ID: 1129654733

View in Genome Browser
Species Human (GRCh38)
Location 15:77516623-77516645
Sequence CTGGGGACTCTTGAGGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129654733_1129654742 -6 Left 1129654733 15:77516623-77516645 CCATCCCCCTCAAGAGTCCCCAG No data
Right 1129654742 15:77516640-77516662 CCCCAGGGGAGATGTCTGAGTGG No data
1129654733_1129654746 3 Left 1129654733 15:77516623-77516645 CCATCCCCCTCAAGAGTCCCCAG No data
Right 1129654746 15:77516649-77516671 AGATGTCTGAGTGGTGAGAAGGG No data
1129654733_1129654745 2 Left 1129654733 15:77516623-77516645 CCATCCCCCTCAAGAGTCCCCAG No data
Right 1129654745 15:77516648-77516670 GAGATGTCTGAGTGGTGAGAAGG No data
1129654733_1129654747 23 Left 1129654733 15:77516623-77516645 CCATCCCCCTCAAGAGTCCCCAG No data
Right 1129654747 15:77516669-77516691 GGGCACTGAACTCCACCCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129654733 Original CRISPR CTGGGGACTCTTGAGGGGGA TGG (reversed) Intergenic
No off target data available for this crispr