCCTCACATGTAATATTTTTGG - Intronic
1101070078 12:101064768-101064790 AATTTTCCATTTAATATTTTTGG - Intronic
1101103760 12:101420510-101420532 AATTTTCAATTTAATATTTTTGG - Intergenic
1101131454 12:101695442-101695464 AATTTTCTATTTAATATTTTTGG + Intergenic
1103087742 12:118074445-118074467 AATTTTCCATTTAGTATTTTTGG - Intronic
1103126827 12:118430643-118430665 AATTTTCCATGTAATATTTTTGG - Intergenic
1103310231 12:120000579-120000601 AATTTCCCCTTTAATTTTTCTGG - Intronic
1103854195 12:123954207-123954229 ACCTTCCCATTAATTATTCTTGG - Intronic
1104512887 12:129397502-129397524 AACTTCACATTTTCTCTTTTGGG + Intronic
1104527695 12:129539715-129539737 AATTTTCCATTTAATGTTTTCGG + Intronic
1104800138 12:131549064-131549086 AATTTTCTATTTAATATTTTTGG + Intergenic
1105737544 13:23286890-23286912 AATTTTCCATTTAATATTTTAGG + Intronic
1105793670 13:23829477-23829499 CACTTTCCTTTTAATATTGTTGG - Intronic
1106369381 13:29116894-29116916 AATTTTTCACTTAATATTTTTGG + Intronic
1106371192 13:29135007-29135029 AAGTGTCCATTTAATATTTTCGG - Intronic
1106494908 13:30266878-30266900 ACAATCCCATTTAATATGTTGGG + Intronic
1106663744 13:31830297-31830319 AACTTATAATTTAATATTTTAGG + Intergenic
1106710855 13:32330776-32330798 AATTTTCCATTAAAAATTTTTGG + Intronic
1106827520 13:33540556-33540578 AATTTTCCATTAAATATTTTTGG + Intergenic
1106932163 13:34678210-34678232 AATTTTCCATTCAGTATTTTGGG - Intergenic
1106955291 13:34931634-34931656 AGTTTCCCATTTACTATTTTCGG - Intergenic
1107094227 13:36517314-36517336 AATTTTCTATTTAATATTTTTGG - Intergenic
1107203228 13:37748128-37748150 AATTTTCAATTTAATGTTTTTGG + Intronic
1107298631 13:38941589-38941611 AATTTTCCATTTAATATTTTTGG - Intergenic
1107342616 13:39424622-39424644 AACATCCAATTTAATATTACGGG + Intronic
1107730978 13:43348511-43348533 AATTTTGCATTTACTATTTTCGG - Intronic
1107817586 13:44257855-44257877 AATTTTTCATTTAATATATTTGG - Intergenic
1107842326 13:44471846-44471868 AATTTTCCACTTAATATTTTTGG - Intronic
1108011757 13:46021915-46021937 AACCTCCTATTAAATATTTTTGG - Intronic
1108044224 13:46367690-46367712 AACTTTTCATTGAATATTTTTGG - Intronic
1108050074 13:46426401-46426423 AATTTTACATTTAATATTTTTGG - Intronic
1108090332 13:46842925-46842947 CATTTTCCATTTAATATTTTCGG - Intronic
1108133450 13:47329038-47329060 AATTTCAGAATTAATATTTTTGG - Intergenic
1108191573 13:47945748-47945770 AATTTCTCATTTAAAATTTTTGG - Intronic
1108314849 13:49226887-49226909 AATTTTCCATTTAATAGTTTTGG + Intergenic
1108398268 13:50011523-50011545 AACATACCATTTCATATTTGTGG + Intronic
1108558579 13:51620772-51620794 CACTTCCCATTTAGGATTCTGGG - Intronic
1108901773 13:55419453-55419475 AATTTTTCATGTAATATTTTTGG + Intergenic
1109004849 13:56859565-56859587 AATTTTTCATTTAATATTTTTGG + Intergenic
1109269081 13:60234332-60234354 AATTTTCTATTTAATATTTTTGG + Intergenic
1109518190 13:63471591-63471613 AATATTCCAGTTAATATTTTTGG - Intergenic
1109542596 13:63799710-63799732 AATTTTACATTTAATATTTTTGG - Intergenic
1110073815 13:71213488-71213510 AATTTTTCTTTTAATATTTTGGG - Intergenic
1110108356 13:71709342-71709364 AAGTTTCTATTTAATGTTTTTGG - Intronic
1110854509 13:80281495-80281517 AATTTTCCATTTAATATTTCTGG + Intergenic
1111002895 13:82207582-82207604 AATTTTCCATTTGATCTTTTTGG - Intergenic
1111263277 13:85772479-85772501 AATTTTCCATTTAATATTTTTGG - Intergenic
1111306345 13:86418047-86418069 AATTTTCCATTTAATATTTTTGG - Intergenic
1111488079 13:88930196-88930218 TAATTTTCATTTAATATTTTGGG - Intergenic
1111629457 13:90831168-90831190 AACTTCTCAATAAATATTTGTGG - Intergenic
1111643331 13:90998421-90998443 AATTTCCCATTTACTTTTTTTGG + Intergenic
1111678724 13:91417948-91417970 AACTTTCCCTTTCATATTTTTGG - Intronic
1111868806 13:93804226-93804248 AACTTAGCATTTAAAATTTTAGG - Intronic
1112072899 13:95874581-95874603 AATTTCCCACTTAATATTTTTGG + Intronic
1112244604 13:97720100-97720122 AATTTTCCATTTAATACGTTTGG + Intergenic
1112525925 13:100146782-100146804 AACTACACATTTAAAATCTTAGG - Intronic
1112688974 13:101867485-101867507 TTCTTCCCAAGTAATATTTTAGG - Intronic
1112981907 13:105395090-105395112 AATTTTCCACTTAATATTTTTGG - Intergenic
1113151436 13:107268297-107268319 AATTTTCGATTCAATATTTTGGG + Intronic
1113290737 13:108902871-108902893 AATTTTCTATTTAAAATTTTTGG - Intronic
1113306232 13:109082116-109082138 AACTTGGCATTTGATATTTGTGG + Intronic
1113597776 13:111546860-111546882 AACTTTCCACTTAATATTTTTGG + Intergenic
1113956182 13:114100941-114100963 AATTTTCCATTTAACATTTTTGG + Intronic
1114541075 14:23459339-23459361 TACTGCCCAATTAATACTTTTGG + Intergenic
1114596698 14:23918346-23918368 ATCTTCCCATTTCTTAGTTTTGG - Intergenic
1114755887 14:25259571-25259593 AATTTTCTATTTGATATTTTTGG + Intergenic
1114870783 14:26655554-26655576 AATTTCCTAGTTAATAATTTAGG + Intergenic
1114936055 14:27538391-27538413 AATTTTTCATTTAATATTTTTGG - Intergenic
1115225354 14:31096394-31096416 AATTTTCTGTTTAATATTTTGGG - Intronic
1115389510 14:32838780-32838802 AATTTCCCATTTAATATTTTGGG - Intergenic
1115748831 14:36467387-36467409 AATTTTCCATTTAATATTTTTGG - Intergenic
1115817691 14:37180234-37180256 GATTTTCCATTTAATATTTTTGG + Intergenic
1116145523 14:41063217-41063239 TAAATCCCATTTAATGTTTTAGG + Intergenic
1116159190 14:41246651-41246673 AACTTCTCATTTCATAGTTGGGG + Intergenic
1116727809 14:48584339-48584361 AATTTTTCATTTAATATTTTTGG + Intergenic
1116736023 14:48692715-48692737 AACTTCCCATTTAATATGCATGG - Intergenic
1116763313 14:49040877-49040899 AACTTCACATTAAAAATTTTAGG + Intergenic
1116808330 14:49515198-49515220 AATTTTCCATGTAACATTTTTGG - Intergenic
1117171883 14:53108605-53108627 AATTTTCCATTTAATATTTTTGG + Intronic
1117368711 14:55055969-55055991 AATTTTTCATTTAATATGTTCGG + Intronic
1117391002 14:55262746-55262768 AACTTCCCATTGCATTTTATTGG + Intergenic
1117397842 14:55328594-55328616 AATTTTCCATTTACTATTTTTGG + Intronic
1117786556 14:59291901-59291923 CACTTCCCATTTAAGATCTAGGG + Intronic
1118289695 14:64508132-64508154 AACTTTCTATGTACTATTTTGGG - Intronic
1118513121 14:66498259-66498281 ATATTCTAATTTAATATTTTAGG + Intergenic
1118639087 14:67775765-67775787 TGCTCCCCTTTTAATATTTTGGG - Intronic
1118731959 14:68674700-68674722 GACTTCCCATTTTATACTTAGGG - Intronic
1119966874 14:78926369-78926391 AATATTCCATTTAATATTTTTGG + Intronic
1120692766 14:87611577-87611599 AATTTTCCATTTAATATTTCTGG + Intergenic
1120708819 14:87772220-87772242 AAATTTCCATCTAATATTTTAGG - Intergenic
1120796553 14:88639502-88639524 AATTTTCCATTTAATAATTTGGG + Intronic
1120796759 14:88641988-88642010 AATTTTCTATTTAATAATTTGGG - Intronic
1121097131 14:91225304-91225326 AATTTTTCATTTAGTATTTTCGG - Exonic
1121481740 14:94283409-94283431 AATTTTTCATTTAATGTTTTTGG - Exonic
1121722746 14:96122318-96122340 AATTTTCCATTTAATATTTTTGG + Intergenic
1121868800 14:97388186-97388208 CACCACGCATTTAATATTTTAGG + Intergenic
1122071197 14:99206396-99206418 AATTTTCCATTTAATATTTTTGG - Intronic
1122669804 14:103362079-103362101 AATTTTCCATTTCATATTTTTGG + Intergenic
1123705829 15:22950585-22950607 AGTTTTCCGTTTAATATTTTTGG - Intronic
1123895280 15:24822726-24822748 AACCTACCTTTTGATATTTTGGG - Intergenic
1124398650 15:29329400-29329422 AATTTGCTATTTAATATTTTTGG + Intronic
1124470722 15:29983292-29983314 AATTTTCCATTTAATATTTTGGG + Intergenic
1125253381 15:37732661-37732683 AATTTTTCATTCAATATTTTTGG + Intergenic
1125393821 15:39225645-39225667 AATTTCCAAAATAATATTTTGGG + Intergenic
1125495706 15:40191227-40191249 AATTTTTCACTTAATATTTTTGG + Intronic
1125852251 15:42915132-42915154 AATTCTCCATTTAATATTTTTGG - Intronic
1125910222 15:43431206-43431228 AATTTTCCATTTAGTATTTCTGG + Intronic
1126132836 15:45359725-45359747 ATTTTTCTATTTAATATTTTTGG - Intergenic
1126317735 15:47388359-47388381 GATTTTCCATTTCATATTTTTGG - Intronic
1126385389 15:48088599-48088621 AAATTTTCATTTAATATTTTTGG - Intergenic
1126825954 15:52548146-52548168 AATTTTCCACATAATATTTTTGG - Exonic
1126972403 15:54131448-54131470 AATTTTCCATTGAATATTTTTGG - Intronic
1126982175 15:54256465-54256487 AATTTTCTATTTAATATTTTTGG - Intronic
1127164320 15:56229132-56229154 TATTTTCCATTTAATATTTTTGG + Intronic
1127229372 15:56971727-56971749 AATTTTCCATTTAATATTTCTGG + Intronic
1127431891 15:58918819-58918841 AACTTCTAATTTTAGATTTTAGG - Intronic
1127679784 15:61282215-61282237 AATTTTCCATTTAATATTCAAGG + Intergenic
1127877483 15:63123196-63123218 AATTTTCCATTTAATACTTTCGG + Intronic
1127943240 15:63722505-63722527 AATTTTCCATTTAATATTTTTGG - Intronic
1128259907 15:66226005-66226027 AATTTGCCATTTAACATTTTTGG - Intronic
1128271851 15:66317179-66317201 AACTTCACATTTTTTTTTTTTGG + Intronic
1128840418 15:70846153-70846175 CACCTCCCATGTTATATTTTAGG + Intronic
1129577460 15:76765638-76765660 AACTTCCCTTATTACATTTTAGG - Exonic
1129647062 15:77445905-77445927 AACTTCCCATTTAATATTTTTGG + Intronic
1129745621 15:78018106-78018128 CACTTCCTAATTAATCTTTTTGG + Intronic
1130059872 15:80561590-80561612 AATTTTCCATTTAATATTTTTGG - Intronic
1130185272 15:81674624-81674646 AACTTCTTATTTAAAATGTTGGG + Intergenic
1130440023 15:83944130-83944152 AATGTTCTATTTAATATTTTTGG + Intronic
1131126334 15:89860564-89860586 AATTTTCCATTTAATATTTTTGG + Intronic
1131185506 15:90270596-90270618 ACCTTCCCATTACATAGTTTGGG - Intronic
1131413539 15:92231694-92231716 GATTTTCCATTTAATATTTTTGG - Intergenic
1131538844 15:93259336-93259358 AATTTTCCATTTAATATTTTTGG - Intergenic
1131551286 15:93359292-93359314 AATTTTTCAGTTAATATTTTTGG + Intergenic
1131668937 15:94599037-94599059 AATTTTCCATTTAATATTTTTGG - Intergenic
1131719136 15:95148197-95148219 AACTTACCATTAACCATTTTAGG - Intergenic
1131880304 15:96855176-96855198 AATTTCCCGTTTAATAGTTTTGG - Intergenic
1132213323 15:100042837-100042859 AATTTTCCTTTTAATATTTTTGG + Intronic
1133144261 16:3772011-3772033 AATTTCCCATTTAATATTTTTGG + Intronic
1135063034 16:19286941-19286963 TACGTCCCATGTAATATTTGGGG - Intronic
1135104742 16:19639131-19639153 AATTTTCTATTTAATATTTTCGG + Intronic
1135110837 16:19689618-19689640 GATTTTCCACTTAATATTTTTGG - Intronic
1135114872 16:19715949-19715971 AACTTGCTATGAAATATTTTGGG - Intronic
1135131447 16:19857115-19857137 AACTTTCTATATAATACTTTGGG - Exonic
1135948359 16:26886476-26886498 AATTTTTCATTTAATATTTTTGG - Intergenic
1135985452 16:27180484-27180506 AATTTTCCATTTAATATTTTGGG - Intergenic
1136732256 16:32426179-32426201 AATTTCCCCTTAAACATTTTAGG + Intergenic
1137227955 16:46532963-46532985 AATTTACCATTTGACATTTTTGG - Intergenic
1137420499 16:48329217-48329239 AATTTTCCAGTTAATATTTTTGG - Intronic
1137436829 16:48461842-48461864 AATTTTTAATTTAATATTTTTGG - Intergenic
1137735161 16:50718473-50718495 AATTTTCCATTTAATATTTTTGG + Intronic
1137741066 16:50774763-50774785 AATTTTTTATTTAATATTTTTGG + Intronic
1137889166 16:52140464-52140486 GATTTTCCATTTAATATTTTTGG - Intergenic
1138569753 16:57862387-57862409 AATTTTCCATTTAATATTTTTGG + Intronic
1138633532 16:58318564-58318586 AATTTTTCATTTAATAGTTTTGG - Intronic
1138838390 16:60466840-60466862 AATTTCCCATTGTGTATTTTTGG - Intergenic
1138895112 16:61194723-61194745 AACTTCTGAATTAGTATTTTAGG + Intergenic
1139037101 16:62960354-62960376 AACTTCTCGTTTAAAATTTCTGG - Intergenic
1139045500 16:63053866-63053888 AATTTTAGATTTAATATTTTTGG - Intergenic
1139453429 16:67051023-67051045 AATTTTTCATATAATATTTTTGG + Intronic
1139994586 16:70967985-70968007 AAATTCCAATTTAAGATTATAGG - Intronic
1140006639 16:71083662-71083684 AATTTTTTATTTAATATTTTTGG - Intronic
1140053638 16:71505190-71505212 AATTTTCTGTTTAATATTTTTGG + Intronic
1140331362 16:74060362-74060384 AACTTCAGACTTAATATTTTTGG - Intergenic
1140634132 16:76890561-76890583 AATTTAACATTTAATATTTGTGG - Intergenic
1141453415 16:84120924-84120946 AATTTTCCATTGAATATTTTCGG + Intergenic
1142268878 16:89078832-89078854 AATTTTCCATTTAATATTTTTGG - Intergenic
1202994139 16_KI270728v1_random:91063-91085 AATTTCCCCTTAAACATTTTAGG - Intergenic
1203020826 16_KI270728v1_random:403405-403427 AATTTCCCCTTAAACATTTTAGG - Intergenic
1203039161 16_KI270728v1_random:676563-676585 AATTTCCCCTTAAACATTTTAGG - Intergenic
1142544630 17:691576-691598 AATTTTCCATGTAATATTTTTGG - Intronic
1143397602 17:6614757-6614779 AATTTCCCATTGAATATTTTTGG - Intronic
1143573232 17:7774411-7774433 AATTTTCCATTCAGTATTTTCGG + Intronic
1143727801 17:8861457-8861479 AATTTTTCATTTAATATTTTTGG - Intronic
1143797622 17:9350322-9350344 AATTTTCCATTTAATATTTTAGG + Intronic
1143808942 17:9454720-9454742 TATTTTCCATTTAATATATTGGG + Intronic
1144153227 17:12471519-12471541 AACTTCCAAGTTAATAGCTTTGG + Intergenic
1144176201 17:12710114-12710136 ATCATCCCATTTAATGATTTTGG + Intronic
1144225935 17:13146095-13146117 AATTTTCCACTTAATATATTTGG + Intergenic
1144227627 17:13165885-13165907 AATTTCCCAGTTTTTATTTTGGG + Intergenic
1144385374 17:14744596-14744618 AATTTTTCATTTAATATTTTCGG + Intergenic
1144464611 17:15487347-15487369 AATTTTCCATTTTATGTTTTTGG + Intronic
1146068645 17:29658508-29658530 TCTTTCCCATTTAATATTTTGGG + Intronic
1146198473 17:30833377-30833399 TACTTACCATTTAATATGTTAGG + Intronic
1146736859 17:35245440-35245462 AATTTTTCATTTAATATTTTTGG + Intronic
1147196843 17:38772263-38772285 AATTTTCCATTTAATATTTTTGG - Intronic
1147569716 17:41561620-41561642 AATTTTCCATTTAATATTTTTGG - Intergenic
1147795729 17:43041358-43041380 AATTTTCCTTTTAATATTTTTGG + Intergenic
1148273965 17:46286759-46286781 AGCATCACATTTAATAATTTAGG - Intronic
1149257802 17:54846946-54846968 AGTTTTCCATTTAATATTTTTGG - Intergenic
1149447785 17:56727099-56727121 AATTTTCCATTTAATATTTTTGG + Intergenic
1149486217 17:57045074-57045096 AATTTTCAGTTTAATATTTTTGG - Intergenic
1149715642 17:58786637-58786659 AATTTTCCATTAAATATTTTTGG + Intronic
1149881382 17:60295467-60295489 AAATTTCCATTTAATATTTTTGG - Intronic
1149907740 17:60542145-60542167 AATTTTCCATTTAATATTTTTGG - Intergenic
1149954722 17:61035942-61035964 AATTTTCCGTTTAATATTTTTGG + Intronic
1150028733 17:61708227-61708249 AATTTTCCATTTAATATTTTTGG - Intronic
1150029749 17:61720522-61720544 AATTTTTTATTTAATATTTTTGG - Intronic
1150409086 17:64927825-64927847 AGCATCACATTTAATAATTTAGG + Intergenic
1150528979 17:65957105-65957127 AATTTTCCATTTAATATTTTTGG + Intronic
1150718008 17:67588393-67588415 AATTTTCCATTTAATATTTTTGG - Intronic
1150941947 17:69702385-69702407 AATTTTCCATTTAATGTTTTTGG + Intergenic
1151271250 17:72997625-72997647 AATTTTCCATTTAATATTTTTGG - Intronic
1151723073 17:75869300-75869322 AATCTTCCATTTAACATTTTTGG - Intergenic
1153723569 18:7932931-7932953 AATTTTCCATTTGACATTTTCGG - Intronic
1154033177 18:10771700-10771722 AATTTTCCATTTAATATTTTTGG - Intronic
1154229394 18:12540805-12540827 AATTTTCCATTTAATATCTTTGG - Intronic
1154476770 18:14767837-14767859 AATTCCCCATTTAATATTTTTGG + Intronic
1154481227 18:14827334-14827356 AATTCCACATTTAATATTTTTGG + Intronic
1155086966 18:22468155-22468177 AATTTTTCATTTAATATTTTTGG + Intergenic
1155340061 18:24804825-24804847 ATCATGCCATTTAATATTTTAGG + Intergenic
1155391069 18:25337303-25337325 AACTTCCAAATTTTTATTTTTGG - Intronic
1155474611 18:26225924-26225946 GATTTTCCATTTAAGATTTTAGG + Exonic
1155477827 18:26252484-26252506 AATTTTCCACTTAATATTTTTGG - Intronic
1155750611 18:29418441-29418463 AATTTTTCATGTAATATTTTTGG + Intergenic
1155797263 18:30055513-30055535 CTCTTCCCATTTAATTCTTTAGG - Intergenic
1155826711 18:30454012-30454034 AATTTTCCATTTAATACTTTTGG + Intergenic
1155840749 18:30639695-30639717 AATTTTCTATTTAATAGTTTGGG + Intergenic
1155841571 18:30651381-30651403 AATTTTCCATTTAATATTTTTGG - Intergenic
1156131884 18:33986560-33986582 AATTTTGCATTCAATATTTTTGG + Intronic
1156320074 18:36011890-36011912 AACTTTTCATGTAATAGTTTTGG - Intronic
1156365696 18:36424727-36424749 AATTGTCCGTTTAATATTTTTGG - Intronic
1156415335 18:36882158-36882180 TACTTGCCATTTAATGTTTTTGG + Intronic
1156440711 18:37184856-37184878 AACTTCCCATTAAAAATGTTTGG + Intronic
1156631227 18:38971652-38971674 AATTTTTTATTTAATATTTTTGG + Intergenic
1156785732 18:40911944-40911966 AATTTTCCATTTAATATTTTTGG - Intergenic
1156803252 18:41144509-41144531 AATTGTCCATTTAATATTTTTGG - Intergenic
1156930024 18:42630338-42630360 AATTTTCTGTTTAATATTTTTGG + Intergenic
1157681521 18:49611212-49611234 AACTCCACATTTAACATTTTTGG - Intergenic
1157763027 18:50278258-50278280 AATTTTCCATTTAATATTTTTGG + Intronic
1157852614 18:51070620-51070642 AATTTTTCATTTAATATTTTTGG - Intronic
1157928777 18:51795955-51795977 AATTTTCCATTTGGTATTTTCGG + Intergenic
1157966974 18:52219221-52219243 AATTTTCAATTTAATATTTGTGG - Intergenic
1157982466 18:52397215-52397237 AATTTCTGATTTAATATTCTGGG + Intronic
1158126847 18:54109416-54109438 AATTTTTCATTTAATATTTTTGG + Intergenic
1158231220 18:55257525-55257547 AACTTCCCATATAAGAATTTTGG + Intronic
1158252714 18:55507476-55507498 AATTTTCCATTTAATATTTTTGG + Intronic
1158487361 18:57879437-57879459 ACTTCCCCTTTTAATATTTTTGG + Intergenic
1158595609 18:58813001-58813023 AATTTTCCATTTAATATTTTTGG + Intergenic
1158763308 18:60416129-60416151 AGCTTTCCCTTTAAAATTTTTGG + Intergenic
1159132988 18:64302181-64302203 AATTTTCTAGTTAATATTTTAGG - Intergenic
1159308876 18:66681872-66681894 TACTTCCCATTCATTTTTTTGGG + Intergenic
1159565597 18:70044892-70044914 AATTTTCCATTTAATATTTCTGG + Intronic
1159641923 18:70873431-70873453 AATTTTCCATGTAATATTTTTGG + Intergenic
1160030942 18:75259355-75259377 AATTTTCTGTTTAATATTTTTGG - Intronic
1160212494 18:76894185-76894207 AATTTTCCATTTAATATTTTTGG - Intronic
1160616662 18:80135819-80135841 AACTACACAGTGAATATTTTAGG + Exonic
1162161273 19:8719538-8719560 AACTAACCATTTCATTTTTTTGG + Intergenic
1162260843 19:9532598-9532620 AGTTTCCCATTTAATATTTTTGG + Intronic
1162303800 19:9859260-9859282 AATTTCCCACTTAATATTTTTGG - Intronic
1162912179 19:13853967-13853989 AATTTTCCATTTAATATTTTTGG + Intergenic
1163101117 19:15097244-15097266 AATTTTTCATTTAGTATTTTTGG - Intergenic
1163734321 19:18969643-18969665 AATTTTCCACTTAATATGTTTGG - Intergenic
1164852564 19:31496677-31496699 AACTTTCTATTTAGTATTTTTGG + Intergenic
1164963891 19:32462400-32462422 AATTTTCAATTTAATATTTTCGG + Intronic
1165667508 19:37646006-37646028 ATTTTTCCATTTTATATTTTTGG - Intronic
1166129735 19:40739055-40739077 AATTTTCCACTTAATATTTTTGG + Intronic
1167840277 19:52111231-52111253 AATATTCCATTTAATGTTTTTGG - Intergenic
1168020209 19:53603671-53603693 ACTTTTCCATTTACTATTTTTGG - Intergenic
1168114497 19:54214243-54214265 ACTTTTCTATTTAATATTTTTGG - Intronic
1168253158 19:55152385-55152407 AATTTTCCATTTAATATTTTTGG - Intronic
1168456955 19:56519771-56519793 AATTTTCCATTTAATATTTTTGG - Intronic
925206588 2:2012615-2012637 AATTTTCCGTTGAATATTTTTGG - Intronic
926033718 2:9616809-9616831 ATATACCCATTTAATGTTTTAGG - Intronic
926077893 2:9956765-9956787 AACTTCATAATTAATGTTTTAGG - Intronic
926267268 2:11335686-11335708 AAACTCCCAATTAATATTTTGGG + Intronic
926324065 2:11769114-11769136 AACTTTACATTTAACATTTGAGG + Intronic
926398807 2:12473994-12474016 TACTTCCCAATTAATGTTATAGG - Intergenic
926846317 2:17144534-17144556 ATTTTTCCATTTAATATTTTGGG + Intergenic
927127461 2:20025433-20025455 AATTTTCCATTCAGTATTTTTGG - Intergenic
927145187 2:20160445-20160467 AACATTCAATTAAATATTTTAGG - Intergenic
927221019 2:20709603-20709625 AACTCTGTATTTAATATTTTAGG - Intronic
927370697 2:22352055-22352077 AATTGTCTATTTAATATTTTTGG - Intergenic
927571665 2:24165717-24165739 AACTTTCCATTTTAAATGTTGGG - Intronic
927648003 2:24891256-24891278 AATTTTTCATTTAATATTTTTGG - Intronic
928059886 2:28101109-28101131 AACTTCTCATTTTATAGTTGAGG + Intronic
928162862 2:28944943-28944965 CATTTTCCATTTAATATTTTTGG + Intronic
928299253 2:30111094-30111116 AATTTTCTATTTAATATTTTTGG + Intergenic
928302350 2:30137056-30137078 AATTTTCCATTTAATATTCTTGG + Intergenic
928796724 2:35032552-35032574 AATTTTCCATTTTACATTTTTGG + Intergenic
928902374 2:36333654-36333676 GATTTTCCATTTAGTATTTTTGG + Intergenic
929011896 2:37453058-37453080 TACTTCCAATTGAATGTTTTGGG + Intergenic
929021995 2:37562580-37562602 AATTTTCCGTTTAATATTTTTGG + Intergenic
929270387 2:39965151-39965173 AACTTCCCTTTTGAGGTTTTTGG - Intergenic
929461493 2:42105150-42105172 ATCTTCCAATTTAAAATTTTTGG - Intergenic
929491709 2:42402914-42402936 AAATTCCCAATAAATTTTTTTGG - Intronic
930446093 2:51474272-51474294 AATTTTCCACTTAATATTTTTGG + Intergenic
930610969 2:53543227-53543249 AATTTTCCATTTATTATTTTAGG - Intronic
930612591 2:53559855-53559877 AATTTTCCATTTAACATTTTTGG + Intronic
930636430 2:53810941-53810963 TACTTCTCATTTAAAATTTCTGG - Intronic
930887561 2:56344461-56344483 AATTTTCCATTTAATATTTTTGG + Intronic
930985089 2:57575993-57576015 AAGTTTTCATTTAATATTTTCGG + Intergenic
931047202 2:58368273-58368295 AACTTTATATTTAACATTTTGGG - Intergenic
931347522 2:61460208-61460230 AATTTTCCATTTAATATTTTTGG - Intronic
931506351 2:62931611-62931633 AACTTTCCATTTAATATTTTTGG - Intronic
931533897 2:63250376-63250398 AATTTTCCATATAATATTTTTGG + Intronic
931606293 2:64056071-64056093 AATTTTCCACTTAATATTTCTGG - Intergenic
931836883 2:66108449-66108471 AGCTACCCAATTAATGTTTTGGG - Intergenic
932299303 2:70654605-70654627 AATTTTCCATTTAATTTTCTTGG - Intronic
932651835 2:73566538-73566560 AATTTTCCATTAAATATTTTTGG + Intronic
932900651 2:75695943-75695965 AATTTTCCATTCAATATTTTTGG + Intronic
932985188 2:76717738-76717760 AAGTCCCCAAGTAATATTTTTGG + Intergenic
933128692 2:78644925-78644947 ATTTCTCCATTTAATATTTTTGG - Intergenic
933422805 2:82072874-82072896 AATTTTTTATTTAATATTTTTGG - Intergenic
933467328 2:82670137-82670159 AATTTGCCATTTAATATGGTAGG + Intergenic
933510787 2:83238751-83238773 AATTTTCTATTTAATATTTTTGG + Intergenic
933582306 2:84141554-84141576 AACTTTCCATTTAATATTTTTGG + Intergenic
933911965 2:86949059-86949081 AATCTTCCATTCAATATTTTTGG - Intronic
933980438 2:87544869-87544891 AATTTTCCATTTAATAATTTTGG + Intergenic
934011030 2:87820835-87820857 AATCTTCCATTCAATATTTTTGG + Intronic
934575632 2:95399070-95399092 AATTTTCCAGTTAATATTTTTGG - Intergenic
935119249 2:100167058-100167080 AATTTTCCATTTAACATTTTTGG + Intergenic
935774592 2:106461550-106461572 AATCTTCCATTCAATATTTTTGG + Intronic
935905475 2:107834367-107834389 AATCTTCCATTCAATATTTTTGG - Intronic
935991839 2:108726089-108726111 AATCTTCCATTCAATATTTTTGG - Intronic
936127266 2:109799605-109799627 AATCTTCCATTCAATATTTTTGG - Intronic
936217431 2:110571880-110571902 AATCTTCCATTCAATATTTTTGG + Intronic
936313388 2:111405922-111405944 AATTTTCCATTTAATAATTTTGG - Intergenic
936426573 2:112426457-112426479 AATCTTCCATTCAATATTTTTGG + Intronic
936698085 2:114974912-114974934 AACATTCCATTTAATTTTTATGG - Intronic
936787146 2:116107384-116107406 AATTGTTCATTTAATATTTTTGG + Intergenic
937110255 2:119361245-119361267 AATTTTTCATTTAATATTTTTGG - Intronic
937582433 2:123503231-123503253 AATTTCCCATTTAATATTCTTGG + Intergenic
937588725 2:123588472-123588494 AATTTTCCATTTAATATTTTTGG + Intergenic
937635150 2:124147219-124147241 AACTTCTTCTTTAATACTTTGGG + Intronic
937692391 2:124771209-124771231 AAATACCCATTTCCTATTTTAGG + Intronic
937745384 2:125406114-125406136 AATTTTCTATTTAATATTTTTGG + Intergenic
938620367 2:133046118-133046140 ATTTTTCCATTTAATATTTTTGG + Intronic
938815516 2:134900202-134900224 AATTTTCCATTTAATATTTTTGG - Intronic
938964947 2:136380165-136380187 AATTTGCCATTTAAAAATTTTGG + Intergenic
939161096 2:138589792-138589814 AATTTTCCATTTAATATTTTTGG + Intergenic
939216524 2:139245926-139245948 ACCTTCCATTTTAAAATTTTAGG + Intergenic
939246100 2:139625477-139625499 AAATTCCCACCTAATAATTTTGG - Intergenic
939435724 2:142175156-142175178 AAATTTAAATTTAATATTTTGGG - Intergenic
939458452 2:142467747-142467769 AATTTCTCATTTAATATTTTTGG - Intergenic
939620680 2:144415159-144415181 AAATTTCCATTTAATATTTAAGG + Intronic
939749918 2:146031450-146031472 ATTTTTCCCTTTAATATTTTAGG + Intergenic
939785239 2:146501726-146501748 AAATTCTCATTTAATAGCTTAGG - Intergenic
939796762 2:146655212-146655234 ACCTTTCCATTTAATATTTCTGG - Intergenic
939805201 2:146767255-146767277 AATTTTCCATGTAATATTTTTGG - Intergenic
940295343 2:152116763-152116785 AATTTTGCATTTAATATTTTTGG - Intergenic
940346220 2:152631649-152631671 AATTTTCCACTTAGTATTTTTGG + Intronic
940456304 2:153906065-153906087 AATTTTCCATTTAATATTTTTGG + Intronic
940562689 2:155321122-155321144 AACTTTCCTTTTATTCTTTTTGG + Intergenic
940845231 2:158633553-158633575 AATTTTCCATTTGATATTTTTGG + Intronic
940943790 2:159593552-159593574 AATTTTCATTTTAATATTTTTGG - Intronic
940974312 2:159926542-159926564 AACTTTCCATTTCATTTTTGTGG - Intergenic
941450704 2:165656991-165657013 ATATTTTCATTTAATATTTTTGG - Intronic
941595752 2:167475115-167475137 AATTTACTATTTAATATTTTTGG - Intergenic
941829647 2:169940826-169940848 AATTTTCCATTTAATATTTTCGG - Intronic
941838042 2:170047704-170047726 AATTTTCCATTTACTCTTTTTGG - Intronic
941931068 2:170939513-170939535 AATTTTCCATCTGATATTTTTGG - Intronic
942297308 2:174530225-174530247 AATTTTCCATTTAACATTTTTGG + Intergenic
942641921 2:178069622-178069644 AAGTTGCCTTTTAATATTTTTGG - Intronic
942891278 2:180991904-180991926 ATTTTTCCATTTAATATTTTTGG + Intronic
942920081 2:181362657-181362679 AATTTTTCATTTAATATTTTTGG + Intergenic
942998381 2:182294152-182294174 AATTTTCCATTTAGTATTTTTGG + Intronic
943289347 2:186048768-186048790 AATTTTCTATTTAATATTTTTGG + Intergenic
943600805 2:189918996-189919018 AATTTTCTATTTAATATTTTTGG - Intronic
943671717 2:190669214-190669236 AATTTTTCATTTAATATTTTTGG + Intronic
943849747 2:192703232-192703254 AATTTTCAATTTAATATTTTTGG + Intergenic
944088534 2:195877488-195877510 ATTTTACCATTTGATATTTTGGG - Intronic
944130163 2:196339091-196339113 ATCTTCACACTTTATATTTTAGG - Intronic
944169737 2:196761378-196761400 AACTTCCACTTCAATCTTTTAGG - Intronic
945056309 2:205872445-205872467 AATTTTCCAGTTAATATTTTTGG + Intergenic
945478189 2:210311368-210311390 AACTTTCAATTTAATATGTAAGG - Intronic
945665468 2:212735982-212736004 AATTTTCCATTTAATATTTTTGG + Intergenic
945744928 2:213708822-213708844 CACTTGCCATTTAACATTTTGGG - Intronic
946265853 2:218540677-218540699 AATTTTCCATTTAACATTTTTGG + Intronic
947129062 2:226903262-226903284 AATTTTCCATTTAATGTTTTTGG - Intronic
947464599 2:230330785-230330807 AATTTTCCATTTAATGTTTTTGG - Intronic
947473472 2:230419226-230419248 AATTTTGCATTTAATGTTTTTGG - Intronic
948238148 2:236405921-236405943 AATTTTCCATTTAATACTTATGG + Intronic
948562219 2:238861772-238861794 AATTTTCCATTTAATAACTTTGG - Intronic
948788194 2:240363976-240363998 AAATTCCCAGCTAATATTTATGG - Intergenic
948819588 2:240533950-240533972 AATTTTCCATTTATTATTTTTGG - Intronic
1168866855 20:1094044-1094066 AATTTTCCATTTAATATTTTTGG + Intergenic
1169187159 20:3628428-3628450 AATTTTCCACTTAATGTTTTTGG - Intronic
1169558694 20:6775657-6775679 ATCTTGTCATTTAATTTTTTGGG + Intronic
1169755289 20:9036663-9036685 AAATTTTCCTTTAATATTTTTGG - Intergenic
1170111367 20:12807605-12807627 AACTTACCTTTTATTATTTGTGG + Intergenic
1170450498 20:16478482-16478504 AATTTTCCATTTAATATTTTTGG - Intronic
1170758245 20:19224010-19224032 GTTTTTCCATTTAATATTTTTGG + Intronic
1170908676 20:20541669-20541691 AATCTTCCATTTAATATTTTTGG + Intronic
1170919521 20:20664132-20664154 AATTTTCCATTTAATGTTTTTGG + Intronic
1171102260 20:22395162-22395184 TACTACCCATAAAATATTTTTGG + Intergenic
1172063826 20:32206088-32206110 AATTTCCCAGTTGCTATTTTGGG - Intronic
1172264944 20:33603072-33603094 AATTTTCCATTTGATATTTTTGG + Intronic
1172453179 20:35043788-35043810 AATTTTTCAGTTAATATTTTCGG + Intronic
1173012477 20:39194875-39194897 AATTTTCTGTTTAATATTTTTGG + Intergenic
1173035985 20:39410880-39410902 AAATGCCCTATTAATATTTTGGG + Intergenic
1173754889 20:45507258-45507280 AATTTTCCATTTCATATTTTTGG + Intergenic
1173935002 20:46853689-46853711 GATTTTCCATTTAGTATTTTTGG + Intergenic
1174293688 20:49528189-49528211 AATTTTTCATTTAATATTTTTGG - Intronic
1174558594 20:51413759-51413781 AAATTTTTATTTAATATTTTTGG - Intronic
1174679542 20:52392896-52392918 AATTTTCCATTTAATATTTTTGG + Intergenic
1174949790 20:55031052-55031074 TTCTTCCCATTTAATTTTCTTGG + Intergenic
1175557084 20:59872201-59872223 AATGTTCCATTTAATATTTTTGG - Intronic
1176799376 21:13409272-13409294 AATTCCACATTTAATATTTTTGG - Intergenic
1176891143 21:14321047-14321069 AGTTTTTCATTTAATATTTTTGG + Intergenic
1176975074 21:15311704-15311726 AACTACCCAGTGAATATTTGTGG - Intergenic
1177033619 21:16014389-16014411 AATTTTCCGTTTAATATTTTTGG - Intergenic
1177467334 21:21503552-21503574 AATTTTCCATTTGATATTTTTGG + Intronic
1177483605 21:21725942-21725964 AATTTTCCATTTAATACTTTTGG - Intergenic
1177548834 21:22594963-22594985 TCTTTCCCATTTACTATTTTGGG + Intergenic
1177620503 21:23585680-23585702 AATGTTCCATGTAATATTTTTGG - Intergenic
1177758467 21:25374610-25374632 AATTTTCCATTTAATATTTTTGG + Intergenic
1177826931 21:26094786-26094808 AGCTTTCTATTTAATATTTTTGG - Intronic
1179005442 21:37509858-37509880 AATTTTCCACTTTATATTTTTGG - Intronic
1179274047 21:39875031-39875053 GATTTTCCATTGAATATTTTTGG + Intronic
1179274731 21:39881849-39881871 TACTTGCCATTTAATCTTTCCGG - Intronic
1179306932 21:40162865-40162887 AATTGACCATTTCATATTTTGGG + Intronic
1179447034 21:41439297-41439319 AATTTTCCAGTTTATATTTTAGG + Intronic
1179646658 21:42780203-42780225 CACTTCCCCTTTACTAGTTTTGG - Intergenic
1179775027 21:43656625-43656647 ACCTCCCCATTTAGTATTCTGGG + Exonic
1180015015 21:45075770-45075792 TAGTTCCCAGTTAATATTTTTGG + Intronic
1181378482 22:22479956-22479978 AATTTTCCGTTTAATATTTTTGG - Intergenic
1182022783 22:27095099-27095121 AAATTCCCATTTAACAGTTAAGG - Intergenic
1182901720 22:33904031-33904053 ATCTTCCTACTGAATATTTTCGG + Intronic
1182939610 22:34262909-34262931 AATTTTCCATTTAATATTTTTGG + Intergenic
1183998560 22:41654931-41654953 AATTTTCCACTTAAAATTTTTGG - Intronic
1184278006 22:43421267-43421289 TAATGCCCATTTAATATTTATGG - Intronic
1184501651 22:44878362-44878384 AAATTTCCATTTAATATTTTTGG - Intergenic
1184906646 22:47491981-47492003 AAGTTTCCATTTATTATTTTTGG + Intergenic
1184922545 22:47615572-47615594 AATTTTCCATTTGATATTTTTGG - Intergenic
1184940136 22:47758533-47758555 AATTTTCCATGTGATATTTTTGG + Intergenic
1185072405 22:48663610-48663632 AAATTTCTATTTAATATTTTTGG - Intronic
1185102235 22:48847068-48847090 AATGTTCCATTTAATATTTTTGG - Intronic
949093203 3:54233-54255 AATTTTCCATTTAATTTTTTTGG - Intergenic
949121643 3:391746-391768 AAGTTTCCATTTAATTTCTTAGG - Exonic
949183205 3:1159464-1159486 AATTTAGCGTTTAATATTTTTGG + Intronic
949281357 3:2351668-2351690 AATTTCCCATTTAATATTTTTGG + Intronic
949294714 3:2507817-2507839 TACTTCTCATTTAATTTTTGGGG - Intronic
949422488 3:3880864-3880886 AATTCTCCATTTAAGATTTTTGG + Intronic
949528780 3:4932982-4933004 AGCTTTACATTTAAGATTTTTGG + Intergenic
949673998 3:6432118-6432140 TATTTCCCATTTATTATTTTGGG - Intergenic
949693216 3:6664330-6664352 AATTTTCCATTTACCATTTTTGG + Intergenic
951124700 3:18969596-18969618 ATTTTACCATTTAATATTGTGGG - Intergenic
951141047 3:19160645-19160667 GATTTTCCATTTAATATTTTTGG - Intronic
951331250 3:21371154-21371176 AGTTTTCCATTTAATATTTTTGG - Intergenic
951402805 3:22255066-22255088 AACTTTCCATTTAGTATTTTTGG + Intronic
951502059 3:23399597-23399619 AATTTTTCATTTAATATTTTTGG + Intronic
951507200 3:23460579-23460601 AACTTTCCACTTTATATTATCGG - Intronic
952104765 3:30056279-30056301 AACTTCACATATACTAATTTGGG + Intergenic
952291801 3:32023972-32023994 GATTTTCCACTTAATATTTTTGG + Intronic
952398793 3:32944860-32944882 AATTTTCAATTTAATATTTTTGG - Intergenic
952469815 3:33635563-33635585 AACTTTCCATTTTATTTATTTGG - Intronic
952734869 3:36679692-36679714 AATATTCCATTTAATATTTTGGG + Intergenic
952765627 3:36951451-36951473 AAATTCAGATTCAATATTTTTGG - Intergenic
953146404 3:40279828-40279850 GACTTCCCATTTGAGATTTGTGG + Intergenic
953609289 3:44434023-44434045 AATTCCACATTTAACATTTTGGG - Intergenic
953724623 3:45387255-45387277 AATTTTTCATTTAATATTTTTGG - Intergenic
953872702 3:46641243-46641265 CACTTCCCCTTTATTAGTTTTGG + Intergenic
954169594 3:48790263-48790285 AATTTTCCATTTAGTATTTTTGG + Intronic
954926759 3:54242750-54242772 AATTTCCCGTGTAATATTTTTGG + Intronic
955425609 3:58786440-58786462 AATTTTCCATTTAATATTTTTGG - Intronic
955440739 3:58952247-58952269 TATTTTCCACTTAATATTTTTGG - Intronic
955553100 3:60105955-60105977 GATTTTCCATTTAATATTTTTGG - Intronic
955615471 3:60802471-60802493 AAATGCCCATTTAATATTTTGGG - Intronic
955894354 3:63683663-63683685 TACTTCCAATTTATTATTTCAGG - Intergenic
955994114 3:64660466-64660488 AATTTTCCATTTAATATTTAAGG - Intronic
956028784 3:65013112-65013134 GATTTTCCATTGAATATTTTTGG - Intergenic
956104119 3:65798754-65798776 AATTTTTCATTTAATATTTTTGG - Intronic
956251331 3:67237376-67237398 AGGTTCCCATTTAATATTGTTGG - Intergenic
956463757 3:69498298-69498320 AACTTATCATTTAATATTTTTGG + Intronic
956739119 3:72261094-72261116 TTTTTTCCATTTAATATTTTGGG - Intergenic
956758383 3:72413278-72413300 AATTTTCCATTTAATATTTTTGG - Intronic
956971605 3:74532742-74532764 AATTTTCCATTTAATATTTTTGG + Intergenic
956992926 3:74789449-74789471 AATTTCTCATTAAATATTTTTGG + Intergenic
957033461 3:75270304-75270326 AATTTTCCATTTAATTTTTTTGG - Intergenic
957119419 3:76070426-76070448 AAATTCCCACCTAATAATTTTGG + Intronic
957574907 3:81994988-81995010 AATTCTCCATTTAATATGTTTGG - Intergenic
957674005 3:83343448-83343470 AACTTTTCATTTTTTATTTTGGG - Intergenic
957877183 3:86162607-86162629 AAATTCCACTTAAATATTTTTGG + Intergenic
958067845 3:88567343-88567365 AACTTTATATTTAACATTTTAGG - Intergenic
958114789 3:89201757-89201779 AACTTCCCATGGCATATTTCTGG - Intronic
959118809 3:102208787-102208809 AAATTCCCACCTAATAATTTTGG - Intronic
959233014 3:103681569-103681591 AAATTCCCATCTAGTTTTTTTGG - Intergenic
959403630 3:105933678-105933700 AACCACCCATTTAATGCTTTGGG - Intergenic
959538216 3:107511074-107511096 AAATTCCCATTTTACAGTTTAGG + Intergenic
959796098 3:110430015-110430037 ATCTTACCACTTATTATTTTAGG + Intergenic
959904527 3:111695876-111695898 AATTTTCCATTTAATAGTTTTGG + Intronic
959977930 3:112482969-112482991 AACTTCCCTTTTCATTTTCTTGG + Intronic
959983532 3:112546492-112546514 AATTTGGCACTTAATATTTTTGG + Intronic
960131489 3:114061045-114061067 AATTTTCCGTTTAATATGTTTGG + Intronic
960652763 3:119969826-119969848 AATTTTCCATTTATTATTTTTGG - Intronic
960804227 3:121567306-121567328 AAGTTTCCATTTAATATTTTTGG + Intergenic
961023154 3:123527310-123527332 AATTTTCCATTTAATATTTTTGG - Intronic
961215295 3:125155119-125155141 TATTTTCCATTTAGTATTTTCGG + Intronic
961431371 3:126886286-126886308 AAATTTCCACTTAATATTTTTGG - Intronic
961587159 3:127941163-127941185 AACTTCCCATCTCATTTTATAGG + Intronic
961708230 3:128806540-128806562 AACTTCCCATTTGTTGTGTTGGG + Exonic
961854723 3:129858360-129858382 AATTTCCCATTTTACATTTTTGG + Intronic
961971556 3:130973670-130973692 AATTTTCTATTTAATATTTTTGG + Intronic
962124701 3:132604182-132604204 AATTTTTCACTTAATATTTTTGG - Intronic
962651955 3:137503969-137503991 AACTTCTAATTCAAAATTTTTGG + Intergenic
962760601 3:138509644-138509666 AATTTTCCTTTTAATATTTTTGG - Intronic
962858277 3:139370427-139370449 ACTTTTCCACTTAATATTTTTGG + Intronic
963269405 3:143270926-143270948 GATTTTCCATTTAATTTTTTTGG - Intronic
963507503 3:146205740-146205762 AATTTTCCATTTAATATTTTTGG + Intronic
963526748 3:146424638-146424660 AATTTTTCATTTAATATATTTGG - Intronic
963662086 3:148139764-148139786 AACAGCCCATGTAATGTTTTAGG - Intergenic
963676309 3:148315817-148315839 GATTTTCCATTTAATATTTTTGG - Intergenic
963736628 3:149024595-149024617 AACACCCCATTGAATGTTTTAGG + Intronic
963885793 3:150580946-150580968 GATTTTCCATGTAATATTTTTGG + Intronic
963918922 3:150887356-150887378 AATTTTCTATTTAATATTTTTGG + Intronic
964212891 3:154247569-154247591 AGGTTCCCAATAAATATTTTTGG + Intronic
964327071 3:155558743-155558765 GAATTTCTATTTAATATTTTCGG + Intronic
964726788 3:159822062-159822084 AATTTTCCATTTAATGTTTTTGG + Intronic
964727537 3:159829863-159829885 ACCTTCTCATTTGATATATTGGG - Intronic
965376621 3:167932223-167932245 AAATTCCCATAGGATATTTTTGG - Intergenic
965408891 3:168305071-168305093 AATTTCCCACTAATTATTTTTGG - Intergenic
965468339 3:169060058-169060080 ATTTTTCTATTTAATATTTTGGG + Intergenic
965573719 3:170196903-170196925 CATTTTCCATTTAATATTTTTGG - Intergenic
965610645 3:170540200-170540222 AATTTTCCATTTCATATTTTTGG + Intronic
965856640 3:173097031-173097053 AATTTTCCACTTAATATTTTTGG - Intronic
965994001 3:174856388-174856410 AATTTTCCATTCAATATTTTTGG - Intronic
966005651 3:175008417-175008439 AGTTTTCCATTTAATATTTCTGG + Intronic
966039677 3:175466494-175466516 AGCTTCCAACTTAAAATTTTAGG - Intronic
966080410 3:175993337-175993359 AATTTTCCATTTAATATTTTTGG + Intergenic
966156320 3:176920422-176920444 GATGTTCCATTTAATATTTTTGG - Intergenic
966396476 3:179509333-179509355 GAATGCCCATTTATTATTTTAGG + Intergenic
967587584 3:191234153-191234175 ATTCTCCCATTTAATATTTTAGG + Intronic
967714494 3:192746936-192746958 AATTTTGCATTTAATATTTTTGG - Intronic
968778552 4:2561142-2561164 AAGTTCACACTTAATATGTTAGG + Intronic
969157723 4:5226414-5226436 AATTTTTCATTTAATGTTTTTGG - Intronic
969689579 4:8696831-8696853 AATTTTCCATTTAATATTTTAGG - Intergenic
970738378 4:19201365-19201387 AACTACCAATGAAATATTTTAGG - Intergenic
971309226 4:25510270-25510292 CACTGCCCAATTAATACTTTGGG - Intergenic
971445814 4:26747058-26747080 AATTTTTCATTTAATATTTTTGG + Intronic
972027346 4:34399478-34399500 AATTTTTCACTTAATATTTTTGG + Intergenic
972122413 4:35720869-35720891 GACTTTCAATCTAATATTTTTGG + Intergenic
972375236 4:38463591-38463613 AATTTTCTATTTAATATTTTTGG + Intergenic
972402125 4:38715185-38715207 AATTTTCCATGAAATATTTTTGG - Intergenic
972405738 4:38744862-38744884 AATTTTCCACTTAATATTTTTGG + Intergenic
972467914 4:39375106-39375128 AAATTGCCAATGAATATTTTAGG + Intergenic
972978116 4:44662552-44662574 AATTTTCCATTTAATGCTTTTGG + Intronic
973054535 4:45639238-45639260 AACATTCCATTTAATATCTCAGG - Intergenic
973263828 4:48190816-48190838 AACTTCTGATTTTATATTTAGGG - Intronic
973544242 4:51964612-51964634 TATTTCCCATGTAATATTTAGGG - Intergenic
973553726 4:52060760-52060782 AACTCGTCATTTAACATTTTAGG + Exonic
973739211 4:53902852-53902874 ATTTTTCCATTTAATATTTTTGG - Intronic
974064104 4:57061689-57061711 AATTTCCCATGTAATATTTTCGG + Intronic
974753051 4:66166314-66166336 AATTTTCCATTTAATATTTTTGG - Intergenic
974856611 4:67468534-67468556 AATTTTCCATTTAACATTTTTGG + Intergenic
975052752 4:69885833-69885855 AACTCCCAAATTCATATTTTGGG + Intergenic
975275172 4:72489334-72489356 AATTTTTCATTTAATATTTTTGG - Intronic
975377635 4:73664418-73664440 AACTTCTGATTTAATTTTTCAGG - Intergenic
975557907 4:75682454-75682476 AGTTTTCCATGTAATATTTTTGG + Intronic
975583109 4:75924445-75924467 AATTTTCCATTTCATATTTCTGG + Intronic
975605001 4:76146558-76146580 AACTTCCCAATTAACTTTTAGGG + Intronic
975644527 4:76533113-76533135 AATTTTCCATTGAATATTTTTGG + Intronic
975869577 4:78764969-78764991 AATTGTCCATTTAATATTTTTGG + Intergenic
975989081 4:80238218-80238240 AATTTTGCATTTACTATTTTTGG + Intergenic
976388803 4:84488584-84488606 AACTTTCCATTTAATAGGCTGGG + Intergenic
976567158 4:86564159-86564181 AATTTTCCATTTACTATTTTAGG + Intronic
976914001 4:90347475-90347497 AATTTTCCATTTCATATTTTTGG - Intronic
976921067 4:90443520-90443542 AATTTTACATTTAATATTTTTGG + Intronic
977029952 4:91870258-91870280 AACTTTTTTTTTAATATTTTGGG + Intergenic
977191842 4:94010678-94010700 AAATTACCATTTAGAATTTTAGG - Intergenic
977322863 4:95541190-95541212 AATTTTCCATTTAATGTTTTTGG - Intronic
977429113 4:96909206-96909228 AATTTATCATTTCATATTTTTGG - Intergenic
977977496 4:103284441-103284463 AATTTTCCATTTAATATTTTTGG - Intergenic
978148009 4:105399836-105399858 AATTTTCCATTTAATATTTCTGG - Intronic
978181932 4:105808719-105808741 AATTTTTCATTTAATATTTTTGG - Intronic
978367897 4:108001822-108001844 AATTTCCCATTTAATATTTTTGG + Intronic
978420198 4:108524118-108524140 AATTTTTCATTTAATATTCTTGG - Intergenic
978540812 4:109814803-109814825 GACTTCCCATTTATTAAATTTGG - Intergenic
978628184 4:110711610-110711632 ACGTTCCCTTTTAACATTTTTGG + Intergenic
978711059 4:111781686-111781708 AATTTCTCATTTAGTATTTTTGG - Intergenic
978767780 4:112422212-112422234 AATTTTCCATTTAATATTTTTGG + Intronic
979356050 4:119707061-119707083 AATTTTCCATTTAATATTTTTGG + Intergenic
979425347 4:120557647-120557669 AGTTTTCCATTTAATATTTTTGG + Intergenic
979447611 4:120833162-120833184 AATTTGTCATTGAATATTTTTGG - Intronic
979560391 4:122095327-122095349 AATTTTCTATTTAATATTTTTGG - Intergenic
979650567 4:123125524-123125546 AAGTTCACTTTTAATATATTTGG - Intronic
980017000 4:127661353-127661375 AATTTCCCTTTTTTTATTTTTGG + Intronic
980069651 4:128230030-128230052 AAGATCCCATTTAATGTCTTTGG - Intergenic
980240237 4:130163976-130163998 AAACTCTCGTTTAATATTTTTGG - Intergenic
980245332 4:130231709-130231731 AATTTTTCATATAATATTTTTGG + Intergenic
980334236 4:131449612-131449634 AACTTTCCATGTAATGTTTTTGG - Intergenic
980568635 4:134580247-134580269 CACTTCTCATTAAATATTGTGGG + Intergenic
980611176 4:135165968-135165990 TACTTTCTATTTTATATTTTAGG - Intergenic
980646804 4:135652923-135652945 AAATTCCCACCTAATAATTTTGG - Intergenic
980661269 4:135862040-135862062 AAATTTCCATTTAATATTTTTGG - Intergenic
980682392 4:136180535-136180557 AATTTTCTATTTGATATTTTTGG + Intergenic
980763456 4:137267308-137267330 AATTTTCCATGTAATATTTTTGG + Intergenic
981172874 4:141645214-141645236 AAGTTCCACTTTAATTTTTTGGG + Intronic
981666510 4:147233127-147233149 GATTTCCCATTTAATGTTTTTGG - Intergenic
981788905 4:148513245-148513267 AATATTCCATTTAATATTTTGGG - Intergenic
982338524 4:154268547-154268569 ACCTTCCCATTTAACATTTTTGG + Intronic
982601813 4:157460906-157460928 AAATTCCGATTTTATATTTTTGG + Intergenic
982790847 4:159589593-159589615 AAGTTTCCATTTAATAGTTTTGG + Intergenic
982917049 4:161226155-161226177 AAAATACCATGTAATATTTTTGG + Intergenic
983109872 4:163736466-163736488 AATTTTCCATTTAATATTTTTGG + Intronic
983111886 4:163760785-163760807 AACTTCTCATTTACTAATTATGG + Intronic
983165216 4:164467850-164467872 AATTCCCCATTTAATATTTTTGG + Intergenic
983378144 4:166956593-166956615 AATTTTCCATTTAATATTTTTGG + Intronic
983484044 4:168312614-168312636 CACTTGCCATTCAATATGTTAGG + Intronic
983865823 4:172765263-172765285 TACTTCTCATTTTATATTTTGGG - Intronic
983907093 4:173195115-173195137 TAATTCCAAATTAATATTTTGGG - Intronic
983977030 4:173947602-173947624 AACTCCCAAATTAACATTTTTGG + Intergenic
984049989 4:174854005-174854027 AACTTTCCATTTAATATTTTCGG + Intronic
984094036 4:175412016-175412038 AATTTTCCATCTAATATATTTGG + Intergenic
984128818 4:175847338-175847360 AATTTTCCATTTAATATTTTTGG - Intronic
984385767 4:179055550-179055572 AACTTCTCCTTTGTTATTTTTGG - Intergenic
984396107 4:179201797-179201819 AATTTTTCATTTAACATTTTTGG + Intergenic
984775472 4:183478097-183478119 AAGTTCCCAAATAATATTGTAGG - Intergenic
985043376 4:185915630-185915652 GAATTCCCAATAAATATTTTTGG - Intronic
985190950 4:187372209-187372231 CACTTCACATTTCAGATTTTTGG + Intergenic
985584188 5:719822-719844 AATTTTCCATTTAATATTATTGG - Intronic
985597690 5:804148-804170 AATTTTCCATTTAATATTATTGG - Intronic
986079433 5:4374970-4374992 AATTTTCCATTTAACATTTTTGG - Intergenic
986228269 5:5837535-5837557 AAATTCCTAATGAATATTTTTGG - Intergenic
986239657 5:5948978-5949000 CACTTCTCATTTATTATTTCTGG + Intergenic
986317881 5:6603113-6603135 AACTTGCTGTTTAATATTTTTGG - Intronic
986583158 5:9286489-9286511 GACTTCCCATGTAATGCTTTGGG + Intronic
987027050 5:13938000-13938022 AATTATCCATTTAACATTTTTGG - Intronic
987030949 5:13976291-13976313 AATTTTCCATTTAATATTTTTGG - Intergenic
987169736 5:15241528-15241550 AATTTTACATTTAATATTTTTGG + Intergenic
987177578 5:15331461-15331483 AATTTTCCATTTAATAGTTTTGG + Intergenic
987380177 5:17277601-17277623 AAGGTCCCATTTAATGGTTTGGG + Intergenic
987383164 5:17304702-17304724 AATTTTCCATGTAATATTTTTGG + Intergenic
987610003 5:20190850-20190872 AAATTCCCTTTTCCTATTTTTGG + Intronic
987790475 5:22560195-22560217 ATTTTCCCAATTAATATTTTTGG - Intronic
987794912 5:22615056-22615078 AATTTTCCATTTAACATTTTTGG + Intronic
987801696 5:22705568-22705590 TAATTCCCATTTTATAATTTGGG - Intronic
987921846 5:24293781-24293803 TACTTCATATTTAAGATTTTTGG + Intergenic
987973798 5:24985255-24985277 ATCTTGCCATTTTATTTTTTAGG + Intergenic
988032037 5:25775079-25775101 AATTTTCCATTTAATATTCTAGG + Intergenic
988147418 5:27328559-27328581 AAGTTTCCATTGAATATTTTTGG - Intergenic
988206968 5:28150300-28150322 AACTTTCCATTTAATATTTTTGG + Intergenic
988355950 5:30174952-30174974 AGTTTTCCATTTAATAATTTTGG - Intergenic
988443078 5:31253983-31254005 AATTTTCCATGTAATATTTTTGG - Intronic
988883826 5:35533589-35533611 AATTTTCCATTTAATATTTTTGG + Intergenic
988903212 5:35756054-35756076 AAATTTCCATGTAATATTTTCGG - Intronic
988909007 5:35820872-35820894 AACTTCCCATTCTATATTAATGG + Intergenic
988991442 5:36674981-36675003 TGTTTCCCTTTTAATATTTTAGG - Intronic
988999189 5:36743441-36743463 CACTTCCCATATATTATTTTAGG + Intergenic
989162343 5:38403692-38403714 AATTTCCCATTTAATATTTTTGG + Intronic
989280375 5:39634776-39634798 AATTTTTTATTTAATATTTTTGG + Intergenic
989436019 5:41414675-41414697 AATTTTCCATTTAACATTTTTGG - Intronic
989474537 5:41858971-41858993 AATTTTCCATTTAATATTTGTGG - Intronic
989491821 5:42064881-42064903 AATTTCCCATTTAATATTTTTGG - Intergenic
989553165 5:42759539-42759561 AATTTCCCATTTAATAGTTTTGG - Intronic
989790044 5:45387956-45387978 AACTTTCCATTTGATATTTTTGG + Intronic
990054628 5:51557119-51557141 AATTGTCCATGTAATATTTTTGG + Intergenic
990167216 5:53008026-53008048 AAATTCCAATTTACTATTTCAGG - Intronic
990542838 5:56791699-56791721 TATTTTTCATTTAATATTTTTGG + Intergenic
990545697 5:56818282-56818304 TACTTACCATTTAAAGTTTTAGG + Intronic
990569832 5:57067009-57067031 AATTTTCCATTTAATATGGTTGG - Intergenic
990602633 5:57376390-57376412 CACTGAACATTTAATATTTTTGG + Intergenic
991052672 5:62289730-62289752 AAATTTCCTGTTAATATTTTAGG - Intergenic
991070553 5:62474997-62475019 AATTTTATATTTAATATTTTTGG + Intronic
991099089 5:62772143-62772165 AATTTTCCATTTAATATTTTTGG + Intergenic
991228365 5:64299824-64299846 AATTTCCTATTTAATAGTTTTGG - Intronic
991274439 5:64827800-64827822 AATTTTCCATTTAATATTTCTGG - Intronic
991374828 5:65955811-65955833 AATTTTCCATTTAATATTTTTGG - Intronic
991966013 5:72091842-72091864 AACTTCCAATTATATATTTGTGG - Intergenic
992139858 5:73785099-73785121 AATTTTCTATTTAGTATTTTTGG + Intronic
992211358 5:74482994-74483016 AATTTTCCATTTAATATTTTTGG - Intergenic
992483939 5:77177888-77177910 ATTTTTCAATTTAATATTTTTGG + Intergenic
992665110 5:79000746-79000768 ATTTTCTCATTAAATATTTTGGG + Intronic
993207571 5:84902818-84902840 AATTTCCCATATCACATTTTTGG - Intergenic
993372833 5:87113979-87114001 AATTTTCCGTTTAATATTTTCGG - Intergenic
993468936 5:88283000-88283022 AATTTTTCAGTTAATATTTTTGG + Intergenic
993523208 5:88931164-88931186 ATCGTTCCATTTAACATTTTGGG + Intergenic
993571890 5:89550923-89550945 AATTTTCCATTTAGTATTTCGGG - Intergenic
993711385 5:91229107-91229129 GAATTTCCACTTAATATTTTTGG - Intergenic
993822543 5:92636997-92637019 AGCCTACCATTTAATACTTTTGG + Intergenic
994101821 5:95901968-95901990 AATTTTCCTTTTAATATTTTTGG + Intronic
994186808 5:96824128-96824150 AATTTTCCACATAATATTTTTGG + Intronic
994290323 5:98022463-98022485 GACTGCTCATTTAATATTTCTGG - Intergenic
994391572 5:99197933-99197955 ACCTTCCCCTGTAATATTGTTGG - Intergenic
994423667 5:99557636-99557658 CACTTCACATTTAATGTTTTAGG - Intergenic
994765483 5:103910919-103910941 AAATTCATGTTTAATATTTTTGG - Intergenic
994844205 5:104964746-104964768 AAATTCCAATTTACTATATTGGG - Intergenic
995057883 5:107781465-107781487 CACTTACCATTTAATTATTTTGG + Intergenic
995169773 5:109093970-109093992 AACTACTCATTTTATATTTTTGG - Intronic
995277707 5:110295666-110295688 AATTTTCCATTTAATATCTTAGG - Intronic
995340890 5:111057954-111057976 AATTTTCTATTTAATATGTTTGG + Intergenic
995371161 5:111420540-111420562 AAATTCCCACCTAATAATTTTGG - Intronic
995573453 5:113505254-113505276 AATTTTCCATTTAAGATTTGTGG - Intergenic
995739817 5:115344050-115344072 AATTTTTCTTTTAATATTTTTGG - Intergenic
996166115 5:120225975-120225997 AACTTTCCAGTTATTGTTTTGGG + Intergenic
996282419 5:121746671-121746693 AACTTTTCATTTAATATTTGAGG - Intergenic
996621235 5:125506175-125506197 AATTTTCCATTTAAGAATTTTGG - Intergenic
996763879 5:127015793-127015815 AATTTTCCATTTTATATTTTCGG - Intronic
996827661 5:127703530-127703552 AAATTCCCATGAATTATTTTGGG - Intergenic
996997106 5:129710932-129710954 AAATCCCCCTTTAAAATTTTTGG - Intronic
997014929 5:129921505-129921527 AATTTTTCATTTAATATTTTTGG + Intronic
997023554 5:130030833-130030855 AACTTTCCATTGAAGATTTGAGG + Intronic
997137300 5:131340218-131340240 AAATTTCCATTTAATATTTTTGG - Intronic
998200871 5:140118848-140118870 AACTTCCAATTTGATTTTTCAGG + Exonic
998538857 5:142960379-142960401 AATTTTTCATTTAATATTTTGGG - Intronic
998748314 5:145287529-145287551 AATTTTCCATTTAAAATGTTTGG + Intergenic
998792025 5:145776125-145776147 AATTTTCCACTTAATATTTTTGG - Intronic
998793101 5:145787491-145787513 AGCATGCCATTTACTATTTTGGG - Intronic
999243880 5:150143214-150143236 AATTTTCCATTTAATGTTTTTGG + Intronic
1000126293 5:158247088-158247110 AAGTTCACACTTAATAATTTTGG - Intergenic
1000203587 5:159035937-159035959 AACTTCCCTTTTAAATCTTTGGG - Intronic
1000366601 5:160497097-160497119 AATTTTTCATTTAGTATTTTTGG + Intergenic
1000457570 5:161470741-161470763 AATTTTCCATTTAATATTTTCGG + Intronic
1000626849 5:163548494-163548516 AAGTTCTCATTTCATATTTAGGG + Intergenic
1000694830 5:164367993-164368015 AATTTTCAATTTAATATTTTTGG + Intergenic
1000883436 5:166723029-166723051 ACATTTCCATTTAATGTTTTCGG - Intergenic
1001227828 5:169960746-169960768 GATTTTCCATTTAATATTTTTGG - Intronic
1001499563 5:172219331-172219353 ATTTTTCCATTTAATATTTTTGG - Intronic
1001815171 5:174662537-174662559 AATTTTTCATTTAATATTTTTGG - Intergenic
1002676355 5:180916872-180916894 AATTTTTCATTCAATATTTTTGG + Intronic
1003040632 6:2684371-2684393 AATTTTCCACTTAATATTTTGGG + Intronic
1003160763 6:3632279-3632301 AACTTTCCATATAATATTTTTGG + Intergenic
1003301274 6:4884958-4884980 AATTTTCCATTTAATATTTTTGG - Intronic
1003487259 6:6590437-6590459 AATTTTCTATTTAATATTTTTGG + Intronic
1003693445 6:8377563-8377585 AAGTTTCCATTTAATATTTCTGG - Intergenic
1004125049 6:12865095-12865117 AACTTCCCATTTTAAAAGTTGGG - Intronic
1004215055 6:13694629-13694651 AATTTTCCAATTAATATTTTTGG - Intronic
1004311334 6:14548311-14548333 AATTTTGCATTTATTATTTTTGG - Intergenic
1004665819 6:17747811-17747833 AACTTCACAGTTAATTTCTTAGG + Intergenic
1004927451 6:20429309-20429331 AATTTTTCATGTAATATTTTTGG - Intronic
1005033357 6:21532113-21532135 AATTTGCCATTTAATTTGTTAGG - Intergenic
1005141647 6:22638449-22638471 AATTTCCCATTTCATACTTTTGG + Intergenic
1005200190 6:23335952-23335974 AATTTTTCACTTAATATTTTTGG + Intergenic
1005454909 6:26010078-26010100 AATTTACCGTTTATTATTTTTGG - Intergenic
1005515708 6:26552151-26552173 GAATTTTCATTTAATATTTTTGG - Intergenic
1005615871 6:27572783-27572805 GACTTCCCTTTTATTATATTGGG - Intergenic
1005923396 6:30419376-30419398 AGTTTCCCATTTAATATATGAGG - Intergenic
1006206719 6:32350637-32350659 ATCTTCCTGTTTAATATGTTAGG + Intronic
1006937086 6:37725988-37726010 ATATCCCCATTGAATATTTTGGG + Intergenic
1007003644 6:38338351-38338373 GATTTTCCATTTAATATTTTTGG + Intronic
1007297907 6:40841688-40841710 AACTTCATATATAATAATTTAGG - Intergenic
1007878283 6:45132087-45132109 AATTTTCTATTTAATATTTTTGG + Intronic
1007919968 6:45598139-45598161 AAATCCCCATTTAATACTTTGGG - Intronic
1008067485 6:47064621-47064643 AATTTTCCATTTAATATTTTTGG + Intergenic
1008086854 6:47254375-47254397 AATTTCCCATTTAGTATTTTCGG + Intronic
1008194394 6:48500264-48500286 AACTTCTGTTTTAATACTTTTGG - Intergenic
1008554310 6:52659945-52659967 ATTTTTCCATTTAATATTTTTGG - Intergenic
1009255178 6:61381820-61381842 AATTTCCAAGTGAATATTTTGGG + Intergenic
1009485932 6:64221649-64221671 AATTTTCTATTTAATATTTTTGG - Intronic
1009572533 6:65405963-65405985 AAATTCATGTTTAATATTTTAGG + Intronic
1009594264 6:65714288-65714310 AAAATCCCATTTATTATATTGGG - Intergenic
1009676647 6:66832479-66832501 ACTTTTTCATTTAATATTTTTGG - Intergenic
1009894798 6:69734740-69734762 AACTTCCTATTGCATATTTCTGG + Intronic
1009898991 6:69788713-69788735 TAATTCACATTTTATATTTTGGG - Intronic
1010056154 6:71567632-71567654 AGTTTTCCATTTAATATTTTTGG - Intergenic
1010408676 6:75535742-75535764 AATTTTCCATTTAATATTTGTGG + Intergenic
1010412834 6:75580350-75580372 AATTTTCCATTTTATATTTCCGG + Intergenic
1010452471 6:76018422-76018444 AATTTTCAATTTAATATTTTTGG + Intronic
1010478806 6:76323918-76323940 GATTTTTCATTTAATATTTTAGG + Intergenic
1010688803 6:78883721-78883743 AATTTTACATTTAATATTTTTGG - Intronic
1010953543 6:82065134-82065156 AATTTGCCAAATAATATTTTAGG - Intergenic
1010968912 6:82243391-82243413 AAATTTTCATTTAATATTTTTGG - Intronic
1010989254 6:82461007-82461029 AACATCTCCTTCAATATTTTAGG - Intergenic
1011691549 6:89874778-89874800 AACTTCTCAGTTAATAATCTAGG + Intergenic
1012011819 6:93797701-93797723 AACTACCCTTTCAATCTTTTGGG - Intergenic
1012019190 6:93894734-93894756 AATTTTCCATTGAATATTTTTGG - Intergenic
1012242873 6:96894110-96894132 AGTTTTTCATTTAATATTTTTGG - Intronic
1012257377 6:97049506-97049528 AATTTTCTATTTAATGTTTTTGG + Intronic
1012564642 6:100633134-100633156 AATTTTTCATTTAACATTTTTGG - Intronic
1012578323 6:100830093-100830115 AACTTATAATTTAATATTTTCGG + Intronic
1012663866 6:101941888-101941910 AACTGTCCAATTAATACTTTGGG + Intronic
1012667765 6:101998248-101998270 AATTTTCCATTTAGTATTTGTGG + Intronic
1012708601 6:102567734-102567756 AATTTTCCATTTAATATTTTGGG + Intergenic
1012727170 6:102828960-102828982 AACTTCCGTTTCAATATATTAGG - Intergenic
1012912111 6:105129864-105129886 TATTTTCCATTTAATATTATTGG + Intronic
1012957387 6:105586115-105586137 AACTGCCCATTTATTCTGTTGGG - Intergenic
1013096980 6:106954268-106954290 AAAGTTCCATTTCATATTTTTGG - Intergenic
1013218449 6:108053259-108053281 AATTTTCCATTTAATATTTTTGG + Intronic
1013219216 6:108062411-108062433 AATTTTCCATTTAATATTTTTGG + Intronic
1013438895 6:110141049-110141071 AATTTTCCATTTAATATTTTTGG + Intronic
1013675057 6:112449883-112449905 AACTTCTAATTTAATTTTATTGG + Intergenic
1013708067 6:112863083-112863105 AATTTTCCATTTAATATTTTTGG + Intergenic
1013861030 6:114635576-114635598 ATTTTCCCATTTCATATTTTTGG - Intergenic
1013938589 6:115632166-115632188 AATTTTTTATTTAATATTTTTGG + Intergenic
1013940471 6:115655215-115655237 AAATTTCCCTTTATTATTTTAGG + Intergenic
1014082548 6:117304528-117304550 AATTTTCCTTTAAATATTTTTGG - Intronic
1014267283 6:119294499-119294521 AACTTCCCTTTTAAATCTTTAGG + Intronic
1014344988 6:120257813-120257835 AACTTCTTATTTAATAAATTAGG + Intergenic
1014510386 6:122313946-122313968 AATTTTGCATTTAATATTTTTGG + Intergenic
1014769264 6:125442888-125442910 AAATTCCCATTAAATATTAGAGG + Intergenic
1015023775 6:128508637-128508659 AATTTTTCATTTAATATTTTTGG - Intronic
1015041417 6:128724833-128724855 AACTGCCAATTTAATATGGTAGG - Intergenic
1015182659 6:130377711-130377733 TACTTACCATGTACTATTTTAGG + Intronic
1015738314 6:136425221-136425243 AGTTTTCCATTTAATATTTTTGG + Intronic
1015992109 6:138956207-138956229 AACTTCCTCTTTATTATTGTGGG - Intronic
1016031155 6:139339801-139339823 AAAATCCCATGTAATATTGTTGG + Intergenic
1016141704 6:140620535-140620557 AACTTCCCACTCACTATTATTGG - Intergenic
1016141929 6:140623527-140623549 AATTTTCCACTTAATATTTTTGG - Intergenic
1016758229 6:147710355-147710377 AATTTTCCATTGAATATTTTTGG - Intronic
1016796576 6:148124442-148124464 AAATTTCCATTTAATTTTTTTGG - Intergenic
1016796941 6:148128295-148128317 AATTTTCCATTTGATATTTTTGG + Intergenic
1016817766 6:148319456-148319478 AGTTTTCCATTTAATATTTTAGG - Intronic
1016824701 6:148377446-148377468 AACTTTCCATTTATTCCTTTTGG + Intronic
1016876037 6:148865857-148865879 AACTTGACTTTGAATATTTTGGG + Intronic
1017320748 6:153090305-153090327 AATTTTCGATTTAATATTTTTGG - Intronic
1017589493 6:155963150-155963172 AATTTTCCACTTAATATTTGTGG - Intergenic
1017681008 6:156863680-156863702 CACTTCCTATTTCATACTTTTGG - Intronic
1018158802 6:161016599-161016621 CTTTTCCCATTGAATATTTTTGG + Intronic
1018205986 6:161437429-161437451 TATTTTCCATTTAATATCTTCGG + Intronic
1018470448 6:164091808-164091830 AATTTTCCATTTAATATCTTTGG - Intergenic
1018590106 6:165410225-165410247 AAGTTCACCTTTAATATTTTAGG - Intronic
1018615204 6:165680213-165680235 AAATTCCTCTGTAATATTTTGGG + Intronic
1019424333 7:966746-966768 AATTTTCCACTTAGTATTTTTGG - Exonic
1020349882 7:7207965-7207987 AGTTTTCCATTTAATATTTTTGG - Intronic
1020479846 7:8645348-8645370 AACCTTCCATATAATATATTTGG - Intronic
1020492637 7:8807596-8807618 ACTTTCCCATTGAATATATTTGG + Intergenic
1020503608 7:8955290-8955312 AAATTTCCATTTAATATTTTGGG + Intergenic
1020643976 7:10791204-10791226 AATTTTCCACTTAATATTTTTGG + Intergenic
1020687500 7:11313735-11313757 AATTTTCCATTTAGTATTTTCGG + Intergenic
1020984148 7:15111277-15111299 AACTTTGCATTTCATCTTTTAGG - Intergenic
1021041481 7:15867694-15867716 AACTACCCATTTAAAATTTTTGG + Intergenic
1021194792 7:17663140-17663162 AAGCTCCCAATAAATATTTTTGG - Intergenic
1021309776 7:19079779-19079801 AATTTTGCTTTTAATATTTTGGG - Intronic
1021332258 7:19353244-19353266 AATTTTTCATTTAATGTTTTTGG - Intergenic
1021408028 7:20296779-20296801 AATTTTCCATTTAATATTTTTGG + Intergenic
1021511551 7:21438674-21438696 AATATTCCATTTAACATTTTTGG - Intronic
1021846043 7:24763618-24763640 AAATTTCCATTTAATATTTTTGG + Intergenic
1022229825 7:28403798-28403820 AACTTTCTATTTATTATCTTCGG - Intronic
1022247128 7:28571241-28571263 AATTTTCCTTTTAATATTTTTGG + Intronic
1023046967 7:36218644-36218666 AATTTTCCATTTAATATTTTTGG + Intronic
1023405112 7:39825664-39825686 AACTTTTCATTTAATATTTATGG + Intergenic
1023461451 7:40401940-40401962 AATTTCTCTCTTAATATTTTGGG + Intronic
1023678804 7:42661602-42661624 AATTTTCCATTTAATATTTTTGG + Intergenic
1024311047 7:47969513-47969535 GACTTCCCCTTTGAGATTTTTGG - Intronic
1024484305 7:49899365-49899387 AATTTTCCATTTAATGTTTTTGG + Intronic
1024570715 7:50721209-50721231 AATTGTCCATTTAATATTTTTGG - Intronic
1024765858 7:52658559-52658581 CATTTTCCATTTAAAATTTTTGG - Intergenic
1025064174 7:55838888-55838910 AATTTTTCATTTAATATATTTGG - Intronic
1026114206 7:67482699-67482721 AATTTTCCATTTACTATTTTCGG + Intergenic
1026407174 7:70078409-70078431 AGTTTTCCATGTAATATTTTTGG + Intronic
1026652891 7:72230899-72230921 AATTTTCCATCTGATATTTTTGG - Intronic
1027343122 7:77230986-77231008 AATTTTCCACTTAATATTTTTGG - Intronic
1027547941 7:79554107-79554129 AATTTTCCATTTAATATTTCTGG + Intergenic
1027630684 7:80601144-80601166 AGCTTTCAAATTAATATTTTAGG - Intronic
1027720554 7:81736208-81736230 AATTTTTTATTTAATATTTTTGG - Intronic
1028067069 7:86399559-86399581 AATTTTTCACTTAATATTTTTGG - Intergenic
1028133853 7:87206692-87206714 AGTTTTCCATTTAATATTTTTGG + Intronic
1028397775 7:90391238-90391260 ACTTTTCCATTTAATATTTTTGG + Exonic
1028397824 7:90391774-90391796 ACTTTTCCATTTAATATTTTTGG + Intronic
1028646351 7:93101272-93101294 CAGTACCCATTTAATTTTTTTGG - Exonic
1028669318 7:93383140-93383162 AACTTGCCACTTAATATTTATGG + Intergenic
1028948333 7:96605795-96605817 AATTTTCTATTTAATATTTTTGG - Intronic
1029339401 7:99930765-99930787 AATTTTCCATTTAATATTTTTGG - Intergenic
1029826314 7:103199253-103199275 AACTTTTCGTTTAATATTTTTGG - Intergenic
1029938716 7:104456906-104456928 AATTTTCTATTGAATATTTTTGG + Intronic
1030089088 7:105841417-105841439 GATTTTCCACTTAATATTTTTGG - Intronic
1030134565 7:106234474-106234496 AAATTCAGTTTTAATATTTTTGG - Intergenic
1030253459 7:107478475-107478497 AATTTTCCATTTAATATTTTTGG - Intronic
1030731934 7:113000219-113000241 AATTTTCCATTTAATATTTTTGG - Intergenic
1030777528 7:113552691-113552713 AATTTCCCATTTAATAGTTTTGG - Intergenic
1030919712 7:115367099-115367121 GATTTTCCATTTAACATTTTTGG + Intergenic
1030940614 7:115643262-115643284 TATTTCACATTTAATATTTCTGG - Intergenic
1031039545 7:116824904-116824926 AACTTCCCACATAATAATTCTGG - Intronic
1031095559 7:117415244-117415266 AATTTTTTATTTAATATTTTTGG - Intronic
1031183868 7:118451188-118451210 CACTTCCAATTTAATTATTTTGG + Intergenic
1031376278 7:121030374-121030396 AGTTTTCAATTTAATATTTTTGG - Intronic
1031537320 7:122951311-122951333 AATATTCCATTTAATATTTTTGG + Intergenic
1032262591 7:130348840-130348862 AATTTTCCGTTTAATGTTTTTGG - Intronic
1033013617 7:137648700-137648722 GATTTTCCATTTAATATTTTTGG + Intronic
1033022943 7:137745420-137745442 AATTTTCCATTTAATATTTTTGG - Intronic
1033298691 7:140165514-140165536 AATATTTCATTTAATATTTTTGG - Intronic
1033806971 7:144965424-144965446 AACTTCCCATTTTATATACGGGG + Intergenic
1033880352 7:145874225-145874247 AAGTTTCCATTGAATATTTCTGG - Intergenic
1033969489 7:147022182-147022204 AGCTTCCCATTTTATTTCTTTGG + Intronic
1034290443 7:149926862-149926884 ATCTTCGCATTTATTTTTTTCGG - Intergenic
1034660629 7:152765979-152766001 ATCTTCGCATTTATTTTTTTCGG + Intronic
1034842898 7:154416042-154416064 AATTTTCTATTTAATACTTTTGG - Intronic
1035052369 7:156006646-156006668 AATTTTCCATTTAAAATTTTTGG - Intergenic
1035174940 7:157043868-157043890 AATTCCACTTTTAATATTTTAGG + Intergenic
1035533825 8:375960-375982 AATTTTTCATTTAATGTTTTTGG + Intergenic
1036172628 8:6503992-6504014 ATTTTTCCATTTAATATTTTTGG - Intronic
1036613141 8:10367023-10367045 AATTTTCCATTCAATATTTTTGG - Intronic
1036699810 8:11005271-11005293 AATTTCCCATTTAATATTTTTGG + Intronic
1036992497 8:13614454-13614476 GATTTTCCATTTAGTATTTTTGG + Intergenic
1037002542 8:13737474-13737496 AATTTTTCATTTAATATTTTTGG + Intergenic
1037157096 8:15715590-15715612 AATTTTCCATTGAATATTTTTGG + Intronic
1037241406 8:16782971-16782993 AAATTCCAAGTTATTATTTTTGG - Intergenic
1037266711 8:17071053-17071075 AACTTTCTATTTAATGTTTTTGG + Intronic
1037417759 8:18669696-18669718 AATTTTCCTTTTAATGTTTTTGG + Intronic
1037500817 8:19483952-19483974 AATTTTCCATTTAATATTTTTGG - Intronic
1037797338 8:22007361-22007383 AACTCACCATTTAATATGTTAGG - Intergenic
1037854224 8:22358954-22358976 AATTTTCCATTTAATAGTTTTGG + Intergenic
1037896007 8:22656282-22656304 AACTTCACATGTGTTATTTTGGG - Intronic
1037981192 8:23255553-23255575 AATTTTCCACTTATTATTTTTGG - Intronic
1038060423 8:23906192-23906214 AATTTTCCATTCAATATTTTTGG - Intergenic
1038469879 8:27806086-27806108 AAATTTCCATGCAATATTTTTGG - Intronic
1038734078 8:30153472-30153494 AATTTTCTATTTAATATTTTTGG - Intronic
1038863890 8:31417369-31417391 ACCTTCCCATTTATCATTTCTGG - Intergenic
1039023931 8:33237161-33237183 AATTTTCCATTCAATATATTAGG - Intergenic
1039312151 8:36328435-36328457 AACTTCCAAATTTATAATTTAGG + Intergenic
1040523205 8:48195413-48195435 AATTTTCCATTTAATATTTTTGG - Intergenic
1040615940 8:49038527-49038549 AAGTTCCTATTTTATATTTTTGG - Intergenic
1040778540 8:51077104-51077126 AATTTTCTAATTAATATTTTAGG + Intergenic
1041127834 8:54663009-54663031 AATTTTACATTTAATATTTTTGG - Intergenic
1041292498 8:56320361-56320383 AAATTCCCATCTAATAATCTAGG - Exonic
1041336639 8:56792724-56792746 AACTTTATATTTAATATTTTGGG - Intergenic
1041512793 8:58670275-58670297 AATTTTCCATTTAATATTTTTGG - Intergenic
1041559688 8:59201902-59201924 AAATTCCCGTCTAATAATTTTGG - Intergenic
1041591647 8:59593522-59593544 AATTTTCCGTTTAGTATTTTCGG - Intergenic
1041627801 8:60050572-60050594 ATATTCCCCTTCAATATTTTGGG - Intergenic
1041646489 8:60257974-60257996 AATTTTCCATTTAATATTTTTGG - Intronic
1041692014 8:60697490-60697512 AACAACCCATTTATTATTTTGGG - Intronic
1041746595 8:61214074-61214096 AAATTCCCACCTAATAATTTTGG + Intronic
1041856021 8:62456125-62456147 AATTTTTCATTTAATATTTTTGG + Intronic
1041944229 8:63423925-63423947 AATTTTCTATTTAATATTTTTGG + Intergenic
1042105380 8:65320802-65320824 AAGTTTCCATGTAAGATTTTGGG - Intergenic
1042244330 8:66695507-66695529 AATGTTCCATTTAATATTTTTGG + Intronic
1042276157 8:67007325-67007347 GATTTTCCATTAAATATTTTTGG - Intronic
1042527381 8:69777595-69777617 AATTTTCCATTTAATATTTTTGG - Intronic
1042628342 8:70786005-70786027 AATTTCCCTTTTAATTTCTTCGG + Intronic
1042966023 8:74352912-74352934 AAAATCCCATTTAAGTTTTTTGG + Intronic
1043038436 8:75228572-75228594 AATTTTCCATTTAATATTTTTGG - Intergenic
1043192246 8:77240411-77240433 AACATTCCATTTAATATTTTTGG - Intergenic
1043387687 8:79764823-79764845 ATCTTAACATTTAGTATTTTTGG - Exonic
1043453862 8:80394636-80394658 GATTTTCCATTTAATATTTTTGG + Intergenic
1043479919 8:80642579-80642601 AATTCTCCATTTAACATTTTTGG + Intronic
1043644994 8:82506788-82506810 ATCTTCCCAGATAACATTTTAGG + Intergenic
1043865689 8:85372686-85372708 AAGTTTCCATTTAATAATTTTGG - Intronic
1044074526 8:87802710-87802732 AATTTTCCATTTAATATTTTTGG + Intergenic
1044323834 8:90837506-90837528 GATTTTCCATTTAATATTTTTGG + Intronic
1044485700 8:92751136-92751158 TACTTCCCTTGGAATATTTTGGG + Intergenic
1044789117 8:95828431-95828453 AACTTCCCATTTATATTTCTAGG + Intergenic
1044866779 8:96578880-96578902 AACTTCCCAACTAATAAATTTGG + Intronic
1044951535 8:97440175-97440197 AATTTTCCATTTAATATTTTTGG + Intergenic
1045549556 8:103158808-103158830 AATTTTCCATTTAATATTTTTGG + Intronic
1045685704 8:104709156-104709178 AAATTCTCATCTAATGTTTTTGG - Intronic
1045778661 8:105837327-105837349 AACTTTCAATTTGCTATTTTTGG - Intergenic
1045941025 8:107738627-107738649 AATTTTCTATTTAATATTTTTGG - Intergenic
1045985577 8:108246215-108246237 AATTTTCCATTTAATATTTTTGG + Intronic
1046079251 8:109351198-109351220 TATTTCCCATTTTATATTCTTGG + Intergenic
1046252183 8:111646522-111646544 AATTTTCCATTTAATATTTTTGG + Intergenic
1046254895 8:111682874-111682896 AATTTTCCATTTAATATTTTTGG + Intergenic
1046342148 8:112873294-112873316 AACATCCAATTTTAAATTTTGGG - Intronic
1046422793 8:114006585-114006607 AATTTCCTATTTAATATTTTTGG + Intergenic
1046460342 8:114525697-114525719 AATTTTTCATTTAATATTTTTGG - Intergenic
1047469792 8:125158983-125159005 AATTTCCTGTTTAATAATTTTGG - Intronic
1047695672 8:127401338-127401360 AACTGCCCAGGTAATATGTTTGG + Intergenic
1047812603 8:128426690-128426712 ACCTTCCAGTTTACTATTTTGGG - Intergenic
1047957316 8:129985536-129985558 TACTTCTCATTTACTATTTCTGG - Intronic
1048500712 8:134972354-134972376 AATTTTCCATTTAATATTTTTGG - Intergenic
1048554937 8:135466443-135466465 AGCTTTCAATTTAATGTTTTTGG - Intronic
1048718954 8:137300257-137300279 ATCTTCCCAGTTAATCTTTTAGG + Intergenic
1049500840 8:142964487-142964509 AAATTCCCACCTAATAATTTTGG - Intergenic
1049589994 8:143454029-143454051 AATTTTCCATTTAATATTTTTGG - Intronic
1049727077 8:144152227-144152249 ATTTTTCTATTTAATATTTTTGG + Intronic
1049839254 8:144760403-144760425 AAATTCCCACCTAATAATTTTGG + Intergenic
1049861185 8:144900855-144900877 AACCTCCATTTTTATATTTTGGG + Intronic
1050471677 9:5998605-5998627 AACTTTGCATTTAATTTTTTTGG + Intronic
1050777137 9:9278422-9278444 ATCTTCTCATATATTATTTTAGG - Intronic
1050820999 9:9879896-9879918 AACTTCCAATATAATTTTCTTGG - Intronic
1051079903 9:13281625-13281647 AAAATGCCATTTAAAATTTTAGG - Intergenic
1051104360 9:13561956-13561978 AATTTTCCATTTAATATTATTGG + Intergenic
1051115029 9:13684871-13684893 GATTTTCCATTTAACATTTTTGG - Intergenic
1051137809 9:13942797-13942819 AATTTTCCATTTGATATTTTTGG - Intergenic
1051240957 9:15055172-15055194 AACTACCCATTTTCTTTTTTTGG + Intergenic
1051330535 9:16020832-16020854 AAATTTCCATGTAATATTTTTGG + Intronic
1051441166 9:17084770-17084792 AATTTCCCATTTAACACTTGTGG - Intergenic
1051453358 9:17223227-17223249 AACTTATCATTTAATATTTTTGG + Intronic
1051549908 9:18316315-18316337 AAATTCCCACCTAATAATTTTGG - Intergenic
1051597212 9:18837125-18837147 GACTTTCCATTTATTCTTTTAGG + Intronic
1051611928 9:18969688-18969710 ATCTACACACTTAATATTTTTGG + Intronic
1051772311 9:20592134-20592156 ATCTTCCATTTTAATTTTTTGGG - Intronic
1051955687 9:22690808-22690830 AATTTCTCATTTATTAATTTTGG + Intergenic
1052042965 9:23761127-23761149 AATATTCCATTTTATATTTTTGG + Intronic
1052086145 9:24268169-24268191 AATTTTCCATTTAATATGTTTGG + Intergenic
1052193173 9:25681479-25681501 GACTTTCCATTTAATATTTTTGG + Intergenic
1052430557 9:28360992-28361014 ATTTTTCCATTTAATATTTTTGG - Intronic
1052595831 9:30557398-30557420 AAATCTCCATTTAATATTTTTGG - Intergenic
1052963075 9:34317513-34317535 AATTTTTCACTTAATATTTTTGG - Intronic
1054738014 9:68775660-68775682 AATTTTCCATTTAATATTTTTGG + Intronic
1054854708 9:69885968-69885990 AATTTTCTGTTTAATATTTTCGG - Intronic
1054884111 9:70177454-70177476 AACTTTCCATGTAATATTTTTGG + Intronic
1055127379 9:72734191-72734213 AATTTTCCATTAAATATTTTTGG + Intronic
1055131942 9:72785796-72785818 AATTTTCCATTTAATATTTTTGG + Intronic
1055159794 9:73112256-73112278 ATTTTTCCATTTAATATTTTTGG - Intergenic
1055184787 9:73437925-73437947 AATTTTCCATTTAGTATTTTTGG - Intergenic
1055331749 9:75191304-75191326 GATTTCCCATTTACTATTTCTGG - Intergenic
1055546055 9:77374577-77374599 AATTTTCCATTTAATATTTTTGG + Intronic
1055863513 9:80784208-80784230 AACTTCCCACTTTTTATTTGTGG - Intergenic
1056336058 9:85570287-85570309 AATTTTCCATTTAATGTTTTTGG + Intronic
1056500098 9:87200422-87200444 CCCTTCTCATTAAATATTTTTGG - Intergenic
1056526150 9:87444712-87444734 AACTCTCCATTTTTTATTTTTGG + Intergenic
1056596005 9:88008065-88008087 AATTTTCCATTTAATATTTTTGG - Intergenic
1056719776 9:89061677-89061699 AATTTTCCATTTATTGTTTTTGG - Intronic
1056961008 9:91123142-91123164 AATTTTCCACTTAATATTCTTGG - Intergenic
1057108085 9:92439995-92440017 AATTTTCCATTTAATATTTTTGG - Intronic
1057451719 9:95168482-95168504 ATTTTTTCATTTAATATTTTTGG - Intronic
1057593839 9:96397485-96397507 AACTTGACAATTAATGTTTTTGG + Intronic
1057738911 9:97694276-97694298 AAATTTCCATTTCATATTTTGGG + Intronic
1058261698 9:102841313-102841335 AATTTTCCATTTAATATTTTTGG + Intergenic
1058387541 9:104456147-104456169 CACTTCCCTTTTATTATTTTAGG + Intergenic
1059055331 9:110973156-110973178 AATTTTTCATTTAATATTTTTGG + Intronic
1059110495 9:111554736-111554758 AATTTTCTATTTAAAATTTTGGG + Intronic
1059242879 9:112822705-112822727 AATTTTCCATGTCATATTTTTGG - Intronic
1059616388 9:115956038-115956060 CTTTTCCCATTTAATATTTTAGG - Intergenic
1059675970 9:116539802-116539824 AATTTTCTATTTAATATTTTTGG + Intronic
1060394875 9:123308839-123308861 AATTTTCTATTTAATATTTTTGG + Intergenic
1060800385 9:126540969-126540991 AATTTTCCATTTAATATTTTTGG + Intergenic
1061440742 9:130601763-130601785 AAATTTCCATTTAATAATTTCGG - Intronic
1062666967 9:137679270-137679292 AATTTTTCATTTAATATTTTTGG + Intronic
1185947864 X:4398062-4398084 AACTTAACTTTTAACATTTTGGG + Intergenic
1186747077 X:12580949-12580971 AATTTTACATTTAATATTTTTGG + Intronic
1186847846 X:13548815-13548837 AATTTTCCATTTAATATTTTTGG - Intergenic
1187293349 X:17976158-17976180 AACTTTTCATTTAAAGTTTTTGG - Intergenic
1187442850 X:19335595-19335617 AATTTTCTGTTTAATATTTTTGG + Intergenic
1187486618 X:19710129-19710151 AATATTCCATTTAATATTTTTGG - Intronic
1187696449 X:21926720-21926742 CACTGCCCAATTAATACTTTGGG + Intergenic
1187772298 X:22713370-22713392 AATTTTACATTTAATATTTTCGG - Intergenic
1188171362 X:26931871-26931893 AGCTTCCCATTAAAGATTTCAGG + Intergenic
1188369178 X:29348033-29348055 AATTTCCCATTTAATATTGTTGG + Intronic
1188478763 X:30615298-30615320 AATCTTCCATTTAATATTTTTGG - Intergenic
1188600316 X:31955695-31955717 AACTTCCAAATTTATAGTTTGGG + Intronic
1188606305 X:32035371-32035393 TACTTCTCATTTAATCATTTTGG + Intronic
1188967283 X:36570102-36570124 AATTTTCCATTTGATAATTTTGG + Intergenic
1189378207 X:40482338-40482360 AATTTTCCATGTAATCTTTTCGG + Intergenic
1189737156 X:44083299-44083321 AATTTTCCATTTAATATTTTTGG - Intergenic
1189841908 X:45088697-45088719 CACTTCAAATTTCATATTTTGGG - Intronic
1189844410 X:45119864-45119886 AAATTCACATTTAATATTACAGG + Intergenic
1189882966 X:45511113-45511135 GACCTCACATTTAATTTTTTAGG + Intergenic
1190135807 X:47796674-47796696 AATGTTCTATTTAATATTTTTGG - Intergenic
1190149263 X:47929598-47929620 AAATTTCCCTTTGATATTTTTGG + Intronic
1190166615 X:48078390-48078412 AAATTCCCACCTAATAATTTTGG + Intergenic
1190487848 X:50946496-50946518 AATTTTTCATTTAATATTTTTGG - Intergenic
1190577171 X:51851819-51851841 AATTTCCCATTTAATATTTTTGG + Intronic
1190794360 X:53727039-53727061 AATTTTCCATTTAATATTTTTGG - Intergenic
1192056324 X:67777475-67777497 AAGTTCCCATTAGATTTTTTGGG - Intergenic
1192590886 X:72358622-72358644 AATTTTCCATTTAATATTTTTGG + Intronic
1193113121 X:77749703-77749725 AATTTTCCGTTTAATATTTTTGG - Intronic
1193498797 X:82246523-82246545 AACCTCCTATTTAATATATAGGG - Intergenic
1193520831 X:82527478-82527500 AAATTTTCATTTAATATTTTTGG + Intergenic
1193660133 X:84247512-84247534 AACTTTCCATGTAATATTTTTGG - Intergenic
1193965305 X:87977380-87977402 AACTTTGCATTTTATTTTTTGGG + Intergenic
1194050985 X:89068776-89068798 AATTTTTTATTTAATATTTTTGG + Intergenic
1194132454 X:90097715-90097737 TACTTCCCGTTTAAAATTTCTGG + Intergenic
1194221414 X:91197188-91197210 AATTTCCTATTTAACATGTTTGG - Intergenic
1194681147 X:96854821-96854843 AATTTTCCATTTAATATTTTTGG + Intronic
1194693850 X:97020833-97020855 ATTTTTCCATTTAATATCTTTGG + Intronic
1195012634 X:100748176-100748198 AATTTTCCATTTAATATTCTAGG - Intergenic
1195230970 X:102846673-102846695 TACTTCCAATTTTATATTTGTGG + Intergenic
1195262611 X:103148162-103148184 AATTTTCCATTTAATATTTTTGG - Intergenic
1195282706 X:103351963-103351985 AAACTCCCATTTAATTTTATGGG - Intergenic
1195397687 X:104428867-104428889 AATTTTCTACTTAATATTTTTGG + Intergenic
1195496784 X:105545437-105545459 TACTTCCCGTTTACTAGTTTTGG - Intronic
1195623479 X:106983137-106983159 CACTTCCGATTTTAGATTTTTGG + Intronic
1195718603 X:107843487-107843509 TAGTTCCCCTTTCATATTTTAGG + Intronic
1195956926 X:110341445-110341467 AATTTTCCATTTAATATTTTTGG - Intronic
1196187424 X:112759573-112759595 AATTTTCCATTCAATATTTTTGG - Intergenic
1196221502 X:113116497-113116519 AATTTTCCATTTAATGTTTCTGG + Intergenic
1196255254 X:113510645-113510667 AACTTCCAATTTGATTTTTAAGG - Intergenic
1196665575 X:118312371-118312393 AACTTTACATTTTATATTATTGG - Intergenic
1196674306 X:118403183-118403205 GATTTTCCATTTAATATTTTTGG + Intronic
1196913792 X:120511543-120511565 AATTTTCCATGTAATATTCTTGG - Intergenic
1197233122 X:124028468-124028490 AATTTCCTACTGAATATTTTTGG + Intronic
1197290041 X:124644540-124644562 AACTTGCCATTTCAAAATTTTGG + Intronic
1197336680 X:125217396-125217418 AATTTTCTATTTAATCTTTTTGG + Intergenic
1197429216 X:126340066-126340088 AATTTCCCATTTTATATTTTTGG - Intergenic
1197447550 X:126569110-126569132 AATTTTCCATTTAATATTTTTGG + Intergenic
1197621151 X:128750704-128750726 ATCTGCCCATTTTATTTTTTTGG - Intergenic
1197627487 X:128818752-128818774 AATTTCCCATTTAATAATTTTGG - Intergenic
1197743833 X:129916936-129916958 AAATTACCATTAAATATTATTGG - Intronic
1198004411 X:132477835-132477857 ATCTTTCCCATTAATATTTTAGG + Intronic
1198386118 X:136131117-136131139 AATTTTCCATTTAATATTTTTGG - Intergenic
1198736444 X:139790546-139790568 TACATCCCATTTAATTTATTGGG - Intronic
1199013135 X:142780248-142780270 CACTTCCCATTTCTCATTTTAGG - Intergenic
1199252908 X:145684845-145684867 AAATTTTCATTTAATTTTTTGGG - Intergenic
1199483589 X:148324959-148324981 AACTTTCTATTTAGAATTTTTGG - Intergenic
1200041571 X:153374555-153374577 AAGTTTCCACTTAATATTTTTGG - Intergenic
1200041621 X:153375025-153375047 AATTTTTCATTTAATATATTTGG + Intergenic
1200557924 Y:4660942-4660964 AATTTCCTATTTAACATATTTGG - Intergenic
1201633187 Y:16092632-16092654 TTATTTCCATTTAATATTTTTGG - Intergenic
1202040917 Y:20682780-20682802 AACTTCCATTTTAATAACTTTGG - Intergenic