ID: 1129648277

View in Genome Browser
Species Human (GRCh38)
Location 15:77458934-77458956
Sequence CACAGAAAGGAGAAGGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 880
Summary {0: 1, 1: 0, 2: 10, 3: 89, 4: 780}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129648277_1129648286 15 Left 1129648277 15:77458934-77458956 CCCACCCCCTTCTCCTTTCTGTG 0: 1
1: 0
2: 10
3: 89
4: 780
Right 1129648286 15:77458972-77458994 TATTTAAAGAGATATAGAAAAGG 0: 1
1: 0
2: 11
3: 152
4: 1947
1129648277_1129648287 16 Left 1129648277 15:77458934-77458956 CCCACCCCCTTCTCCTTTCTGTG 0: 1
1: 0
2: 10
3: 89
4: 780
Right 1129648287 15:77458973-77458995 ATTTAAAGAGATATAGAAAAGGG 0: 1
1: 0
2: 12
3: 118
4: 1161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129648277 Original CRISPR CACAGAAAGGAGAAGGGGGT GGG (reversed) Intronic
900542936 1:3213029-3213051 CCCAGAAAGGAAAGCGGGGTCGG + Intronic
900806573 1:4771524-4771546 CACAGGAAGGACAAGGGGGCTGG - Intronic
901877495 1:12175268-12175290 TTCAGAAAGGAGAAGGGAATTGG - Intronic
902076931 1:13794566-13794588 CACAGAAAGGAAAACGGGCTCGG - Intronic
902268606 1:15287140-15287162 CAAAGAATGGAAAAGAGGGTAGG + Intronic
902918853 1:19654960-19654982 CACAGCAAGGTGCAGGGGGCCGG - Intronic
903010248 1:20324707-20324729 CTCAGCAAGGAGAGGAGGGTTGG + Intronic
903054728 1:20627779-20627801 CACCCAAAGGACATGGGGGTGGG - Intergenic
903085896 1:20858536-20858558 CAAAGAAGGGAGAAGGGACTAGG - Intronic
903179730 1:21599109-21599131 CAAAGAAAGGAGGAGGCGGCAGG + Intronic
903681689 1:25101833-25101855 CACAGGAAGGAGAGGGGAGGAGG - Intergenic
903841393 1:26244042-26244064 CACAGGAGAGAGAAAGGGGTGGG + Intronic
904274193 1:29369653-29369675 CACAGGAAGGAGAGAGGGGCAGG - Intergenic
904423773 1:30410440-30410462 CACAGGAAGGAGAGAGGGGCAGG + Intergenic
905300959 1:36985926-36985948 CACAGTGAGGAGGAGGGGGAGGG - Intronic
905566729 1:38971478-38971500 CACAAAAAGTATAAGGGGCTGGG + Intergenic
905825769 1:41025004-41025026 CACATCAGGGAGAAGGGGGTTGG - Intergenic
906092942 1:43198154-43198176 CAAAGAAAACAGTAGGGGGTGGG - Intronic
906182418 1:43833706-43833728 GGCAGAAAGGGGAAGGCGGTAGG + Intronic
906504290 1:46366548-46366570 CTAAAAAAAGAGAAGGGGGTTGG + Intergenic
906683594 1:47748228-47748250 ATAAGCAAGGAGAAGGGGGTAGG + Intergenic
906706797 1:47900897-47900919 CAAAGAAAGCAGAAAGGGCTGGG + Intronic
907333288 1:53685077-53685099 CACAGAAGAAAGAAGAGGGTGGG + Intronic
908189239 1:61684378-61684400 CACAGTGAGGAGAAGTGGGAAGG - Intronic
908572964 1:65428374-65428396 CACAGAGAGGGGAAGGGGTTTGG - Intronic
908896253 1:68903644-68903666 CACAGAAAGAAGCAGGTGGAAGG - Intergenic
909015332 1:70373900-70373922 CAGAGAAGGGAGATAGGGGTGGG - Intronic
910091622 1:83471325-83471347 CACAGAAAGGAGAAGATACTGGG + Intergenic
910480119 1:87649601-87649623 AAAAGAAGGGAGAAGGGGGAGGG - Intergenic
910618868 1:89230722-89230744 CCCAGAAAGGACAAGGGGTTAGG - Intergenic
910795421 1:91092734-91092756 CAGAGAGAGGAGGAAGGGGTGGG - Intergenic
910936641 1:92488350-92488372 CGCAGAAAGGAGCAGGTGGGAGG + Intergenic
911436761 1:97869753-97869775 AACACAAAGGAAAAGGGGTTTGG - Intronic
912032488 1:105265877-105265899 GTTAGAAAGGAGAAGGAGGTGGG - Intergenic
912902049 1:113661724-113661746 CAGAGAAAAGAGAAGGGTGGAGG + Intronic
912913232 1:113784487-113784509 CACGGAAAAGGGCAGGGGGTTGG + Intronic
912939481 1:114032359-114032381 CAGTGAAAGGAGATAGGGGTGGG - Intergenic
912954589 1:114145880-114145902 GAGAGGTAGGAGAAGGGGGTGGG + Intronic
913177316 1:116286623-116286645 CACAGGAGGGAGTTGGGGGTAGG - Intergenic
913221397 1:116663566-116663588 CACACAGAGGTCAAGGGGGTAGG + Intronic
913325166 1:117621677-117621699 GTCAGAAAGGCGGAGGGGGTGGG + Intronic
913384720 1:118247145-118247167 CACAGTGAGGAGAAAGGTGTTGG + Intergenic
914240531 1:145849870-145849892 CAGGGAAAGGGGAAGGGTGTAGG - Intronic
914960132 1:152197623-152197645 GAAAGAAAGGAGGAGGGGGGAGG - Intergenic
915079662 1:153343410-153343432 CTCTGAAAAGGGAAGGGGGTAGG - Intronic
915257039 1:154641349-154641371 CACAGTATGGAGAAAGGGGATGG + Intergenic
915301286 1:154953048-154953070 CTGAGGAGGGAGAAGGGGGTTGG - Intronic
915493858 1:156267245-156267267 GGCAGTAAGGAGAAGGGGGAAGG + Intronic
915542428 1:156576415-156576437 TACAGAAAGGAATAGGGGTTGGG - Intergenic
915656824 1:157367575-157367597 AACAGAGAGGAGGAGGGGATAGG - Intergenic
916418262 1:164612375-164612397 CACAGAAAGGAAAGGGGGATGGG + Intronic
916508027 1:165445500-165445522 CTGTGAAAGGAGGAGGGGGTGGG + Intergenic
916737137 1:167617932-167617954 CGCAGAAAGGGGAATGGTGTGGG - Intergenic
916818103 1:168372708-168372730 GACAGAAAGCAGGAGGGCGTGGG + Intergenic
917288637 1:173448516-173448538 CAGAGAAGGGAGATAGGGGTGGG + Intergenic
918047846 1:180952172-180952194 CACAGAATGGGGTAGGGGGGTGG + Intergenic
918148877 1:181781348-181781370 CAGGGAAAGGAGAAGGAAGTGGG - Intronic
918322009 1:183373370-183373392 CATGGAAAGGAGAAGGGAGAAGG - Intronic
919822454 1:201481841-201481863 CAGAGAGAGGAGGAGGGCGTGGG + Intergenic
920226953 1:204446155-204446177 CACGGAAAGGAGAAGGTGGTGGG + Intronic
920363011 1:205432290-205432312 CACACAAAGGAGGAGTGGCTGGG - Intronic
920538422 1:206758137-206758159 CTCAGAAAGCAGGACGGGGTGGG - Intergenic
920681557 1:208077008-208077030 CAGGGAAAGGAGGATGGGGTAGG + Intronic
921114459 1:212074979-212075001 CAGAGAAAAGAGGATGGGGTGGG - Intronic
921256855 1:213349389-213349411 CACAGTAAGGAGAAGCAGGATGG + Intergenic
921267192 1:213430998-213431020 CACAGAAATGGGTTGGGGGTGGG + Intergenic
921986992 1:221322919-221322941 CACATAAGGAAGAAAGGGGTTGG - Intergenic
922145753 1:222942543-222942565 CACTGAAAGGAGAGGTGGGCAGG + Intronic
922596237 1:226815635-226815657 CAGAGGAAGGAGAAAGAGGTGGG - Intergenic
922744634 1:228037242-228037264 CACAGAATAGGGCAGGGGGTGGG - Intronic
923150012 1:231224537-231224559 CACAGGAAGGCGTATGGGGTGGG - Intronic
923252888 1:232193497-232193519 TACAGAAAGGACTAGGGGATTGG + Intergenic
923409297 1:233691276-233691298 TAAAGAAAAGAGATGGGGGTGGG + Intergenic
924284378 1:242470811-242470833 CACAGAAAGAAGACAGGGGCAGG - Intronic
924730832 1:246710216-246710238 TACAAAAAGTAGAAGGGGGGTGG + Intergenic
1062931288 10:1354448-1354470 CAGCGAAGGGAGATGGGGGTGGG - Intronic
1063152993 10:3353759-3353781 GACAGAAAGTGGAAGGGGGGTGG - Intergenic
1063348057 10:5329623-5329645 TAGAGGAAGGGGAAGGGGGTTGG - Intergenic
1063509972 10:6635194-6635216 CAGTGAAGGGAGATGGGGGTGGG + Intergenic
1063527204 10:6797184-6797206 CAGTGAAGGGAGATGGGGGTGGG + Intergenic
1064071132 10:12229058-12229080 CACAGAAAGGAGAAGCGTAGAGG - Intronic
1064534698 10:16346645-16346667 CATAGTAGGGAGAAGGGGCTGGG - Intergenic
1064817532 10:19283572-19283594 GACAGAAAGGGGAAAGGGGAGGG - Intronic
1064887334 10:20124635-20124657 CAGCGAAGGGAGATGGGGGTGGG + Intronic
1065064697 10:21949397-21949419 AAAAAAAAGAAGAAGGGGGTGGG - Intronic
1065646508 10:27840511-27840533 CACTGATTGGACAAGGGGGTGGG + Intronic
1065806128 10:29395004-29395026 CTCAGAAAGGAGAAAGGGGATGG - Intergenic
1065862971 10:29886846-29886868 GAGAGGAAGGAGATGGGGGTAGG + Intergenic
1065879181 10:30025084-30025106 AACAGAAAATAGAAAGGGGTGGG + Intronic
1066305768 10:34139170-34139192 CATAGAAAGGAGAAGATAGTAGG + Intronic
1066718520 10:38312751-38312773 CAAAATAAGTAGAAGGGGGTCGG - Intergenic
1067047044 10:42990718-42990740 CAGAGGAAGGAGACAGGGGTGGG + Intergenic
1067344406 10:45427464-45427486 CACATAAAGGAGGAGGGCGGTGG + Intronic
1067656162 10:48193236-48193258 AGCAGAAAGCAGAAGGGGATGGG - Intronic
1070001869 10:72384509-72384531 CAAAGAGAAGAGATGGGGGTAGG - Intronic
1070097994 10:73357080-73357102 CACAGGGAGGAAAAGGGGGGTGG + Intronic
1070112893 10:73501651-73501673 CACAGTAAGGAGGAGTGGATGGG - Intronic
1070610998 10:77932501-77932523 CTCAAAAAGGAGAAGTGGCTGGG + Intergenic
1070835865 10:79446480-79446502 CAGAAATAGGAGAAGGGGGGGGG - Intergenic
1070870294 10:79745369-79745391 CACAGCAAGGAGAATGTGGCAGG - Intergenic
1071637213 10:87267589-87267611 CACAGCAAGGAGAATGTGGCAGG - Intergenic
1071742478 10:88375891-88375913 TACAGAAAGGAGTAGGGGCTTGG + Intronic
1071807741 10:89142766-89142788 AAGAGAAAGGAGAAGGGGAGGGG + Intergenic
1071858606 10:89650164-89650186 CTCAGAAAGGAGATTGGGGAAGG + Intergenic
1071893266 10:90035871-90035893 CACAGAAATGTGGAGAGGGTTGG + Intergenic
1072222164 10:93335695-93335717 GCCAGAAAGGAAAAGGGGGAGGG - Intronic
1073142200 10:101255525-101255547 CACAGGAAGGAGAAGAGGTTAGG - Intergenic
1073170520 10:101504048-101504070 AACTGAAGGGAGAAGGGTGTTGG + Intronic
1073663899 10:105508650-105508672 TACAGAAAGGAACAGGGGCTTGG + Intergenic
1074370552 10:112897743-112897765 CTCAGAGAGGTGGAGGGGGTGGG + Intergenic
1075334832 10:121601069-121601091 AAGAGAAAGGAGAAGGGGGTGGG + Intergenic
1075591931 10:123698234-123698256 CACAGAAAGGGGAATGTGCTAGG - Intergenic
1076245300 10:128942679-128942701 TACAAAAAGGAGAAGTGGCTAGG + Intergenic
1076543321 10:131228021-131228043 CACAGCACGGAGAGGGGGGCTGG - Intronic
1077016155 11:399907-399929 CCCAGAAACGCGGAGGGGGTTGG + Intronic
1077066975 11:645675-645697 CAGAGAAAGGAGGTGGGGGATGG + Intronic
1077173522 11:1178743-1178765 CCCAGAAGGGAGAAGGGAATGGG + Intronic
1077490226 11:2857655-2857677 CACAGAGAGGAATAGGGGCTGGG - Intergenic
1077578033 11:3399072-3399094 CAGAGAAGGGAGATAGGGGTAGG - Intergenic
1078857857 11:15221100-15221122 CACAGCAAGGAAGAGGGGATTGG + Intronic
1079186581 11:18243853-18243875 CACAAATAGGACAAAGGGGTGGG - Intronic
1079346394 11:19656471-19656493 CACAGACAGGAGACTGGGGAAGG + Intronic
1079487476 11:20950514-20950536 GACTCACAGGAGAAGGGGGTTGG + Intronic
1080514952 11:33011675-33011697 CACAGAAACAGGAAGTGGGTTGG + Intergenic
1080540902 11:33263777-33263799 GACAGAAAGAGGAAGGGGTTGGG - Intronic
1081751522 11:45514419-45514441 CACAGAAAGCTGAAGGCGCTGGG + Intergenic
1081871079 11:46382751-46382773 CAGCGAAAGGAGAAGGGGGTGGG + Intronic
1082082009 11:48019372-48019394 CAGAGAAAGGAGGTGGGGTTCGG - Intronic
1082657055 11:55869002-55869024 CTGAGCAAAGAGAAGGGGGTGGG + Intergenic
1082760366 11:57121499-57121521 CAAGGATAGGAGCAGGGGGTTGG - Intergenic
1082912818 11:58395971-58395993 CACTGAAAGGAGATGGGGGTGGG + Intergenic
1082968187 11:58989876-58989898 CCCAGGAAGCAGAAGGGGTTGGG - Intronic
1083058149 11:59842944-59842966 CCCAGAAAGGAAAAGGGTGGGGG - Intronic
1083179835 11:60978204-60978226 CAGAGAAAGGACAAAGGGGGTGG + Intronic
1083205657 11:61147242-61147264 CACTGAAAGGAGGTTGGGGTGGG + Intronic
1083692522 11:64419100-64419122 CACAGACAGGAGGAGGAGTTGGG - Intergenic
1083801095 11:65046755-65046777 CACAGAAAGGAGAAGAACCTGGG + Intronic
1083812390 11:65112952-65112974 CACACAAAGGAGCCTGGGGTGGG - Intronic
1083990820 11:66244666-66244688 CAGAGAGAGGAGATGGGGGTGGG + Exonic
1084044476 11:66560780-66560802 CACAGTATGCAGGAGGGGGTGGG - Intronic
1084333010 11:68440654-68440676 CAGAGGAAGCAGAAGGGGGCTGG - Intronic
1084712309 11:70851480-70851502 AGCAGAAAGGAGAAAGGGGCAGG - Intronic
1084763036 11:71286070-71286092 CACAGAAAGGTGAAGGCTGTAGG - Intergenic
1084796150 11:71505793-71505815 CAGCGAAAGGAGATAGGGGTGGG - Intronic
1085020084 11:73201303-73201325 CACAGAGTAGGGAAGGGGGTGGG - Intergenic
1085306464 11:75488724-75488746 CACAAAAAGGAGGAGGCAGTGGG - Intronic
1085349242 11:75787981-75788003 CAGAGTAAGGACAAGTGGGTAGG + Intronic
1085402711 11:76244224-76244246 CACAGATGGGAGAATGGGGGTGG - Intergenic
1085450488 11:76629315-76629337 CCCAGACAGGAGAAGGGGCCTGG - Intergenic
1086116446 11:83256546-83256568 AAGAGAAAAGAGAGGGGGGTAGG - Intronic
1086274124 11:85104905-85104927 GAGAGAAAGGAGAAAGAGGTGGG + Intronic
1086276336 11:85133992-85134014 CTCAGAAAGGAGAGAGGGGGTGG + Intronic
1086362526 11:86073694-86073716 CACAGAAAGGTGAGGGGGGAAGG - Intergenic
1087078446 11:94147584-94147606 AACAGAAACGAGAAGGAGGCTGG - Intronic
1087394468 11:97579827-97579849 TACAGAAAGGAAGAGGGGCTTGG - Intergenic
1087839054 11:102904099-102904121 CAGCGAAAGGAGATAGGGGTGGG + Intergenic
1088092543 11:106059843-106059865 AACAGAAAGGAAAAGAGGATTGG + Intronic
1088430656 11:109755040-109755062 AATACAAAGGAGAAGTGGGTCGG - Intergenic
1088912664 11:114203800-114203822 CACAGAAGGCAGCAGGGAGTAGG + Intronic
1089360640 11:117883998-117884020 GACAGCAAGGAGAAAGGGGGTGG + Intergenic
1090106168 11:123855168-123855190 CCCAGTAAGGAGAAGTGGGTCGG - Intergenic
1090387003 11:126363185-126363207 GACAGGAAGGAGATGGGGGCAGG - Intronic
1090480277 11:127061760-127061782 CAAAGAAAGGAGAAGGGGGAAGG - Intergenic
1090591475 11:128274862-128274884 CAGAGAATGGAGAAGCGGGAAGG - Intergenic
1090634494 11:128682295-128682317 CTCAAAAGGGAGAATGGGGTGGG - Intergenic
1091084893 11:132712106-132712128 CCCAGAGAGGAGGAAGGGGTTGG + Intronic
1091178647 11:133583333-133583355 CACAGACAGAAGTAGGGAGTGGG + Intergenic
1091345974 11:134854398-134854420 CACAGAAAAGAGGAGGTGGCTGG + Intergenic
1091751852 12:3027260-3027282 CAAAGAAAGGAGCAGGAGGCTGG - Intronic
1092388842 12:8057196-8057218 CAGAAAAATGAGAAGGTGGTAGG + Intergenic
1092601602 12:10072177-10072199 AACACAAAAGAGAAGGGGCTGGG - Intronic
1092654243 12:10668004-10668026 TACAGAAAGGATAATGGGGATGG - Intronic
1092861851 12:12725340-12725362 CACAGAAAGAAGGAGGGGGTGGG - Intergenic
1094255990 12:28427211-28427233 CACATAAAGGAGGTGGGGGTTGG - Intronic
1094548899 12:31430887-31430909 CACAGAAAGGATACAGGGGGCGG + Intronic
1096230975 12:49896801-49896823 GGCACAAAGGAGACGGGGGTAGG - Intronic
1096386478 12:51198101-51198123 CACAAGAAGGAGAGGGGGTTGGG + Intronic
1096392249 12:51238676-51238698 GACAGAAACGAGCAGGGGGTGGG + Intronic
1096580696 12:52582933-52582955 TACAGGAAGGAGGAGGGGGCAGG - Intergenic
1096895744 12:54819352-54819374 CACAGGAAGCATAAGGGGTTGGG - Intergenic
1096977794 12:55709290-55709312 CACAGGAAGAGGAAGGAGGTAGG - Intronic
1097233623 12:57526182-57526204 CACAGAAGGGAGAATTGGTTGGG - Exonic
1097544289 12:60979375-60979397 CAGAGAAGGGAGATAGGGGTGGG + Intergenic
1097983158 12:65754956-65754978 CTCAGGAGGGAGAAGGGGGCGGG + Intergenic
1098387683 12:69935984-69936006 CACAGATGGGAGCAGGGGGGAGG - Intronic
1099070631 12:78042051-78042073 AACAGAAAGGAGGAGGGAATTGG - Intronic
1099688211 12:85916637-85916659 CACAGAAGGCACAATGGGGTAGG - Intergenic
1100499887 12:95163688-95163710 CACATAAAAGAGTAGGAGGTTGG + Intronic
1100825695 12:98472349-98472371 CAGAGAATGGAGAGGTGGGTTGG - Intergenic
1101086927 12:101245537-101245559 CACAGAAAGGAGACTGGCTTAGG - Intergenic
1101409909 12:104458814-104458836 CAGTGAAAGGAGAAGGCGGGAGG - Intronic
1101525193 12:105522163-105522185 GATAGAATGGAGAAGGGGATGGG + Intergenic
1101556789 12:105817425-105817447 GACAGAAAGGAGAGGGGGAAAGG + Intergenic
1102650779 12:114440872-114440894 CACGGAAAGCAGAAGGCGGAAGG + Intergenic
1102674822 12:114650222-114650244 CACAGAAAGGAAATGGAGCTTGG + Intergenic
1102747622 12:115263480-115263502 CACAGACAGGAGAACAGGGTGGG - Intergenic
1102856540 12:116299338-116299360 CATAGAAAGGAGAAGTGTGGGGG + Intergenic
1104236494 12:126943494-126943516 TGCAGAAAGGAAAAGGGGTTGGG - Intergenic
1104243717 12:127016780-127016802 CACAGATGGGATAAGAGGGTGGG - Intergenic
1104512994 12:129398569-129398591 CAGGCAAAGGAGGAGGGGGTTGG + Intronic
1104748765 12:131225401-131225423 AACAGAGAGGAAAATGGGGTGGG - Intergenic
1104784358 12:131440163-131440185 AACAGAGAGGAAAATGGGGTGGG + Intergenic
1105572846 13:21620348-21620370 AAGAGAAAGGAGAAGGAGATTGG - Intergenic
1106104043 13:26718390-26718412 CAGAGAAAGGAGACTGGCGTGGG + Intergenic
1106242091 13:27920558-27920580 ACCGGAAAGGAGAAAGGGGTGGG - Intronic
1106356398 13:28987454-28987476 GAGAGGAAGGAGATGGGGGTTGG + Intronic
1106644984 13:31624053-31624075 CAGAGAAGGGAGATAGGGGTGGG - Intergenic
1106969997 13:35128071-35128093 CAAAGAAAGCAGAAAGGGGTGGG + Intronic
1107650746 13:42542218-42542240 CACAGAAAAGTGGAGGGGCTAGG - Intergenic
1107726930 13:43308274-43308296 CAAAGAAAGGAGAAGTGAGAGGG - Intronic
1107890747 13:44912076-44912098 CACAAAAAGGGTAAGAGGGTTGG - Intergenic
1108014436 13:46059655-46059677 CACAGAGATGAGAAGGGGAGAGG + Intronic
1108035499 13:46286222-46286244 AAGAGAAAGGAGAATGGGCTGGG - Intergenic
1108515186 13:51194791-51194813 CACAGACTGGAGTAGGGGGATGG + Intergenic
1108879213 13:55088580-55088602 CAGAGAAAGGAGAAAGGGTTTGG - Intergenic
1109282409 13:60372260-60372282 CAGAGACAGGAGAAAGCGGTAGG - Intergenic
1109363216 13:61323757-61323779 CCCAGAAAGCACAAGGGGTTGGG + Intergenic
1109816194 13:67588523-67588545 CCCAGGAAGCAGAAGGGGTTGGG + Intergenic
1110804280 13:79736479-79736501 CCCAGTAAGGAGAAGTGGATTGG + Intergenic
1112221784 13:97498424-97498446 AATAGAAAGGAGAAGGAGGATGG - Intergenic
1112343177 13:98568952-98568974 CACAGAAAATGGAAGGGGGGAGG + Intronic
1112971225 13:105265692-105265714 GACAGAAAGTAGAAGGGAGATGG + Intergenic
1113067557 13:106387634-106387656 CACAAAAAGCACAAGGGGATGGG + Intergenic
1113386607 13:109854561-109854583 CACAAAGAGGAGAAGCTGGTGGG - Intergenic
1114535181 14:23418054-23418076 CCCTGAGAGGAGAAGGAGGTGGG + Intronic
1115873467 14:37833743-37833765 CACACAAAGGAGAAGGTGAAAGG - Intronic
1116460184 14:45163736-45163758 CACAGAAAGGGGAATAGGGCAGG - Intronic
1117579471 14:57137746-57137768 CACAAAAAGGGGCGGGGGGTGGG - Intergenic
1118442787 14:65827328-65827350 TACAGAAAGGAATAGGGGCTTGG - Intergenic
1118746888 14:68780764-68780786 CACAGAGAGAAGCAGGGGTTAGG + Intergenic
1119114906 14:72010528-72010550 CACAGGAATGAGTATGGGGTGGG - Intronic
1119314740 14:73683620-73683642 CAGAGACTGGAGAGGGGGGTGGG - Intronic
1119441425 14:74631224-74631246 AACAGCCAGGAGAAGGGGTTGGG + Intergenic
1119443776 14:74647303-74647325 CAGAGGAAGGAGAAGGGAGTCGG - Intergenic
1119788069 14:77327360-77327382 CAGGGAAGGGAGATGGGGGTGGG + Intronic
1119835559 14:77746895-77746917 CACAGAAGGGGGGAGGGGGAGGG - Intronic
1120142815 14:80947338-80947360 CACAGAAAGCAGAAAGGGAGGGG + Intronic
1120999992 14:90444663-90444685 CACAGAAAGGAGAAAGGAGGAGG - Intergenic
1121129936 14:91436891-91436913 CAGAGAAAGGAGAAAAGGCTGGG - Intergenic
1121605957 14:95240276-95240298 GCCAGAAAGGAGAAGGAAGTAGG - Intronic
1121810956 14:96889765-96889787 CACCAAAAGGCAAAGGGGGTAGG - Intronic
1121911574 14:97796782-97796804 CCCAGACAGGAGAATGGGGTTGG + Intergenic
1122167139 14:99835562-99835584 CGAAGAAAGGAGAAGGAAGTAGG - Intronic
1122692807 14:103539163-103539185 CACGGAAGGGAGCATGGGGTGGG - Intergenic
1123899147 15:24858863-24858885 GAGAAAAAGGAAAAGGGGGTGGG - Intronic
1124032876 15:26027307-26027329 TACAGAAAGGAGCAGGGGCTTGG - Intergenic
1124095843 15:26648169-26648191 GACAGAAAGGAGAATGGAGGTGG - Intronic
1124140278 15:27071299-27071321 GGAAGAGAGGAGAAGGGGGTAGG - Intronic
1124186401 15:27533380-27533402 CAGAGAAAGGAGACTGGGGTTGG - Exonic
1124998303 15:34745610-34745632 CAAAGAAGAGAGAAGTGGGTAGG - Intergenic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1125825315 15:42671550-42671572 CACATAAGGGAGAGGGGGGAAGG + Intronic
1126074536 15:44896475-44896497 CACAGTAAGCACAAGGGGTTGGG - Intergenic
1126993301 15:54408986-54409008 CACAGACAAGAGAAGGGGATAGG + Intronic
1128254137 15:66184789-66184811 ACCAGACAAGAGAAGGGGGTTGG - Intronic
1128537192 15:68500366-68500388 CTCAGGAAGGAGAAGAGGTTTGG - Intergenic
1128557712 15:68642860-68642882 CACAGCAAGGAACAGGAGGTTGG + Intronic
1128632332 15:69279582-69279604 CACAGAATGGAGAGGGGGCTGGG + Intergenic
1128914460 15:71547121-71547143 AACAGAAAGCAGAAAGGGGAGGG - Intronic
1129156140 15:73719394-73719416 CCGTGAAAGGAGAAGGGGGAGGG - Intergenic
1129164426 15:73768262-73768284 CACAGAAAGGAAAGGTGGGGCGG - Intergenic
1129254846 15:74328416-74328438 CTCAGAAAGGTGAAGGGGCCTGG + Intronic
1129296694 15:74603821-74603843 CACAGAACACAGAACGGGGTGGG - Intronic
1129306412 15:74667420-74667442 GAAAGAAAGGAGAAGGGGGGAGG + Intronic
1129448331 15:75634454-75634476 CATAGAAAGGAGATGGAGGGAGG + Intergenic
1129469111 15:75740516-75740538 CACAGAGAGGAAAAGGGGAGAGG + Intergenic
1129648277 15:77458934-77458956 CACAGAAAGGAGAAGGGGGTGGG - Intronic
1129716941 15:77857722-77857744 CAGAGAGAGGAGTATGGGGTCGG + Intergenic
1129727925 15:77911043-77911065 CAGAGGAAGGAGGAGGGGATGGG - Intergenic
1129752666 15:78077067-78077089 CTGAGAAAGGAGACGGGGCTTGG + Intronic
1129765037 15:78159291-78159313 AAGAAAAAGGAGGAGGGGGTAGG - Intronic
1129839954 15:78737817-78737839 CAGAGGAAGGAGGAGGGGATGGG + Intergenic
1130226006 15:82058867-82058889 GAGAGGAAGGAGAAGGGGGAAGG - Intergenic
1130304267 15:82702652-82702674 CAACGAAAGGAGATAGGGGTGGG - Intronic
1130579567 15:85123940-85123962 CACAGAATGGAGAAGAAGGGAGG - Intronic
1130629783 15:85555190-85555212 GCCAGAAAGGGGTAGGGGGTGGG - Intronic
1130661585 15:85835092-85835114 ACCAGAAAGGAAAAAGGGGTGGG - Intergenic
1131060704 15:89402534-89402556 GACAGAAAGGAGTCAGGGGTTGG + Intergenic
1131362875 15:91809596-91809618 CAAATAAAGGAGATGGGGCTGGG + Intergenic
1131557654 15:93413722-93413744 CAGAGAAAGGAGAAGCTGCTGGG - Intergenic
1132185049 15:99796873-99796895 CAAAGAAAGGAGGCGGGGATGGG + Intergenic
1132268840 15:100504688-100504710 CACAGAAAGGACAGGGGTGAAGG + Intronic
1132431940 15:101767682-101767704 CAGAGAAAGGAGGCGGGGATGGG - Intergenic
1132612955 16:826604-826626 CACAAAAAGAATAAGAGGGTCGG + Intergenic
1133015647 16:2938255-2938277 TACAGGAAGGAGAAGGCGGCTGG + Exonic
1133062953 16:3187159-3187181 CACAGAAAAGTGAAGGAGGCTGG - Intergenic
1133108827 16:3533432-3533454 CACAGAACAGGGAGGGGGGTTGG - Intronic
1133171581 16:3985490-3985512 CACAGAAAGGGGACGTGCGTGGG - Intronic
1133288136 16:4700575-4700597 CACAGAAAGGAGGAGGATGGTGG + Intronic
1133388894 16:5393153-5393175 CAGAGAAAGGATGAGGGGGCAGG - Intergenic
1133530793 16:6653230-6653252 TAAACCAAGGAGAAGGGGGTGGG - Intronic
1134480370 16:14613836-14613858 CACATAGAGGAGAAGCGGGAAGG + Intronic
1134667344 16:16028451-16028473 CAGAGAGAGGAGGAAGGGGTGGG - Intronic
1134680684 16:16122892-16122914 CAAAAAAAGGAGATGGGGGTGGG + Intronic
1134747139 16:16597077-16597099 TACAGAAGGGAGAAGGTTGTCGG + Intergenic
1134818751 16:17228468-17228490 CACAGAACGGTGATGGGGTTGGG + Intronic
1134926219 16:18162643-18162665 CAAAGCAACGAGAAGGTGGTTGG + Intergenic
1134998337 16:18756582-18756604 TACAGAAGGGAGAAGGTTGTCGG - Intergenic
1135066565 16:19314982-19315004 GAGAGGAAGGAGGAGGGGGTGGG + Intronic
1135500341 16:22990671-22990693 CAAAGAAGGGAGAAGGGAGAAGG - Intergenic
1135817146 16:25644893-25644915 CCCAGAAAGAAGAAGAAGGTGGG - Intergenic
1135873562 16:26175711-26175733 CACAGAAAGGGGAAGGGAAGAGG - Intergenic
1135879953 16:26245530-26245552 CATAGAGAGGAGAAGGAGGCTGG + Intergenic
1136127368 16:28193891-28193913 CCCAGGAAGAAGAAGGGTGTTGG - Intronic
1136181911 16:28558883-28558905 GACTGAGAGGAGAAGGGGGTGGG + Intronic
1136381196 16:29896792-29896814 GACAGCAAGGGGATGGGGGTGGG - Intronic
1136580139 16:31146628-31146650 TCCAGAAAGGAGTAGGGGGTGGG + Intronic
1137246661 16:46711467-46711489 CACCGAAGGGGTAAGGGGGTGGG - Intronic
1137590941 16:49693250-49693272 CACAGAAATGAGCAGGGTGTGGG + Intronic
1137669656 16:50271865-50271887 CAAAGCAAGGCCAAGGGGGTGGG - Intronic
1137832845 16:51560602-51560624 TACAGAAAGGAATAGGGGTTTGG + Intergenic
1138133960 16:54505302-54505324 AATAAAAAGGAGAAGGGAGTGGG + Intergenic
1139237504 16:65355528-65355550 CACAGAAAAGAAGATGGGGTGGG + Intergenic
1139588867 16:67922050-67922072 AACAGAAAAGGGAAGGGTGTGGG - Intronic
1141085964 16:81095984-81096006 AACAGAAATAAGAAGGGGGCAGG + Intronic
1141139575 16:81488600-81488622 CACAGAGAGGGGATGGGGGAAGG - Intronic
1141513560 16:84528010-84528032 CCAAGAAAAGAGAAGTGGGTTGG + Intronic
1141839307 16:86564453-86564475 CAAAGAAAGGAAAAGGGGAGGGG - Intergenic
1141929799 16:87194440-87194462 CACAGAAATAAGAAGTGGGCTGG + Intronic
1142236951 16:88926916-88926938 CAGAGAAAGGAGATGAGGGCAGG - Intronic
1142480689 17:216366-216388 CACAGAATGGGGGTGGGGGTGGG + Intronic
1142537940 17:633112-633134 GGCAGAAAGGAGAAGCGGCTAGG + Intronic
1142958162 17:3535196-3535218 GACAGAAGGGAGAAGGAGGAGGG - Intronic
1142978114 17:3657095-3657117 CACAGAAGGGAGGAGGGAGGAGG + Intronic
1143520092 17:7439910-7439932 CCCCGAAAGTGGAAGGGGGTGGG + Intronic
1144368524 17:14568437-14568459 CCCAGAAAGTAGAAGTGGGCAGG - Intergenic
1144740891 17:17581693-17581715 CACAGGAGGGAGAGGGGGGAGGG - Intronic
1145287438 17:21516789-21516811 TACAGAAAGGAACAGGGGCTTGG - Intergenic
1145390185 17:22449589-22449611 TACAGAAAGGAACAGGGGCTTGG + Intergenic
1145784867 17:27587293-27587315 CACATCAAGGAGAGGGGGATAGG - Intronic
1145897888 17:28471139-28471161 TAATTAAAGGAGAAGGGGGTGGG + Intronic
1145991721 17:29083062-29083084 CAGAGAAAGGAAAAGGGGCGGGG + Intronic
1146296279 17:31653151-31653173 AAGAGAAAGGGCAAGGGGGTGGG + Intergenic
1146645520 17:34574566-34574588 AATAGAAGGGAGAAGGGGGAAGG + Exonic
1146826846 17:36030519-36030541 GACAAAAAGGAAAAAGGGGTGGG - Intergenic
1147043791 17:37737987-37738009 TTCAGAAAGGAGAAGGAGGCAGG - Intronic
1147112958 17:38277451-38277473 CAGAGGAAGGAGAATGGGGTGGG - Intergenic
1147615074 17:41822800-41822822 CACATAGAGGAAAAGGGGCTGGG - Exonic
1147723079 17:42550515-42550537 CACAGAGGGGCAAAGGGGGTTGG - Exonic
1147724291 17:42556741-42556763 CACAGAGGGGCAAAGGGGGTTGG - Intergenic
1147976891 17:44253042-44253064 AACAGAAAGGGGAAGGGGAAGGG + Intronic
1148416663 17:47511774-47511796 CAGAGGAAGGAGAATGGGGTGGG + Intergenic
1148441446 17:47713631-47713653 CCCGGAAAGGGGAAGGGGGTGGG + Intergenic
1148628211 17:49086669-49086691 CACAGAACTGAGAAGGGTGAAGG + Intergenic
1149039248 17:52168403-52168425 CACATAAAAAATAAGGGGGTTGG - Intergenic
1149466558 17:56884465-56884487 CCAAGACAGGAGAAAGGGGTTGG + Intergenic
1149660696 17:58332667-58332689 GACAGGAAACAGAAGGGGGTGGG + Intergenic
1149812789 17:59693691-59693713 AACAAAAAGGAGCAGGGGGCAGG - Intronic
1150150646 17:62806561-62806583 GAGAGAAAGGAGGAGGGAGTTGG + Intronic
1151024497 17:70661361-70661383 CACAGAAAGGATAAATAGGTCGG - Intergenic
1151084438 17:71364457-71364479 CACAGTAAGGAGAGGGAGGAGGG - Intergenic
1151154219 17:72113547-72113569 CAGAGACAGGAGAAGGGAATAGG + Intergenic
1151444965 17:74157475-74157497 CACAGCAGGCAGAAGGAGGTGGG + Intergenic
1151572911 17:74936133-74936155 CACGGAAAGGAGTAGGGGCGCGG - Intronic
1151981969 17:77517992-77518014 GACAGAAAGGATATGGGGGAGGG - Intergenic
1152060967 17:78074929-78074951 CACGGCAAGGGGATGGGGGTTGG - Intronic
1152598350 17:81249186-81249208 GACAGAAGGGAGGAGGGGGAGGG + Intronic
1153096981 18:1418286-1418308 CAGAGAAATGAGAAGGGAGCTGG + Intergenic
1153268449 18:3295368-3295390 CCCAGGAAGGAGCAGGGGGCTGG + Intergenic
1156293771 18:35772299-35772321 TACAGAAAGGAATAGGGGTTTGG + Intergenic
1157074469 18:44449989-44450011 AACAGAAAGCAGAAGGGAGGTGG - Intergenic
1157112034 18:44830179-44830201 CACAAAAGGGAGAAGAGGGGAGG + Intronic
1157119404 18:44895141-44895163 GAAAGAAAGGAGAAGAGGGAAGG + Intronic
1157174996 18:45443561-45443583 CACAGAAAGGCAGTGGGGGTGGG + Intronic
1157413632 18:47484426-47484448 AACAGAAAGAAAAATGGGGTGGG + Intergenic
1157524827 18:48372854-48372876 CACATACAGGAGATGGGAGTAGG - Intronic
1157538602 18:48481941-48481963 CACAGACAGAAGGTGGGGGTTGG + Intergenic
1157558969 18:48632792-48632814 AACAGCAATGAGAGGGGGGTGGG - Intronic
1158277788 18:55787156-55787178 CACAGATAGCAAAATGGGGTGGG + Intergenic
1158543397 18:58376557-58376579 CACAGAAATGAGAAAGGTTTGGG - Intronic
1158692124 18:59670113-59670135 TTCAGAAAGCAGGAGGGGGTGGG + Intronic
1159127329 18:64238777-64238799 CAGGAAATGGAGAAGGGGGTTGG - Intergenic
1159132293 18:64292672-64292694 CAGAGAGAGGAGAAGGGGTAAGG - Intergenic
1159705973 18:71688192-71688214 CACAGCAAAGAGAAGGGGAAAGG + Intergenic
1160059226 18:75514558-75514580 CACAGAAAGGAGGAATGGGTGGG + Intergenic
1160208608 18:76858357-76858379 CAAAAAAGGGAGAAGGGGGGAGG - Intronic
1160237250 18:77095705-77095727 CACATAAATGTGAAGGGGGCAGG - Intronic
1160841263 19:1147919-1147941 CACAGCAAGGAGAAGGTCCTGGG + Intronic
1160974314 19:1785158-1785180 CACAGAAACGGGAAGGTCGTGGG + Exonic
1161084132 19:2326294-2326316 CACAAAAAGCAGAAAGGGTTTGG - Intronic
1161105783 19:2443326-2443348 CCCAGGAAGGAGGAGGGCGTCGG + Intronic
1161373568 19:3927422-3927444 CACAGACAGGAGACGGGGACAGG + Exonic
1161496905 19:4591451-4591473 GCCAGGAAGGAGGAGGGGGTAGG + Intergenic
1161693625 19:5752729-5752751 CATGGAAAGGAAAAGGGGGCCGG + Intronic
1162083596 19:8234848-8234870 GACAGAAAGTAGAATGGGGCCGG - Intronic
1162435427 19:10654960-10654982 GACAAAGAGGAGGAGGGGGTAGG - Intronic
1162439997 19:10686947-10686969 CACAGCAGGGAGGAGGGGGGTGG + Intronic
1162915247 19:13871202-13871224 CACAGACAGGAGATGGAGATGGG + Intronic
1162992099 19:14310105-14310127 CACAGAAAGGGAAAGTTGGTGGG - Intergenic
1164157083 19:22603451-22603473 CAAAGCCAGGAGAAGGGGGGTGG + Intergenic
1165016086 19:32880970-32880992 CAAAGAAAGGAGGGGTGGGTGGG + Intronic
1165193711 19:34084839-34084861 TACAGAAAGAATAAGGGGCTTGG + Intergenic
1165730801 19:38143418-38143440 CAGGGAAAGGAGGAGAGGGTGGG - Intronic
1165901013 19:39169375-39169397 CACAGATGGGCGCAGGGGGTGGG + Intronic
1165977659 19:39691498-39691520 CAGAGAAAAGAAAAGGGTGTGGG + Intergenic
1166391260 19:42410163-42410185 TACAGAAAGGAGAAGTTGGCTGG - Intronic
1166398714 19:42461972-42461994 CACAGAAAGGGGAAAGCTGTGGG + Intergenic
1166737886 19:45096991-45097013 AACAGCAAGGAGCAGGGGTTAGG + Intronic
1167193836 19:48012981-48013003 AACAAAAAAGAGAGGGGGGTGGG - Intronic
1167333837 19:48872702-48872724 TTTAGAAAGGAGAAGGGGTTGGG + Intronic
1167786838 19:51644247-51644269 CACATTAAGGAGAAGTGGATGGG + Intronic
1168009354 19:53518138-53518160 CACAGAAGGCAGAAGAAGGTGGG + Intergenic
1168024211 19:53631985-53632007 CAGAGAAAGGTGGAGGAGGTGGG + Intergenic
1168229903 19:55023936-55023958 CAAGGGAAGGAGAAGGGTGTAGG + Intronic
1168282000 19:55310890-55310912 CTCATAAAGGAGAATGGGGTGGG + Intronic
925138153 2:1533892-1533914 CACAGAAAGGAGATCTGGGGAGG - Intronic
925138844 2:1536663-1536685 CACAGAAAGGAGATCTGGGGAGG - Intronic
925336606 2:3103064-3103086 CACAGAAAGGAGCTGGGGTTGGG + Intergenic
925406175 2:3606585-3606607 CAGAGCAAGGAGCAGGGGCTGGG - Intronic
925967046 2:9075836-9075858 CACAGAAAGGCAAAGGGGTTAGG - Intergenic
926198762 2:10778764-10778786 CTCAGAAAGGAGACGGGTGGAGG - Intronic
926253455 2:11169562-11169584 CACAGAAAGGATCAAGGGGAAGG - Intronic
927906824 2:26864512-26864534 CACGGAAAGGAAAAGGTGGATGG + Intronic
927955905 2:27207226-27207248 GACAGAAGGGAGAAGTGCGTGGG - Intronic
929818054 2:45251613-45251635 CAATGAAAGGAGAAGGAGGTTGG - Intergenic
930028124 2:47042021-47042043 TACAGAAAGGAAAAGGGGATTGG + Intronic
930061761 2:47295490-47295512 TACACAAAGGAAAAGGGGCTTGG - Intergenic
931285372 2:60827687-60827709 GCCAGAAAGGAGGAGTGGGTGGG - Intergenic
931368136 2:61637231-61637253 CACAGAAAGGAAGAGAGGCTTGG - Intergenic
931446535 2:62331651-62331673 TACAGAAAGGAACAGGGGCTTGG + Intergenic
931566114 2:63617537-63617559 TACAGAAAGGAATAGGGGTTTGG + Intronic
931759325 2:65402587-65402609 GAGGGAAAGGAGAAGGGGGTAGG + Intronic
932042782 2:68318693-68318715 CACTGAATGGCGAAGGGAGTGGG + Intronic
932300570 2:70664070-70664092 CAGAGAAAGGAGAAGGCGTGAGG + Intronic
932555380 2:72819489-72819511 CAGAGAAAGGAGGAGGAGATAGG - Intronic
932624526 2:73286771-73286793 AACAGAAAGGGGAAGGAGGAGGG - Intergenic
932751243 2:74373088-74373110 CACTGAAGGGAGAAGGGGATGGG - Intronic
932777849 2:74539174-74539196 CGCAAAAAGGAGAAGGAAGTTGG + Intronic
932873912 2:75430972-75430994 CAGAGAAGGGAGATAGGGGTGGG - Intergenic
933854071 2:86396437-86396459 CAGCGAAGGGCGAAGGGGGTGGG - Intergenic
933876056 2:86623174-86623196 CACAGAAAGGAGAGGGGCGCGGG + Exonic
935302909 2:101709023-101709045 CACAGAAGGGAGAAAGGAGGGGG + Intronic
935354769 2:102187830-102187852 CAAGGAAGGGAGAAGAGGGTGGG - Intronic
935682240 2:105647935-105647957 CACAGAAAGGGGTAGGGGAAAGG + Intergenic
936110790 2:109662838-109662860 CGCACAAGGGAGAAGGCGGTGGG - Intergenic
936745440 2:115570953-115570975 CACAGGACGGAGAGGGGAGTCGG + Intronic
937110583 2:119364063-119364085 CAGAGATAGGAGAAAGGGGGAGG + Intronic
937681210 2:124646809-124646831 TTCAGAAAAGAGAAGGGGGCTGG + Intronic
937777855 2:125801922-125801944 AACATAAAGGAGAAGGTGGTGGG + Intergenic
937807214 2:126160662-126160684 CACAGGAAGCACAAGGGGTTGGG + Intergenic
938070689 2:128306745-128306767 CTCAGAAAGGAGCATGGGGGTGG - Intronic
938127847 2:128687275-128687297 CACAGACACTAGACGGGGGTGGG - Intergenic
938225754 2:129614717-129614739 AACAGGAAGGAGGAGGGGGGAGG + Intergenic
938305164 2:130248303-130248325 CCCAGAAGGGAGAAGGGGTGTGG - Intergenic
938977588 2:136494617-136494639 CACAGACATGGTAAGGGGGTTGG + Intergenic
939059825 2:137408315-137408337 AAGATAAAGGAGAAGGGGGAAGG - Intronic
939095596 2:137830203-137830225 CGCAGAAAGGAGAAGCAGGAAGG - Intergenic
939428250 2:142069055-142069077 CAGAGAAGGGAGAAGGGTGGAGG - Intronic
939766624 2:146258079-146258101 CAGAGAAAGAAGAAGGGGTTTGG - Intergenic
940219383 2:151335847-151335869 CAGGGAAAGGAGAAGGGCGGTGG - Intergenic
941521046 2:166543510-166543532 GAAAGAAAGGGGAAGGGGGAAGG + Intergenic
942084302 2:172429212-172429234 CACAGAAATTAGCTGGGGGTGGG + Intronic
942729786 2:179051688-179051710 CAGCGAAAGGAGATAGGGGTGGG + Intergenic
943035823 2:182744917-182744939 CACAGAGAAGAGAAGAGGGGGGG - Intronic
943504435 2:188735874-188735896 CACACAAAGGATAAGTGAGTTGG + Intronic
943706830 2:191044580-191044602 CCCAGCCAGGAGAAGGGGGTGGG + Intronic
943757382 2:191570556-191570578 CACAGAAAGCAGACTGGGGATGG - Intergenic
944251983 2:197587602-197587624 CAGCGAAGGGAGAAAGGGGTAGG - Intronic
944485608 2:200201966-200201988 CAGTGAAAGGAGATAGGGGTGGG + Intergenic
945259640 2:207831729-207831751 CACTGGAAGGAGGAGGGGGCTGG - Intronic
945375771 2:209078346-209078368 CAGAGAAGGGAGATAGGGGTGGG - Intergenic
945376652 2:209084256-209084278 CAGAGAAGGGAGATAGGGGTGGG - Intergenic
946118674 2:217489551-217489573 CACAAAGAAGAGTAGGGGGTAGG - Intronic
946254610 2:218433562-218433584 CACAGCAAGGACAAGGGCCTGGG + Intronic
946385992 2:219384864-219384886 CAGAGATTGGAGAAGGGGGCTGG + Intronic
946387966 2:219397216-219397238 AACAGGAAAGAGACGGGGGTGGG - Intronic
946413420 2:219526993-219527015 CACGGAAAGGGGAAGGTCGTGGG - Intronic
946415379 2:219537474-219537496 CAGAGTCAGGAGAAGGGGATGGG + Intronic
946698428 2:222385277-222385299 CTAGGAAAGGAGAAGGGGCTTGG - Intergenic
946781362 2:223195203-223195225 CAGCGAAAGGAGATAGGGGTGGG + Intronic
948057014 2:235016120-235016142 CACAGCAAGGGGTGGGGGGTGGG + Intronic
948504273 2:238417757-238417779 CACACACAGGAGAAGGGTGTAGG - Intergenic
948504283 2:238417799-238417821 CACACACAGGAGAAGGGCGCGGG - Intergenic
948504294 2:238417841-238417863 CACACACAGGAGAAGGGCGCGGG - Intergenic
948504316 2:238417925-238417947 CACACACAGGAGAAGGGCGCGGG - Intergenic
948504338 2:238418009-238418031 CACACACAGGAGAAGGGCGCGGG - Intergenic
948504349 2:238418051-238418073 CACACACAGGAGAAGGGCGCGGG - Intergenic
948504360 2:238418093-238418115 CACACACAGGAGAAGGGCGCGGG - Intergenic
948504371 2:238418135-238418157 CACACACAGGAGAAGGGCGCGGG - Intergenic
948504382 2:238418177-238418199 CACACACAGGAGAAGGGCGCAGG - Intergenic
948504392 2:238418219-238418241 CACACACAGGAGAAGGGCGCAGG - Intergenic
948504402 2:238418261-238418283 CACACACAGGAGAAGGGCGCAGG - Intergenic
948535784 2:238645679-238645701 CACAGACCGGGGAAGGGGGATGG - Intergenic
1169066603 20:2697556-2697578 GAAAGAAAGAAAAAGGGGGTAGG + Intronic
1169537418 20:6560193-6560215 AACAGACAGGAGTAGGGGGATGG + Intergenic
1169650321 20:7859533-7859555 CAGAGAAAGAATATGGGGGTGGG + Intergenic
1169867673 20:10218421-10218443 CACTGAAAGGGGGTGGGGGTGGG + Intergenic
1170102462 20:12717668-12717690 CAAATAAAGGAGAAAGGAGTTGG - Intergenic
1170323183 20:15124747-15124769 CAAAGAAATGAGATGGGGGAAGG - Intronic
1170505841 20:17024959-17024981 CAGAGAAAGCAGAAGAAGGTGGG + Intergenic
1171009161 20:21498631-21498653 CACAGAAAGGAGATGGGAGTGGG + Intergenic
1171232650 20:23500059-23500081 CACAGAGAGGAGAGGCGGGGAGG + Intergenic
1171356308 20:24548010-24548032 CACTGAAGGAAGAAGGGGGAAGG + Intronic
1171878564 20:30599857-30599879 AACAGAAAGGGGTCGGGGGTGGG + Intergenic
1172122612 20:32607761-32607783 CACAGAAGAGAGAAGGGGACAGG - Intronic
1172623937 20:36336847-36336869 CCCAGGAAGGAGAAGGGGGCTGG - Intronic
1172870857 20:38134747-38134769 CAGAGAAAGGAGGCAGGGGTGGG + Intronic
1173201302 20:40957203-40957225 GAGAGAAGGGAGAAAGGGGTAGG + Intergenic
1173289759 20:41704204-41704226 CAGTGAATGGAGAAGGGGATGGG - Intergenic
1173370159 20:42427976-42427998 CAGAGAAGGGAGATAGGGGTGGG - Intronic
1174494510 20:50930567-50930589 CACAGGGCGGAGAAGGGGGTCGG + Intronic
1174507238 20:51024287-51024309 GACAGAAAGGAGAAGAGGAACGG - Intergenic
1174507241 20:51024319-51024341 GACAGAAAGGAGAAGAGGAACGG - Intergenic
1174892411 20:54410379-54410401 TTAAGAAAGGAGAAGGGAGTGGG + Intergenic
1175333602 20:58180803-58180825 CACAGAAAGAAGCAGGAGGGAGG - Intergenic
1175375644 20:58521849-58521871 CACAGCAAGGGGCAGGGGGATGG + Intergenic
1175637852 20:60600593-60600615 CACAAAATGGAGGAGGGGATGGG - Intergenic
1175871381 20:62211001-62211023 AAAAGAGAGGAGCAGGGGGTGGG - Intergenic
1175942670 20:62545140-62545162 CACTGCAAGGAGCAGGGTGTTGG - Intergenic
1177076855 21:16586891-16586913 CACAGAAATGGGAAGAGGGAAGG - Intergenic
1177244221 21:18501865-18501887 CAAAAACAGGACAAGGGGGTAGG + Intergenic
1177646301 21:23903683-23903705 AACAGCAAGGAGAAGGGAGAGGG + Intergenic
1177712761 21:24801453-24801475 CACAGAAGAAAGAAAGGGGTAGG + Intergenic
1178074928 21:29006094-29006116 CAGGTAAGGGAGAAGGGGGTTGG + Exonic
1179396998 21:41049704-41049726 CTCAGAAAGGAGAGGGTGGGAGG - Intergenic
1179773771 21:43645758-43645780 CAAACAAACGAGAAGCGGGTAGG + Intronic
1179946918 21:44684758-44684780 TACAGGAAGGAGATGGGGGAAGG + Intronic
1180112335 21:45666671-45666693 CACAGAAACTAGAAGGCTGTAGG - Intronic
1180943297 22:19674550-19674572 AACAGAAAGAACAAGGGGGCTGG - Intergenic
1180971198 22:19816732-19816754 TACAGACACGAGAAGGGGGAAGG - Intronic
1181311619 22:21947864-21947886 AACACAAAAGAGAATGGGGTGGG + Intronic
1181496141 22:23288523-23288545 CCCAGAAAGGACTAGGGGGCAGG - Intronic
1181624559 22:24114440-24114462 CACAGAAAAGAGTACGGGGCTGG - Intronic
1181825537 22:25512522-25512544 CACTGAATGAGGAAGGGGGTGGG - Intergenic
1181889973 22:26053941-26053963 AACAGAAAGGAGAACTGGGAGGG + Intergenic
1182302662 22:29346387-29346409 CACAGATAGGGGATGCGGGTTGG + Intronic
1183216906 22:36486601-36486623 CAGAGATAGGAGAAGGGTCTGGG + Intergenic
1183733335 22:39630234-39630256 CAGAGAAGGGAGAAAGGGTTGGG - Intronic
1184080634 22:42217177-42217199 CTCAGAGAGGTCAAGGGGGTGGG - Intronic
1184374377 22:44102540-44102562 CAGAGAGAGGTGAAGGGGCTGGG + Intronic
949153458 3:799140-799162 CTCAGAAACTAGAAGGGGCTGGG + Intergenic
949638155 3:6007070-6007092 CACAGCCAGGACAAGTGGGTGGG - Intergenic
950289249 3:11770387-11770409 CCCAGCAAGGGGAAGGGGCTTGG - Intergenic
950415351 3:12866162-12866184 AACAGAAAGGAGGTGGGGGAGGG - Intronic
950416983 3:12874450-12874472 AACAGAAAGGAGGTGGGGGAGGG - Intergenic
950457182 3:13099778-13099800 CAGAGAGAGGAGCTGGGGGTAGG - Intergenic
950806963 3:15613485-15613507 GAGAGAAGGGAGAAGGGAGTGGG - Intronic
951918269 3:27824467-27824489 CACAGAAGGGAGACCAGGGTAGG - Intergenic
952276894 3:31886023-31886045 GAAAGAAAGGAGAAGGAGATGGG + Intronic
952412892 3:33065210-33065232 CACTGAAAAAAGAAGGTGGTTGG + Intronic
952508304 3:34028115-34028137 CAGAGAAAGAACAAGAGGGTCGG - Intergenic
953979091 3:47404847-47404869 TGCAGCAAGGAGAAGGGGGAAGG - Intronic
954140713 3:48603776-48603798 CAGAGACAGGGGAAGGGGGTTGG - Intronic
954240861 3:49292413-49292435 CACACATGGGAGAAGGGGGTTGG - Intronic
954597866 3:51842245-51842267 TTCAGAAAGAAGAAGGGGATGGG - Intergenic
954803122 3:53198889-53198911 GCCAGAGAGGAGAAGGGGTTGGG + Intergenic
955088078 3:55722197-55722219 CAGAGATAAGAGAATGGGGTTGG + Intronic
955291231 3:57693963-57693985 CTAAGAAAGGAGGAGGTGGTAGG - Intergenic
955457005 3:59133655-59133677 CACAGAAAGCAGAAGGGCTTTGG + Intergenic
955566225 3:60249715-60249737 CACACACGGGAGAAGGGGGAAGG + Intronic
955806024 3:62735761-62735783 CAAAGAAAAGAAAAGGTGGTAGG - Intronic
955918695 3:63931884-63931906 CACAGGAAGGACGAGGGTGTGGG + Intronic
956407886 3:68948056-68948078 CACAGGAAGGAGAAAGAAGTTGG + Intergenic
956708915 3:72023411-72023433 CAGCGAAGGGAGATGGGGGTGGG - Intergenic
957407079 3:79785321-79785343 CACAGGAAGGGGATGGGGGAGGG + Intergenic
957540129 3:81557501-81557523 GAAAGAAAGGAGAAGGGAGAAGG + Intronic
957768280 3:84655453-84655475 CACAGAAAGGTGAAGGTGGAAGG + Intergenic
958956117 3:100467317-100467339 AACAGAAGGGCCAAGGGGGTGGG - Intergenic
960819838 3:121717478-121717500 CACAGAAAGGAGCAAGGGTAAGG + Intronic
961253239 3:125523978-125524000 CACTGAAAGGAGAAATGGGGTGG - Intergenic
961784950 3:129342063-129342085 AACAGAAAGGAGGTGGGGGAGGG - Intergenic
961820293 3:129572460-129572482 CTCAGAGAGGAGAAGGGGCTTGG + Intronic
962553315 3:136518899-136518921 CACAGAAAGGCAATGGGGGGAGG + Intronic
962777246 3:138673761-138673783 CACATAACTGGGAAGGGGGTTGG - Intronic
962938777 3:140106460-140106482 CACAGGATGGAGCAGGAGGTGGG + Intronic
963638040 3:147824085-147824107 CACAGAAAGGAGCAGGGGAGTGG - Intergenic
963814473 3:149813780-149813802 CAGGGAAAGAAAAAGGGGGTGGG - Intronic
964538965 3:157757741-157757763 GACAGAAAAGGGATGGGGGTTGG + Intergenic
965070008 3:163907814-163907836 CAGTGAAAGGAGATAGGGGTGGG - Intergenic
965625213 3:170677952-170677974 CAGTGAAAGGAGACAGGGGTGGG + Intronic
965640384 3:170823455-170823477 CAGAGAAGGGAGATAGGGGTGGG + Intronic
965661455 3:171046292-171046314 CACAGCAAGGGTAAGGGGGTAGG + Intergenic
966234755 3:177688169-177688191 CACAGAAAGGAAAAGAGGGAAGG - Intergenic
966516636 3:180828248-180828270 TACAGGAAGGAGAAGGCGGCCGG - Intronic
966742310 3:183245255-183245277 AACAGAAAGGAGAAGGGGAATGG + Intronic
966908167 3:184542683-184542705 AACAGATGGGAGAAGGGGGGAGG + Intronic
967407883 3:189137758-189137780 CAGAGACACGAGAAGGGGGAAGG - Intronic
967654261 3:192027478-192027500 GACAGAAAGGCAAAGGGGGCTGG - Intergenic
967862283 3:194161125-194161147 GAGAGAAAGGAGTATGGGGTGGG - Intergenic
967976283 3:195036289-195036311 CACCGAGGGGAGAAAGGGGTCGG + Intergenic
968041419 3:195592257-195592279 GAGAGAAAGGAGAAGGAGGGAGG + Intergenic
968186375 3:196635710-196635732 CAAAGAAAGGAGGAGGAGGCCGG - Intergenic
969264779 4:6057338-6057360 CAGAGAAGGGAGGAGGGAGTTGG - Intronic
969962502 4:10959424-10959446 CACAGAGAGGGGAAAGGGGTGGG + Intergenic
970852535 4:20618170-20618192 CAGACAAAGGAGAAGGAGGAAGG - Intronic
971423160 4:26492106-26492128 CACAGAAACAAGAAGGGGAAGGG + Intergenic
971424332 4:26501377-26501399 CACAGAAAGGAGATGGGGTGAGG - Intergenic
972156784 4:36172892-36172914 CACAGAAAGGAGCAGCAGGATGG - Intronic
972250410 4:37294056-37294078 TCCAGAAAGGAGTAGGGGGGTGG - Intronic
973110115 4:46388898-46388920 AACAGAAAGGAAAAGGGTGGGGG - Intronic
973139975 4:46754527-46754549 CACAGGAAGGGGTGGGGGGTGGG + Intronic
973199642 4:47485572-47485594 AACAGAAAGGAAAAGCGGGTGGG - Intronic
973944862 4:55945902-55945924 CAGCGAAAGGAGATAGGGGTGGG - Intergenic
976467599 4:85388379-85388401 CAGAGAATGGAGAAGGTGCTTGG + Intergenic
976505847 4:85846322-85846344 CACAGAAAGCAGATTGGGGGTGG - Intronic
977174183 4:93798951-93798973 CAGAGAAAAAAGCAGGGGGTAGG + Intergenic
977263159 4:94822562-94822584 AAGAGAAGGGAGAAGGGAGTTGG - Intronic
978244094 4:106551518-106551540 CAGAGAAGGGAGATAGGGGTGGG - Intergenic
979367016 4:119837423-119837445 GAAATAAAGGAGAAGGGGATGGG + Intergenic
979548712 4:121965690-121965712 CACAGAAGGCAGTAGGGGATGGG + Intergenic
979682786 4:123480113-123480135 CTCAGAGAGGTGAAGGGGTTTGG + Intergenic
979705290 4:123713458-123713480 CCCAGGAAGTACAAGGGGGTGGG + Intergenic
980285773 4:130776915-130776937 CCCAGAAAGCACAAGGGGTTGGG + Intergenic
980559838 4:134459071-134459093 CACAGAAAGGAGAAGAATGAAGG - Intergenic
980875714 4:138660023-138660045 CACAGAAAGGAGCAGCGGAGAGG + Intergenic
980888961 4:138793777-138793799 GAAAGAAAGGAGAAGAGGGGAGG + Intergenic
980928013 4:139158075-139158097 CAGAGAAGGGAGATAGGGGTGGG + Intronic
980990900 4:139737454-139737476 AAAAGAAATGGGAAGGGGGTGGG + Intronic
981521145 4:145663643-145663665 CAGTGAATGGAGAAGGGAGTGGG + Intergenic
981816426 4:148835877-148835899 CCCAGAAAGGAAAAGGAGGATGG - Intergenic
982180825 4:152746810-152746832 CAGCGAAGGGAGATGGGGGTGGG + Intronic
982304326 4:153914045-153914067 TACAGAAATGAGAAAGGGGAAGG - Intergenic
982612695 4:157596685-157596707 CAGCGAAGGGAGAAAGGGGTGGG + Intergenic
983056023 4:163100040-163100062 CAGAGAAGGGAGATAGGGGTGGG + Intergenic
983056581 4:163103990-163104012 CAGAGAAGGGAGATAGGGGTGGG + Intergenic
983533309 4:168832698-168832720 CAAAGAAAGGAGGATGGGCTTGG - Intronic
983805323 4:171986207-171986229 CAGAGAAAGGAGATAAGGGTGGG + Intronic
983882160 4:172945273-172945295 CACAGAAAGGAGATCGGGAAAGG + Intronic
985985880 5:3515871-3515893 CACAGAGTGAAGAAGAGGGTGGG + Intergenic
986213630 5:5697981-5698003 CTCAGAAAGGAAAAGAGGGATGG + Intergenic
987011787 5:13773854-13773876 CAGACAAAGGAGGAGTGGGTGGG + Intronic
987092542 5:14521210-14521232 CACTGAAAGAGGAAGGGAGTTGG - Intronic
987214638 5:15721535-15721557 CAGAGAGAGGAGAAAGGGGAAGG - Intronic
988264845 5:28935349-28935371 CACAGAGAGGAGAAGGCAATCGG - Intergenic
988404625 5:30808245-30808267 GAAAGAAAGGAGAAGGAAGTAGG + Intergenic
988483099 5:31645937-31645959 CTCAGTAGGGGGAAGGGGGTGGG + Intronic
988665110 5:33318334-33318356 CAGAGAGAGGAGATGGGGATTGG + Intergenic
988893546 5:35647249-35647271 CTTAGTAAGGAGAAGGGGGAGGG + Intronic
989112741 5:37922962-37922984 CTCAGAAGGAAGAAGGGGGTAGG - Intergenic
990260428 5:54016015-54016037 TACAGAAAGGAAAAGGGCTTGGG - Intronic
990603601 5:57385302-57385324 CACAGAATGTAGAAGTGGGAGGG - Intergenic
990830504 5:59951928-59951950 CAGAGAAAGGAGAAGTGAGGAGG - Intronic
990897671 5:60716193-60716215 CACAGGAAGCACAAGGGGTTAGG - Intergenic
991437759 5:66614043-66614065 CACTTAAAGGAGAAGGTGCTAGG + Intronic
991537097 5:67681624-67681646 CAAAGAAAGGACAAATGGGTGGG - Intergenic
992238336 5:74735997-74736019 AACAGAAAGGAGTAAGGGGAAGG - Intronic
992541159 5:77765570-77765592 GAAAGAGAGGAAAAGGGGGTAGG - Intronic
993498526 5:88637151-88637173 CAAAGAATGAAGGAGGGGGTTGG - Intergenic
993948045 5:94138385-94138407 CCCAGAAAGCACAAGGGGTTGGG - Intergenic
995443976 5:112222623-112222645 CAGAGAAAGAAGAATGGAGTTGG - Intronic
995907980 5:117149498-117149520 CACAGAAAGCAGGGAGGGGTGGG - Intergenic
996337033 5:122395663-122395685 CACACAAAACAGAAGGGGGCAGG - Intronic
996387597 5:122925263-122925285 GAAGGAAAGGAGAAGGGGGAGGG - Intronic
997632541 5:135379721-135379743 CACTGAAAGGAGAAGGAAGAAGG - Intronic
998961031 5:147487221-147487243 CAAAGACAGGAGAAAGGGGGAGG - Intronic
999261599 5:150241886-150241908 CACAGAATGGGGAAGGGGCCAGG + Intronic
999468585 5:151831028-151831050 CCCAGAAAGCACAAGGGGTTGGG + Intronic
999687980 5:154119197-154119219 GACAGAAATGAGAGGTGGGTGGG + Intronic
999827150 5:155284646-155284668 CACACAAAGGAACAGGGGCTAGG - Intergenic
1000865158 5:166504606-166504628 AAAAGAAAGGAGAAGGAGATTGG - Intergenic
1000954898 5:167531658-167531680 CTTAGAGAGGAGAAAGGGGTGGG - Intronic
1000956945 5:167554660-167554682 CACAGAAAGGTGAAGTAAGTTGG + Intronic
1001022042 5:168191310-168191332 CATAGAAAAGAGGAGGGGATGGG - Intronic
1001144910 5:169175376-169175398 CACAGAAAGGTTAATGGGTTAGG + Intronic
1001992816 5:176132564-176132586 CACAGATAGGAGCAGGTTGTAGG + Intergenic
1002080514 5:176734533-176734555 GAAAGAAAGGAAAAGGGAGTGGG - Intergenic
1002097999 5:176843424-176843446 GACAGAAAGCAGAAGGGGGTTGG + Intronic
1002336451 5:178482422-178482444 GACAGAAAGTAGAACGGGGGCGG + Intronic
1002757803 6:178413-178435 CACTGAAAGGAGCAGAGTGTGGG + Intergenic
1002939792 6:1705896-1705918 CACAGCAATGAGAAGGGTGGCGG + Intronic
1003053021 6:2796929-2796951 GGCAGGAAGGAGGAGGGGGTGGG + Intergenic
1003218728 6:4137468-4137490 CACAGAAAAGAGTGGGGTGTGGG + Intergenic
1003824309 6:9935719-9935741 GACTGAATTGAGAAGGGGGTGGG - Intronic
1004574899 6:16886263-16886285 CAGTGAAGGGAGATGGGGGTGGG - Intergenic
1004924231 6:20402984-20403006 CCCCGGATGGAGAAGGGGGTGGG + Intronic
1005110919 6:22280589-22280611 CACAGCAGGCAGAAGGGGATGGG + Intergenic
1005132042 6:22520500-22520522 GAGAGAAGGGAGAAGGGGGAAGG + Intergenic
1005584912 6:27267132-27267154 GAAATATAGGAGAAGGGGGTTGG - Intergenic
1006152754 6:31998072-31998094 CACAGAATGAAGAAGGGCTTTGG - Intronic
1006159062 6:32030809-32030831 CACAGAATGAAGAAGGGCTTTGG - Intronic
1006303684 6:33207166-33207188 CAGAGAAAGGAGAGGGGTGGGGG - Intergenic
1006616583 6:35332133-35332155 CACAGGAAGCAGAAGGGGTTGGG + Intergenic
1006828888 6:36956962-36956984 TGCTGAAAAGAGAAGGGGGTAGG - Intronic
1006942736 6:37763648-37763670 CACACCAAGGAGAAGGGAATCGG + Intergenic
1007127161 6:39435142-39435164 GACAGAAAGGGCAAGGTGGTGGG + Intronic
1007634883 6:43293351-43293373 CTCAGAAAAGAGACAGGGGTGGG + Intergenic
1007691549 6:43704933-43704955 CAAAGAAAGGGGGAGGGTGTGGG - Intergenic
1007739187 6:44000719-44000741 CAGTCAAAGGAGAAGGGGGCAGG + Intronic
1007765578 6:44157930-44157952 CCCAGAAAGGAGAAAGGGGGAGG + Intergenic
1007788325 6:44294830-44294852 CACAGAAAGGAGAGGAGGTGGGG + Intronic
1007950594 6:45868730-45868752 CAGATAAAGGAGTAGGGTGTGGG + Intergenic
1008440428 6:51526486-51526508 CCCAGAAAGAAGAGGGGGTTAGG - Intergenic
1008627530 6:53332551-53332573 CACAGAACGGAGCAGGAGGAGGG + Intronic
1008816124 6:55568902-55568924 CACAGAAAGAAGAAAGGGTCAGG + Intronic
1009464087 6:63950469-63950491 CAGAGAAGGGAGATAGGGGTGGG - Intronic
1009502342 6:64430760-64430782 AACAGAATGCAGAAAGGGGTGGG + Intronic
1009967907 6:70596395-70596417 GAAGGAAAGGAGAATGGGGTAGG - Intergenic
1010071204 6:71748460-71748482 CAGCGAAGGGAGATGGGGGTGGG + Intergenic
1010205717 6:73321041-73321063 TACAGAATGGAGAAGGGGTGGGG + Intergenic
1010869681 6:81021991-81022013 AAGAGAAAGGAGAAGGGGTAGGG - Intergenic
1011134255 6:84082806-84082828 GACAAAAAGGAGAAAGGGGTGGG - Intronic
1011198540 6:84808323-84808345 CACTGAAACAAGAATGGGGTGGG - Intergenic
1011198546 6:84808357-84808379 CACTGAAACAAGAATGGGGTGGG - Intergenic
1011355363 6:86467782-86467804 TACAGAAAGGAATAGGGGTTTGG + Intergenic
1011476881 6:87757019-87757041 CACAGAAAGCAGAAGCTTGTGGG + Intergenic
1012078429 6:94725429-94725451 CACAGAAAGAGGAAGGGGAGAGG + Intergenic
1012446530 6:99312575-99312597 AACATAAGGGAGAAGAGGGTAGG + Intronic
1014795506 6:125719833-125719855 CTGAGAAAGGAGTTGGGGGTAGG + Intergenic
1014800074 6:125769064-125769086 CACACAAAGGTGAACGGAGTTGG + Intergenic
1014977735 6:127909757-127909779 CACACAAAGGAGAATGGTGATGG + Intronic
1015337633 6:132058847-132058869 CACAGAAAGCAGAATGGGTCTGG + Intergenic
1015411062 6:132894425-132894447 TAGAGGAAGGAGGAGGGGGTTGG + Intergenic
1015885942 6:137918821-137918843 CACAGAATGGAGATGGGAGTGGG - Intergenic
1016709396 6:147152840-147152862 CAAACAAAGGAGAAGAGGGCAGG - Intergenic
1016879799 6:148899894-148899916 CACAGAAGGGTGATGGGGGGTGG - Intronic
1017775749 6:157679472-157679494 CATAGAGGAGAGAAGGGGGTGGG - Intergenic
1017786004 6:157757800-157757822 CAAAGAAAGGAATAGGGGCTAGG + Intronic
1017804198 6:157929209-157929231 CAAACAAAGGAGAAGGAGGGAGG - Intronic
1018268968 6:162055582-162055604 CACAGAAAGGAGGAGGAGGGAGG + Intronic
1018762078 6:166901519-166901541 CACAGTAAAGAGAAGGCCGTGGG + Intronic
1018768378 6:166951926-166951948 CACAGATGGGAGGAGGGGTTAGG - Intronic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1020480543 7:8654827-8654849 CACAGAAGAAAGAAGGGGTTTGG + Intronic
1021117040 7:16755242-16755264 CACCAACAGGAGAAGGAGGTTGG + Intronic
1021263934 7:18495764-18495786 CACAGATAGGAGAAGGGCACCGG + Intronic
1022014242 7:26335417-26335439 CACAAAAAGAAGAAAGGGCTGGG - Intronic
1022096908 7:27146889-27146911 GGCAGAAAGGAGAGGGGGTTGGG + Intronic
1022573031 7:31472078-31472100 CAGAGAAGGGAGATAGGGGTGGG + Intergenic
1022806645 7:33829264-33829286 CACTGAAGGGCGAAGGGGGATGG - Intergenic
1024031201 7:45461195-45461217 CTCAGAAAGCAGAAGTGAGTGGG + Intergenic
1024202485 7:47121211-47121233 GCCAGAAAGTAGAAGGGGGTGGG + Intergenic
1025035270 7:55589713-55589735 CACAGAAAAGAGAAGGGTGAGGG - Intergenic
1026070992 7:67119476-67119498 CTCAGAAGGGAGAAGGTGGTGGG - Intronic
1026582839 7:71632423-71632445 CAAAGAAAGGAGAAGGCAGTAGG + Intronic
1026705908 7:72692822-72692844 CTCAGAAGGGAGAAGATGGTGGG + Intronic
1027053205 7:75032512-75032534 CTCAGAGAGGAGAAGGGGAAGGG - Intronic
1027308473 7:76927775-76927797 CACAGAAAGGAGAAGATACTGGG + Intergenic
1027344081 7:77239181-77239203 CATAGAAAGGACAGGGTGGTAGG - Intronic
1027494756 7:78873693-78873715 CACAGACAGGGCAAGGGAGTGGG - Intronic
1027602435 7:80255650-80255672 CTCACAAAGGAGAAAGGGTTAGG - Intergenic
1028235851 7:88360938-88360960 TCCAGAAAGGAGATGGGGGCTGG + Intergenic
1028544735 7:91985646-91985668 CACAGAAAAAAGAAAGGGGGTGG - Intronic
1028733410 7:94179256-94179278 CCCAGAAAGGAGAGGGAAGTGGG - Intergenic
1028913499 7:96233571-96233593 GACGGAATGGCGAAGGGGGTTGG + Intronic
1029546364 7:101212440-101212462 TGCAGGAAGGAGATGGGGGTGGG + Intronic
1029564124 7:101323736-101323758 CATAGAAAGGAGAACCGGGCTGG - Intergenic
1029657230 7:101935311-101935333 CAGCGAAGGGAGAAAGGGGTGGG - Intronic
1030847089 7:114432392-114432414 CACAGATAGGAAAAGGAGATTGG + Intronic
1031217796 7:118919895-118919917 CACTGAAAGGAGTAGGAGGTTGG + Intergenic
1031543367 7:123023322-123023344 CAGATAGAGGAGATGGGGGTTGG + Intergenic
1031616458 7:123887729-123887751 CACACAAAGGTGAAGAGGCTAGG - Intergenic
1031777926 7:125923989-125924011 CAGTGAAGGGAGAAAGGGGTGGG - Intergenic
1031840231 7:126728849-126728871 TACAGCAAGGAGAACAGGGTGGG - Intronic
1032398263 7:131606274-131606296 CAGAGAAGGGAGAAGAGGTTAGG - Intergenic
1033909823 7:146248915-146248937 CAGTGAAGGGAGAAAGGGGTGGG + Intronic
1034054982 7:148024829-148024851 CAAAGAAAGGAGAAGGCAGGGGG - Intronic
1034227818 7:149497177-149497199 CAGAGAAAGGAGCCGCGGGTGGG + Intronic
1034343267 7:150371285-150371307 CCCAGAAAGGAGTCGGGGCTGGG - Exonic
1034390014 7:150778927-150778949 AAGAGAAAGGAGATGGGAGTGGG - Intergenic
1034901791 7:154912349-154912371 CACAGAAAGGAGTGGACGGTGGG + Intergenic
1035451179 7:158977889-158977911 GACAGAAGGTAGAAGGGGGTGGG - Intergenic
1036469764 8:9042179-9042201 CACAGAAAAGAGAAGGAACTTGG + Intronic
1036538533 8:9677857-9677879 GAAAGAAAGGAGAAGGGGAATGG - Intronic
1036975389 8:13405291-13405313 CACAGAGGGGAGAAGGAGGGAGG - Intronic
1037598659 8:20374916-20374938 CACAGAAAGGTGAAGTGTCTGGG - Intergenic
1037882003 8:22578125-22578147 CACAGACAGGTGAGGGGCGTGGG + Intergenic
1038152987 8:24958905-24958927 CCCAGAAAGGAGAGGGGCGGCGG + Intergenic
1038241213 8:25809265-25809287 CACAGTGAGGGGAAGGGGTTGGG + Intergenic
1038310545 8:26443118-26443140 CACTGAAAGGAGAAAGGGGGAGG + Intronic
1039462788 8:37760222-37760244 CACTGAATGGATAAGGGGGTGGG + Intergenic
1039923725 8:41910617-41910639 CACAGAAACGTGTCGGGGGTGGG + Intergenic
1040331995 8:46390440-46390462 CACAGAATGGCGTAGGGGGAGGG + Intergenic
1042219213 8:66457065-66457087 CACAGAAAGGCCATGGGGCTGGG - Exonic
1042556638 8:70038844-70038866 AAAAGAAAAGAAAAGGGGGTGGG + Intergenic
1042714803 8:71761040-71761062 CACACAGTGGAAAAGGGGGTGGG + Intergenic
1042783724 8:72522937-72522959 CACAGACAGGGGCAGAGGGTGGG + Intergenic
1042820766 8:72927564-72927586 CACAGAAAAGAGTTGGGGGTCGG - Intronic
1043055311 8:75430448-75430470 CAAATAAAAGAGACGGGGGTAGG + Intronic
1043495144 8:80792090-80792112 GACAGAAAGGAAAAGGCAGTGGG + Intronic
1044440995 8:92223295-92223317 CCCAGGAAGCACAAGGGGGTGGG - Intergenic
1044922470 8:97180614-97180636 CAGCGAAGGGAGATGGGGGTGGG - Intergenic
1045130806 8:99149927-99149949 CACAGACAGGAGAAGGGGTATGG - Intronic
1045341006 8:101254474-101254496 CACAGAAAGGTGAAGGGCTGGGG - Intergenic
1045504785 8:102770701-102770723 CATAGAAAGGAGATGCAGGTGGG + Intergenic
1045720262 8:105101579-105101601 CTCAGGAAGGAGTAGGGAGTTGG + Intronic
1046691673 8:117292747-117292769 GACAGAAAGGAGATGAGTGTAGG + Intergenic
1046833110 8:118768928-118768950 CACAGGACTGAGAAGGGGGTTGG - Intergenic
1048010132 8:130448793-130448815 CAGAGAAGGGAGTAGGTGGTGGG + Intergenic
1048438317 8:134438958-134438980 AACAGGAAGGAGAAGGAAGTGGG - Intergenic
1048606804 8:135977166-135977188 CTCAGAAAATAGAAGGGGGGAGG + Intergenic
1048683614 8:136875336-136875358 AGCAGAAATGAGAAGGGAGTTGG + Intergenic
1048764568 8:137830268-137830290 CAGTGAAGGGAGATGGGGGTGGG + Intergenic
1048863207 8:138739218-138739240 CATGGAAATGAGAAGAGGGTTGG - Intronic
1049235649 8:141510936-141510958 CCCAGGCAGGAGAAGGGGGCTGG + Intergenic
1049358721 8:142201680-142201702 CACAGCAGGGAGAGGGGGGCCGG + Intergenic
1049855684 8:144860381-144860403 TACAGAAAGAAAAGGGGGGTTGG + Intergenic
1050061826 9:1717425-1717447 CAAAGAAAGGAGAAAATGGTGGG + Intergenic
1050221656 9:3397917-3397939 CACAGAGAGCAGAAGTGGCTAGG + Intronic
1050252332 9:3758001-3758023 TAGACAAAGGAAAAGGGGGTTGG - Intergenic
1050374826 9:4959818-4959840 AACAGAAAGGGGAAAGGGATGGG - Intergenic
1050580847 9:7054548-7054570 CACAGAAGGAAGAAGGCGGTAGG + Intronic
1051527603 9:18064204-18064226 AAGAGCAAGGAGAAGGGTGTGGG + Intergenic
1052254126 9:26433717-26433739 GACAGAAAGGAAAGGAGGGTGGG + Intergenic
1052735746 9:32340706-32340728 CACAGAAAGGTGAATGTGGAGGG - Intergenic
1053286445 9:36852382-36852404 CTCAGAAAGGAGAAGGGACTTGG + Intronic
1054337134 9:63817337-63817359 CACAGAAAGGAGAACTGGCCTGG + Intergenic
1055051568 9:71986799-71986821 CACTGACAGGAGAAGGGGTGAGG - Intergenic
1055112814 9:72576380-72576402 GTCAGAAAGGAGAAAGGGGAGGG - Intronic
1055339844 9:75269580-75269602 CACAAAAAGGAGAAGTGACTGGG - Intergenic
1055626366 9:78180982-78181004 CAGAGAAGGGAGATAGGGGTAGG - Intergenic
1055627259 9:78186697-78186719 CAGAGAAGGGAGATAGGGGTGGG - Intergenic
1055792279 9:79935682-79935704 GAAAGAAAGGAGACGGGGGTGGG - Intergenic
1056139420 9:83660670-83660692 CAGAGAAAGGGGGACGGGGTGGG - Exonic
1056672815 9:88645895-88645917 GAAAGAAAAGAGAAGGGGATGGG + Intergenic
1056874152 9:90311917-90311939 CATAGAAATGAGAAGGTTGTGGG - Intergenic
1057012413 9:91616890-91616912 CTCAGAAAGGGGAAGGAAGTTGG + Intronic
1057439024 9:95068813-95068835 CACTGAGAAGAGAAGGGGGAGGG + Intronic
1057958553 9:99432945-99432967 CACCCAAAGCAGAAGGGGGGTGG - Intergenic
1058168560 9:101650249-101650271 AACAGAAAGGAGAAAAGAGTTGG - Intronic
1058713014 9:107697381-107697403 AACAGACAGGAGCAGGGTGTGGG + Intergenic
1058766763 9:108189461-108189483 CCAAGATAGGAGAAGGGGGTAGG + Intergenic
1058908601 9:109500068-109500090 CACAGAGAGGATAAGGCAGTGGG - Intergenic
1058976237 9:110127673-110127695 GACAGGAAGGAGAAGGAGCTGGG - Intronic
1059098024 9:111439894-111439916 CACAGCAAGGAGAAGGAAGGAGG + Intronic
1059348035 9:113645578-113645600 CACAGACAGGAGATGGGGATGGG - Intergenic
1059518142 9:114914737-114914759 CCCAGAAAGGAGAAGGGTGTGGG + Intronic
1059549743 9:115217015-115217037 CACAGAAAGGAGAAGTTGAGAGG + Intronic
1060105646 9:120871273-120871295 TACAGGAAGGAGAAGTAGGTGGG - Intronic
1060813088 9:126620882-126620904 CAGCCAATGGAGAAGGGGGTAGG + Intronic
1060963894 9:127701145-127701167 GACAGGTAGGAGAAGGGGTTGGG - Intronic
1061027981 9:128062921-128062943 CACAGTGAGGAGAAAAGGGTGGG + Exonic
1061198639 9:129123023-129123045 AACAGAGAGGAGAATGGGGATGG - Intronic
1061414030 9:130436239-130436261 GACAGAAAGGTCAAGGGGGTGGG + Intergenic
1061422064 9:130477912-130477934 CACAGAAAGGAGGATAGGGTGGG + Intronic
1061940872 9:133883096-133883118 CAGAGAGAGCAGCAGGGGGTGGG - Intronic
1062150022 9:135013380-135013402 CACAGAGAGGAGACGGAGATAGG - Intergenic
1062240723 9:135536377-135536399 GACTGCAAGGAGAAGGGGGCGGG - Intergenic
1062454619 9:136629683-136629705 CCAAGAAGGGAGAAGGGGCTGGG - Intergenic
1185813316 X:3130633-3130655 CACAGAGAAGCTAAGGGGGTTGG - Intergenic
1185857931 X:3553245-3553267 CAGCGAAGGGAGATGGGGGTGGG + Intergenic
1185961670 X:4551571-4551593 CACAGACAGGACATGGGGGAGGG + Intergenic
1186172428 X:6891540-6891562 GACAGAGAGGAGAAAGGAGTTGG - Intergenic
1186611935 X:11146096-11146118 CACAGTTAGGAGAAGGAGGAAGG + Intronic
1186754675 X:12658055-12658077 CATAGAAAGGAAAAGTGGCTCGG + Intronic
1187086050 X:16044813-16044835 CAGCGAAGGGAGATGGGGGTGGG + Intergenic
1187200917 X:17133039-17133061 CACAGAAAGTTGAAGGCGCTGGG - Intronic
1187565469 X:20445229-20445251 GACAGAAAGAAGAAAGGAGTGGG - Intergenic
1187824210 X:23318445-23318467 CAGAGAAGGGAGAAGGAGGTTGG - Intergenic
1188101840 X:26097492-26097514 CATAAAAAGTAGAAAGGGGTGGG + Intergenic
1188105645 X:26144265-26144287 CACAGAAAGCAAGAGCGGGTGGG + Intergenic
1188158744 X:26774973-26774995 CTCAGAAAGGGGAAGGTGGGAGG + Intergenic
1188643757 X:32538467-32538489 CACGGAAGGGAGATAGGGGTGGG - Intronic
1189353326 X:40293599-40293621 CCAGGAAAAGAGAAGGGGGTCGG + Intergenic
1189551845 X:42101654-42101676 CTCAGAAATGACAAGGGTGTTGG - Intergenic
1189928830 X:45986138-45986160 CCCAGAAAGGAGAGGTGGGGAGG - Intergenic
1190490540 X:50978500-50978522 GACAAAAAGGAAAAAGGGGTGGG + Intergenic
1190842117 X:54154903-54154925 GACAGAAAAGAGAAGGGGCCGGG + Intronic
1190881320 X:54494876-54494898 CAGACAGAGGAGAAGGGGGTTGG + Intronic
1191912210 X:66163163-66163185 CCCAGAGAAGAGAAGGGAGTGGG + Intronic
1191978694 X:66902080-66902102 GACACAAAGGACAATGGGGTTGG + Intergenic
1192234177 X:69285608-69285630 AAGAGAATGGAGAAGGGGGAAGG + Intergenic
1192325600 X:70129336-70129358 TACAGAAAGGAATAGGGGCTTGG + Intergenic
1192538157 X:71946184-71946206 CACAGACAGGAGCAGGAGGCAGG + Intergenic
1193994042 X:88343514-88343536 CAGAGAAGGGAGATAGGGGTGGG + Intergenic
1194741192 X:97576104-97576126 GACTGTAAGGAAAAGGGGGTTGG + Intronic
1195157898 X:102141792-102141814 GACAGACAGGAGACAGGGGTAGG + Intronic
1195308544 X:103608576-103608598 GACAGACAGGAGACAGGGGTAGG - Intronic
1195327154 X:103767032-103767054 CAGAGAAGGGAGACAGGGGTGGG + Intergenic
1195701373 X:107708232-107708254 CACTGAAAGAAACAGGGGGTAGG - Intergenic
1196321775 X:114349370-114349392 CTCAAAAAGGAAAAGGGGGGGGG + Intergenic
1196358210 X:114820301-114820323 CACATCATGAAGAAGGGGGTAGG + Intronic
1196484084 X:116183893-116183915 CACAGAAAGGAGAAGGAGAAAGG + Intergenic
1197707424 X:129644357-129644379 GAAAGCAAGGAGAAGGGAGTGGG - Intergenic
1197754033 X:129982745-129982767 GAGAGAGAGGAGAAGGAGGTCGG + Intronic
1197879029 X:131145411-131145433 CACAGAATGGAAAAGGGGAATGG - Intergenic
1197992380 X:132332060-132332082 TACAGTAAGGAGAAAGGGGTGGG - Intergenic
1198129659 X:133680990-133681012 CATAAAAATGAGAGGGGGGTAGG + Intronic
1200183013 X:154162656-154162678 CACAGAGAGGGGGAGTGGGTCGG + Intergenic
1200188667 X:154199770-154199792 CACAGAGAGGGGGAGTGGGTCGG + Intergenic
1200194316 X:154236911-154236933 CACAGAGAGGGGGAGTGGGTCGG + Intergenic
1200200072 X:154274714-154274736 CACAGAGAGGGGGAGTGGGTCGG + Intronic
1200307757 X:155045719-155045741 CACAGAAAAGGGAAGGGGGCTGG + Intronic
1200377255 X:155796252-155796274 CTCAGAAAGGGGGAGGGGGCAGG - Intergenic
1200942641 Y:8801665-8801687 CAGTGAAAGGAGATAGGGGTGGG - Intergenic
1201268281 Y:12229903-12229925 CACAGAGAAGCTAAGGGGGTTGG + Intergenic
1201365862 Y:13205512-13205534 CAGAAAAGGGAGATGGGGGTGGG + Intergenic
1201454013 Y:14148437-14148459 GAGAAAAAGGAGAAAGGGGTTGG - Intergenic
1201454031 Y:14148592-14148614 CACATAAAGGAGAGAGGGGAAGG - Intergenic
1201595196 Y:15660488-15660510 CAAAGCAAGAAGAAGGGGGAAGG - Intergenic
1202459401 Y:25092624-25092646 CACAGAAAGGGCCAGGAGGTTGG + Intergenic