ID: 1129654746

View in Genome Browser
Species Human (GRCh38)
Location 15:77516649-77516671
Sequence AGATGTCTGAGTGGTGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129654731_1129654746 21 Left 1129654731 15:77516605-77516627 CCAACCAGCTCAACATGACCATC No data
Right 1129654746 15:77516649-77516671 AGATGTCTGAGTGGTGAGAAGGG No data
1129654739_1129654746 -3 Left 1129654739 15:77516629-77516651 CCCTCAAGAGTCCCCAGGGGAGA No data
Right 1129654746 15:77516649-77516671 AGATGTCTGAGTGGTGAGAAGGG No data
1129654740_1129654746 -4 Left 1129654740 15:77516630-77516652 CCTCAAGAGTCCCCAGGGGAGAT No data
Right 1129654746 15:77516649-77516671 AGATGTCTGAGTGGTGAGAAGGG No data
1129654732_1129654746 17 Left 1129654732 15:77516609-77516631 CCAGCTCAACATGACCATCCCCC No data
Right 1129654746 15:77516649-77516671 AGATGTCTGAGTGGTGAGAAGGG No data
1129654738_1129654746 -2 Left 1129654738 15:77516628-77516650 CCCCTCAAGAGTCCCCAGGGGAG No data
Right 1129654746 15:77516649-77516671 AGATGTCTGAGTGGTGAGAAGGG No data
1129654737_1129654746 -1 Left 1129654737 15:77516627-77516649 CCCCCTCAAGAGTCCCCAGGGGA No data
Right 1129654746 15:77516649-77516671 AGATGTCTGAGTGGTGAGAAGGG No data
1129654733_1129654746 3 Left 1129654733 15:77516623-77516645 CCATCCCCCTCAAGAGTCCCCAG No data
Right 1129654746 15:77516649-77516671 AGATGTCTGAGTGGTGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129654746 Original CRISPR AGATGTCTGAGTGGTGAGAA GGG Intergenic
No off target data available for this crispr