ID: 1129654743

View in Genome Browser
Species Human (GRCh38)
Location 15:77516641-77516663
Sequence ACCACTCAGACATCTCCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129654743_1129654747 5 Left 1129654743 15:77516641-77516663 CCCAGGGGAGATGTCTGAGTGGT No data
Right 1129654747 15:77516669-77516691 GGGCACTGAACTCCACCCCGAGG No data
1129654743_1129654755 24 Left 1129654743 15:77516641-77516663 CCCAGGGGAGATGTCTGAGTGGT No data
Right 1129654755 15:77516688-77516710 GAGGCTTTGCGAAGAGGGGAAGG No data
1129654743_1129654749 18 Left 1129654743 15:77516641-77516663 CCCAGGGGAGATGTCTGAGTGGT No data
Right 1129654749 15:77516682-77516704 CACCCCGAGGCTTTGCGAAGAGG No data
1129654743_1129654752 20 Left 1129654743 15:77516641-77516663 CCCAGGGGAGATGTCTGAGTGGT No data
Right 1129654752 15:77516684-77516706 CCCCGAGGCTTTGCGAAGAGGGG No data
1129654743_1129654750 19 Left 1129654743 15:77516641-77516663 CCCAGGGGAGATGTCTGAGTGGT No data
Right 1129654750 15:77516683-77516705 ACCCCGAGGCTTTGCGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129654743 Original CRISPR ACCACTCAGACATCTCCCCT GGG (reversed) Intergenic
No off target data available for this crispr