ID: 1129647443

View in Genome Browser
Species Human (GRCh38)
Location 15:77449515-77449537
Sequence TGATATGCATACAATTTAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 205}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129647443_1129647446 23 Left 1129647443 15:77449515-77449537 CCAGTTAAATTGTATGCATATCA 0: 1
1: 0
2: 0
3: 19
4: 205
Right 1129647446 15:77449561-77449583 ACCTCTTTATACCAGTTCTCTGG 0: 1
1: 0
2: 0
3: 9
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129647443 Original CRISPR TGATATGCATACAATTTAAC TGG (reversed) Intronic
906310976 1:44754237-44754259 TGATATCCAGGAAATTTAACTGG + Intronic
906870183 1:49470753-49470775 TAATTTGCATACAATTGAAGTGG + Intronic
909671326 1:78191878-78191900 TCATATGCAGAAAATTTAACTGG - Intergenic
909671573 1:78194947-78194969 TGATAAGAATACAAAGTAACTGG - Intergenic
909752807 1:79184657-79184679 AGATATGAATACAATTGAAATGG + Intergenic
910571019 1:88702980-88703002 TCATAAGCAGACACTTTAACAGG - Intronic
910696503 1:90023996-90024018 TCACATGCATACAAATCAACAGG - Intronic
911578487 1:99606493-99606515 TGATATGCATATAACATCACTGG + Intergenic
911757176 1:101572099-101572121 AAATATGCATAAAATTTAAAAGG - Intergenic
913515100 1:119598258-119598280 AGCTATCCATACAATTTAATAGG + Intergenic
914424027 1:147558034-147558056 TGGTATACATACAGTTTGACTGG - Intronic
916053769 1:161053530-161053552 AATTATGCATACAATTTAAGAGG - Intronic
916851901 1:168712492-168712514 TAATTTACATACATTTTAACTGG + Intronic
917955666 1:180095008-180095030 AGATATGTAAACAATTTCACAGG - Intronic
918723012 1:187878161-187878183 TGATTTGCATTCAAAATAACAGG - Intergenic
918956557 1:191216400-191216422 TAAAATGTATTCAATTTAACTGG + Intergenic
921591735 1:217012017-217012039 TGAAATGCATGCAATTGAAAAGG + Intronic
921717200 1:218429915-218429937 TGTTAAGCATACAACTCAACTGG + Intronic
1063074040 10:2696399-2696421 AGATCTGCATAAAAATTAACAGG + Intergenic
1063303630 10:4876507-4876529 TTATATGCATAGAATGTAAAAGG + Intergenic
1064325008 10:14341578-14341600 TTATATGAAAACAATTTAAAAGG - Intronic
1064801411 10:19077590-19077612 TGATATGGATACTTTCTAACAGG + Intronic
1068700363 10:60013365-60013387 TGATATGGATAAAATTTTAGTGG - Intergenic
1068717621 10:60205685-60205707 TGATATGCAAACAAACTAGCTGG + Intronic
1069130464 10:64695087-64695109 TGTTAAACATACAATTTTACAGG - Intergenic
1072468413 10:95689298-95689320 TAATATGCATACACATTACCTGG - Intronic
1076457854 10:130614832-130614854 TTATCTGCATACAAGTTAACCGG + Intergenic
1077693729 11:4374526-4374548 TGATATAAATACATTTTAAATGG + Intergenic
1080142215 11:28935934-28935956 TGGTATGCATACAAATTAGTAGG - Intergenic
1082251478 11:49986013-49986035 TGATATAACTACAATTTACCAGG - Intergenic
1083383999 11:62294108-62294130 TGACATGCATTCTATTTCACAGG + Intergenic
1086166144 11:83780959-83780981 TAATGTGCATACAAGTTATCTGG + Intronic
1086516171 11:87615825-87615847 TAATATGCATACAAATCACCTGG - Intergenic
1086888450 11:92228093-92228115 TGATATGAAGACATTATAACTGG - Intergenic
1088560415 11:111109951-111109973 TAACATGCATACAAATTACCTGG + Intergenic
1090104597 11:123838980-123839002 TGATATGTATTAAATTTAAGTGG - Intergenic
1093119769 12:15254838-15254860 TTATAAGCATTCAATTAAACTGG - Intronic
1094651171 12:32377145-32377167 TAATATGCATGCAAATTACCTGG - Intronic
1095559441 12:43548399-43548421 TGATCTGCAAACAATTCATCTGG + Intronic
1100588736 12:96004350-96004372 AGGTATGCAGATAATTTAACAGG - Intronic
1100763002 12:97830555-97830577 TGCTATGAATACAATAAAACAGG + Intergenic
1103048868 12:117761658-117761680 TAACATGCATACGATGTAACAGG - Intronic
1103048872 12:117761754-117761776 TAACATGCATACGATGTAACAGG - Intronic
1103767970 12:123296526-123296548 ATATATGCATGCAATTTATCTGG - Intronic
1110124799 13:71929465-71929487 TGATATGAATACAATGTATTGGG + Intergenic
1110576931 13:77068201-77068223 TGATATACATACTATTCAAATGG + Intronic
1110670776 13:78174517-78174539 TTATTTGCTTATAATTTAACTGG - Intergenic
1112254531 13:97817518-97817540 TGATATGCTTACAGGTTGACGGG + Intergenic
1114400468 14:22405573-22405595 TAATATGCATATAATTTACCTGG - Intergenic
1114731639 14:24999570-24999592 AGATATGAATACAATGTTACGGG + Intronic
1115315249 14:32018500-32018522 TGACATGCAGACAATCTAAGAGG - Exonic
1116598209 14:46881130-46881152 TGATATGTATATAAATAAACTGG + Intronic
1116662726 14:47732292-47732314 TGAAATTCATACAATTTTAGGGG + Intergenic
1117496180 14:56307539-56307561 TGGTAAGCATACAACTCAACTGG - Intergenic
1117999370 14:61508931-61508953 TGGGATGCATACAATCTAATTGG - Intronic
1118738960 14:68724413-68724435 TTAGATGCCTACAATTAAACTGG - Intronic
1123784333 15:23654204-23654226 TGAGAAGCATACAATTTTGCTGG - Intergenic
1125143907 15:36443156-36443178 AGATATGCATAAAATTCAAATGG + Intergenic
1125237856 15:37536717-37536739 TGATATTCATTGTATTTAACTGG + Intergenic
1125356856 15:38825475-38825497 TGTTATCCATACCATTTATCTGG + Intergenic
1125375847 15:39028575-39028597 TGATCTTCACATAATTTAACAGG + Intergenic
1125408010 15:39373399-39373421 TAATATGCATACAAGTTACTAGG + Intergenic
1127374562 15:58371409-58371431 TTATTTGCCTACAATTTATCTGG - Intronic
1127460261 15:59192241-59192263 TGACATGCATTCAAATAAACTGG - Intronic
1127521614 15:59748278-59748300 TAATATGCATACAAATTCTCTGG - Intergenic
1129647443 15:77449515-77449537 TGATATGCATACAATTTAACTGG - Intronic
1130186106 15:81684395-81684417 AAAAATGCATACAATTTAAAAGG + Intergenic
1130750423 15:86705722-86705744 TGATGTGCATGCATTTTCACTGG + Intronic
1133606117 16:7389815-7389837 TGATATGCATACAATCTTTATGG + Intronic
1134902642 16:17952633-17952655 TGATGTGCATACAAATAACCTGG + Intergenic
1136705120 16:32181177-32181199 TGAAATGCACACAATGCAACAGG + Intergenic
1136762792 16:32748229-32748251 TGAAATGCACACAATGCAACAGG - Intergenic
1136805308 16:33122157-33122179 TGAAATGCACACAATGCAACAGG + Intergenic
1138759641 16:59527009-59527031 TGAAAAGCATGCAATTTAAATGG + Intergenic
1139203177 16:65000049-65000071 TGATATGTATACAATTTCTTAGG + Intronic
1140354665 16:74295364-74295386 TGATATGCTTACAAATCACCAGG - Intergenic
1140905152 16:79403211-79403233 TGATGGGCATACATTTTAGCGGG - Intergenic
1203064948 16_KI270728v1_random:1008548-1008570 TGAAATGCACACAATGCAACAGG - Intergenic
1153054944 18:936541-936563 TAACATGCATACAAATTACCTGG + Intergenic
1153948141 18:10034902-10034924 GGAATTGCATACAATTTAAAAGG - Intergenic
1153995351 18:10435724-10435746 TCATGTGAATATAATTTAACTGG + Intergenic
1154059213 18:11043430-11043452 TGAAATTCAAACAATTTATCTGG + Intronic
1155113357 18:22738192-22738214 AAATATGTATACAATTTAGCAGG - Intergenic
1155135723 18:22990309-22990331 TAACATGCATACAAGTCAACTGG - Intronic
1155472772 18:26208214-26208236 TGAGATGCTCACAATCTAACAGG - Intergenic
1156658276 18:39313609-39313631 AAAGATGCATACAATTTAACAGG + Intergenic
1156822073 18:41384886-41384908 TAATGTGCATACAAATGAACTGG - Intergenic
1159494584 18:69185594-69185616 TGATATGCATACAATAAAGTTGG - Intergenic
1160281687 18:77496692-77496714 TGATATGCATTAATTTTAATTGG - Intergenic
1161838271 19:6662717-6662739 TGATATGCATACAAATTAGAGGG - Intronic
1161859983 19:6790761-6790783 TGATTTGCATATAATTAAAACGG - Intronic
1165010112 19:32839890-32839912 TGAAAGGCATACAATGTAACTGG - Intronic
1166608653 19:44168463-44168485 TGCAATGCATACAATTAGACTGG - Intronic
925190067 2:1875411-1875433 AGACATGCATACATTTTAAATGG + Intronic
928930418 2:36618280-36618302 TGAGGTGCATAAAATTTATCAGG - Intronic
929208646 2:39327930-39327952 TGATAAGCACACAACTTAGCTGG - Intronic
930591761 2:53335906-53335928 TGAAATGCATAGAGTTTAACTGG + Intergenic
931635275 2:64335113-64335135 TAATATGCATAAAACTTATCTGG - Intergenic
933044887 2:77523196-77523218 TGATATATATATAATTTAAAAGG + Intronic
936822316 2:116538287-116538309 TGATCTTCACACAATTTAATTGG + Intergenic
936846179 2:116836452-116836474 TGATAAGCATACACTTAAAATGG - Intergenic
937577787 2:123445053-123445075 AGATATGCTTACATTTTAAATGG - Intergenic
937698579 2:124837493-124837515 TGATCTACATACATTTTATCTGG - Intronic
939278146 2:140028381-140028403 TAATATTCATAAAATTTAAAAGG - Intergenic
941096505 2:161244343-161244365 TGAAATTCAAAAAATTTAACTGG - Intergenic
941481480 2:166020497-166020519 TGATAAGCATACCATTCAGCTGG - Intronic
941945325 2:171090291-171090313 TGATATGCAGAAAATATAACTGG + Intronic
941993564 2:171579845-171579867 TGATGTGCATACAAATCACCAGG + Intergenic
943126418 2:183798175-183798197 ACATATGCATGCAATTTAAGAGG + Intergenic
943172991 2:184428118-184428140 TGATTTGCTTATAGTTTAACTGG - Intergenic
946561616 2:220920447-220920469 TGTTATCCAAACAACTTAACTGG - Intergenic
947686228 2:232088019-232088041 TGATGTGAACACAATTAAACTGG + Intronic
948819410 2:240531642-240531664 TTATATACATACAATTTTACCGG - Intronic
1169669288 20:8077438-8077460 TGACATGCATAAAATTTACCAGG - Intergenic
1172143268 20:32739051-32739073 TGTTATGCATACATTTAAAATGG + Intronic
1173240591 20:41293285-41293307 TGATGTGCATACAAATTACCTGG - Intronic
1173898652 20:46570652-46570674 TGATATGCATTCAATAGAAAGGG - Intronic
1174705174 20:52647789-52647811 TGATATGCATATTATTTGTCAGG + Intergenic
1177302618 21:19269464-19269486 TGATATCCATCCACTATAACTGG + Intergenic
1177381172 21:20346398-20346420 TGATCTGCACAAAATTTACCAGG - Intergenic
1177776233 21:25569833-25569855 TGAAATGCAGACAAGTTATCTGG - Intergenic
1184286060 22:43472142-43472164 AGAAATAAATACAATTTAACTGG - Intronic
951152605 3:19309407-19309429 TCATAGGCATACTATTTAAAAGG + Intronic
953822884 3:46223444-46223466 TGAGAAGCTTACAATTTAGCTGG - Intronic
955295539 3:57731960-57731982 TGAAATGGATACAAATTTACTGG + Intergenic
958456516 3:94338425-94338447 TGATCTGATTACAATTTAAAAGG - Intergenic
959071093 3:101702713-101702735 TGAAATCCATACATTGTAACTGG - Intergenic
959150527 3:102601886-102601908 TAATATGCATATAAGATAACTGG - Intergenic
959559064 3:107758696-107758718 TGATATTCAAAATATTTAACAGG - Intronic
960403704 3:117234433-117234455 TAATGTGCATACAAATCAACTGG + Intergenic
960476410 3:118134949-118134971 TGATATACAGACAGTTTTACTGG + Intergenic
960768222 3:121162364-121162386 TGATATGCAGAAAACTGAACTGG + Intronic
963843214 3:150129228-150129250 TAATGTGCATACAAATTAAAGGG - Intergenic
970865672 4:20756020-20756042 TGATTTGCTTGCATTTTAACGGG + Intronic
971694471 4:29881487-29881509 TGATTTGCATATATTTTATCTGG - Intergenic
974736642 4:65943546-65943568 TGATAAACATACAAATTAAAAGG + Intergenic
974751500 4:66147251-66147273 TAAAATGAATACAATTTAAATGG + Intergenic
976056681 4:81077481-81077503 TGCTATTAATACAATTAAACAGG - Intergenic
976108271 4:81642698-81642720 TGACATGCACACAAAATAACAGG - Intronic
976893590 4:90080818-90080840 TGATATCCATACCAATTAAATGG - Intergenic
977521023 4:98083672-98083694 TGATATGTATAGAATATAAGTGG - Intronic
978845741 4:113270701-113270723 CAATATGCATACAAATTACCTGG + Intronic
979502861 4:121460185-121460207 AAATATGCATACAATTTAGCTGG - Intergenic
981588998 4:146336029-146336051 TAATATGCCTACAAATTACCTGG - Intronic
983117858 4:163841988-163842010 TGATATAAAAATAATTTAACGGG + Intronic
983300911 4:165924383-165924405 TGATATGGAGAAAATTTAAGTGG + Intronic
983617009 4:169718563-169718585 TCAAATGCATTCATTTTAACTGG + Intronic
983845760 4:172515532-172515554 TCATTTGCGTTCAATTTAACAGG + Intronic
984992066 4:185390603-185390625 TGGTAGGCATACAGTTCAACTGG + Intronic
987648457 5:20707909-20707931 TCATATGCATACATTTTATTGGG - Intergenic
988088919 5:26509427-26509449 TAATTTGCATCCTATTTAACTGG + Intergenic
988172464 5:27676732-27676754 TTATAAACATAAAATTTAACAGG - Intergenic
988747876 5:34161010-34161032 TCATATGCATACATTTTATTGGG + Intergenic
989045814 5:37272444-37272466 TTAGATCCACACAATTTAACAGG - Intergenic
989822576 5:45812175-45812197 AGATATGGTTACAATTTATCAGG - Intergenic
990433034 5:55756320-55756342 TAATGTGCATACAAATTACCTGG - Intronic
990677995 5:58210073-58210095 TGATATGCATCTTATATAACAGG - Intergenic
991256181 5:64617690-64617712 TTATTTGCCTACAAGTTAACTGG + Intergenic
992676469 5:79111328-79111350 TGATATACATCCAGTATAACGGG - Intronic
992960372 5:81952545-81952567 AGATATGCATACAATCTGGCAGG - Intergenic
993376367 5:87153580-87153602 TTATATGCCTACAATGTACCAGG - Intergenic
996284845 5:121777591-121777613 TTCTGTGCATACAATTTATCTGG - Intergenic
996325152 5:122264738-122264760 TGATGTGCATACAAATAACCTGG + Intergenic
996871454 5:128197841-128197863 TGATTTGGATTCAGTTTAACTGG - Intergenic
999547259 5:152643326-152643348 TGATAGGCAAACACATTAACAGG - Intergenic
1004659227 6:17695150-17695172 GGGTATGCACACAATTTAAAGGG - Intronic
1005545458 6:26864092-26864114 TCATATGCATACATTTTATTGGG + Intergenic
1005793475 6:29331802-29331824 TAAAATACATATAATTTAACTGG - Intergenic
1005933577 6:30501670-30501692 TAATATACAAACAATTTAATGGG - Intergenic
1007940667 6:45778105-45778127 TGATGTGCATAGAATTTTACTGG + Intergenic
1008319874 6:50097654-50097676 AGAAATGCATACAATAAAACTGG - Intergenic
1010929184 6:81779769-81779791 TGATTTTCTTACAAATTAACTGG - Intergenic
1011927130 6:92660205-92660227 TGATATCAATACACTTTTACTGG + Intergenic
1011963075 6:93115888-93115910 TGATATGCACACAATATCTCTGG + Intergenic
1012324065 6:97892168-97892190 TCCTATGCATACCAGTTAACTGG - Intergenic
1014179489 6:118369369-118369391 TCATATGCAGAAAATTTAAACGG + Intergenic
1014856144 6:126403449-126403471 TGATATGCAGAAAATTTTAGTGG + Intergenic
1015008455 6:128312978-128313000 TTATATGCATACACTTTCTCAGG - Intronic
1016203520 6:141443202-141443224 TGATAAGAAAACAGTTTAACAGG + Intergenic
1016846972 6:148578198-148578220 TGATATGTATACAAATTCAGTGG - Intergenic
1017308318 6:152947090-152947112 TAATATGCATATAAATTACCTGG + Intergenic
1017404251 6:154100516-154100538 TGATATGGAGCCAATTTATCAGG - Intronic
1018283049 6:162207981-162208003 TGATATCCCAACAATTTAAAGGG - Intronic
1018284117 6:162218577-162218599 TGCTATGCATGCAATTTCCCTGG - Intronic
1020701183 7:11485213-11485235 TGATATGCATAGAAATTACCTGG - Intronic
1021227766 7:18048581-18048603 AGATATGCATGCAAAATAACAGG - Intergenic
1021423769 7:20474908-20474930 TGAAAATCATACAATATAACTGG - Intergenic
1026526674 7:71159611-71159633 TGACAGGTATACAATTCAACTGG + Intronic
1027561059 7:79730897-79730919 TGATATGTAATCATTTTAACAGG + Intergenic
1028974111 7:96892951-96892973 TGATATGCATAAAAATCACCTGG - Intergenic
1031663592 7:124457545-124457567 TAATGTGCATACAAATCAACTGG + Intergenic
1032235489 7:130118472-130118494 TGATATGCAGAAAGTTTAAGTGG - Intronic
1034176175 7:149101584-149101606 TGAAATGCCAACAGTTTAACAGG - Intergenic
1035549891 8:514098-514120 TAAGATGCATACAAAATAACAGG + Intronic
1037164421 8:15809914-15809936 TAATATGCATACAAATTACCTGG + Intergenic
1037333539 8:17768942-17768964 TAATATGGTTACAATTTAAATGG + Intronic
1038500749 8:28041640-28041662 TAACATGCATACAAATCAACAGG + Intronic
1042878033 8:73457766-73457788 TGATATGCAAAGTACTTAACAGG + Intronic
1043843004 8:85131019-85131041 TGATAATCATACAATTTCACTGG - Intronic
1046259163 8:111743983-111744005 ACAAATGCATAAAATTTAACAGG + Intergenic
1051000443 9:12275566-12275588 TGACAGGCATTCAATCTAACAGG + Intergenic
1051871437 9:21742160-21742182 TGAAAGGTATTCAATTTAACAGG + Intergenic
1051936876 9:22453711-22453733 AGTTTTGCATACAATTTCACTGG + Exonic
1055278814 9:74650459-74650481 TGGTATGCAACCAATTTAACAGG + Intronic
1055791972 9:79932168-79932190 TGCTCTGCATACTATTTAAAGGG - Intergenic
1057978846 9:99637195-99637217 TGGTAAGCATACAATTCATCTGG - Intergenic
1059590936 9:115661152-115661174 TCATATACATACAAATTATCTGG - Intergenic
1060296867 9:122348803-122348825 TGATATGAAGAGAATTAAACAGG - Intergenic
1062078736 9:134607287-134607309 TGATTTGCATATAATTAAAATGG - Intergenic
1186093347 X:6073499-6073521 TGATATACATAAAAAATAACAGG + Intronic
1186193651 X:7090436-7090458 TTATATGAATTCAATTTCACAGG - Intronic
1186381285 X:9062663-9062685 TGATATGCAGACATTTTACTTGG + Intronic
1186617392 X:11203575-11203597 TCCTAAGCATAAAATTTAACAGG - Intronic
1187356544 X:18578387-18578409 TGATAGGTATACAACTTGACTGG + Intronic
1188169420 X:26905155-26905177 TAATATGAATACAATTTACCTGG - Intergenic
1188705364 X:33322046-33322068 TGATATGGATAAAATTTAAATGG - Intronic
1189956838 X:46284159-46284181 TGATATGCATACATTACTACTGG + Intergenic
1194324626 X:92498109-92498131 GGATTTGCATACAGTTTAATGGG + Intronic
1194639360 X:96384171-96384193 TGGTAGACATACAATTCAACTGG - Intergenic
1195047879 X:101070499-101070521 TGATAGACAAACAAATTAACTGG - Intergenic
1196271602 X:113718512-113718534 TGAAATACATACAATATAAAGGG - Intergenic
1198202831 X:134439016-134439038 TGTCATGTCTACAATTTAACTGG + Intergenic
1198883333 X:141306100-141306122 TGAACTGCATACAATGTATCAGG + Intergenic
1200633363 Y:5617317-5617339 GGATTTGCATACACTTTAATGGG + Intronic
1201310288 Y:12592297-12592319 TTATATGTATACAATATACCTGG + Intergenic