ID: 1129654742

View in Genome Browser
Species Human (GRCh38)
Location 15:77516640-77516662
Sequence CCCCAGGGGAGATGTCTGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129654728_1129654742 30 Left 1129654728 15:77516587-77516609 CCCCAAAAGACAAACAAACCAAC No data
Right 1129654742 15:77516640-77516662 CCCCAGGGGAGATGTCTGAGTGG No data
1129654733_1129654742 -6 Left 1129654733 15:77516623-77516645 CCATCCCCCTCAAGAGTCCCCAG No data
Right 1129654742 15:77516640-77516662 CCCCAGGGGAGATGTCTGAGTGG No data
1129654731_1129654742 12 Left 1129654731 15:77516605-77516627 CCAACCAGCTCAACATGACCATC No data
Right 1129654742 15:77516640-77516662 CCCCAGGGGAGATGTCTGAGTGG No data
1129654729_1129654742 29 Left 1129654729 15:77516588-77516610 CCCAAAAGACAAACAAACCAACC No data
Right 1129654742 15:77516640-77516662 CCCCAGGGGAGATGTCTGAGTGG No data
1129654730_1129654742 28 Left 1129654730 15:77516589-77516611 CCAAAAGACAAACAAACCAACCA No data
Right 1129654742 15:77516640-77516662 CCCCAGGGGAGATGTCTGAGTGG No data
1129654732_1129654742 8 Left 1129654732 15:77516609-77516631 CCAGCTCAACATGACCATCCCCC No data
Right 1129654742 15:77516640-77516662 CCCCAGGGGAGATGTCTGAGTGG No data
1129654737_1129654742 -10 Left 1129654737 15:77516627-77516649 CCCCCTCAAGAGTCCCCAGGGGA No data
Right 1129654742 15:77516640-77516662 CCCCAGGGGAGATGTCTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129654742 Original CRISPR CCCCAGGGGAGATGTCTGAG TGG Intergenic
No off target data available for this crispr