ID: 1129654740

View in Genome Browser
Species Human (GRCh38)
Location 15:77516630-77516652
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129654740_1129654747 16 Left 1129654740 15:77516630-77516652 CCTCAAGAGTCCCCAGGGGAGAT No data
Right 1129654747 15:77516669-77516691 GGGCACTGAACTCCACCCCGAGG No data
1129654740_1129654745 -5 Left 1129654740 15:77516630-77516652 CCTCAAGAGTCCCCAGGGGAGAT No data
Right 1129654745 15:77516648-77516670 GAGATGTCTGAGTGGTGAGAAGG No data
1129654740_1129654746 -4 Left 1129654740 15:77516630-77516652 CCTCAAGAGTCCCCAGGGGAGAT No data
Right 1129654746 15:77516649-77516671 AGATGTCTGAGTGGTGAGAAGGG No data
1129654740_1129654750 30 Left 1129654740 15:77516630-77516652 CCTCAAGAGTCCCCAGGGGAGAT No data
Right 1129654750 15:77516683-77516705 ACCCCGAGGCTTTGCGAAGAGGG No data
1129654740_1129654749 29 Left 1129654740 15:77516630-77516652 CCTCAAGAGTCCCCAGGGGAGAT No data
Right 1129654749 15:77516682-77516704 CACCCCGAGGCTTTGCGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129654740 Original CRISPR ATCTCCCCTGGGGACTCTTG AGG (reversed) Intergenic
No off target data available for this crispr