ID: 1129654738

View in Genome Browser
Species Human (GRCh38)
Location 15:77516628-77516650
Sequence CTCCCCTGGGGACTCTTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129654738_1129654747 18 Left 1129654738 15:77516628-77516650 CCCCTCAAGAGTCCCCAGGGGAG No data
Right 1129654747 15:77516669-77516691 GGGCACTGAACTCCACCCCGAGG No data
1129654738_1129654746 -2 Left 1129654738 15:77516628-77516650 CCCCTCAAGAGTCCCCAGGGGAG No data
Right 1129654746 15:77516649-77516671 AGATGTCTGAGTGGTGAGAAGGG No data
1129654738_1129654745 -3 Left 1129654738 15:77516628-77516650 CCCCTCAAGAGTCCCCAGGGGAG No data
Right 1129654745 15:77516648-77516670 GAGATGTCTGAGTGGTGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129654738 Original CRISPR CTCCCCTGGGGACTCTTGAG GGG (reversed) Intergenic
No off target data available for this crispr