ID: 1129654747

View in Genome Browser
Species Human (GRCh38)
Location 15:77516669-77516691
Sequence GGGCACTGAACTCCACCCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129654733_1129654747 23 Left 1129654733 15:77516623-77516645 CCATCCCCCTCAAGAGTCCCCAG No data
Right 1129654747 15:77516669-77516691 GGGCACTGAACTCCACCCCGAGG No data
1129654743_1129654747 5 Left 1129654743 15:77516641-77516663 CCCAGGGGAGATGTCTGAGTGGT No data
Right 1129654747 15:77516669-77516691 GGGCACTGAACTCCACCCCGAGG No data
1129654740_1129654747 16 Left 1129654740 15:77516630-77516652 CCTCAAGAGTCCCCAGGGGAGAT No data
Right 1129654747 15:77516669-77516691 GGGCACTGAACTCCACCCCGAGG No data
1129654738_1129654747 18 Left 1129654738 15:77516628-77516650 CCCCTCAAGAGTCCCCAGGGGAG No data
Right 1129654747 15:77516669-77516691 GGGCACTGAACTCCACCCCGAGG No data
1129654741_1129654747 6 Left 1129654741 15:77516640-77516662 CCCCAGGGGAGATGTCTGAGTGG No data
Right 1129654747 15:77516669-77516691 GGGCACTGAACTCCACCCCGAGG No data
1129654737_1129654747 19 Left 1129654737 15:77516627-77516649 CCCCCTCAAGAGTCCCCAGGGGA No data
Right 1129654747 15:77516669-77516691 GGGCACTGAACTCCACCCCGAGG No data
1129654739_1129654747 17 Left 1129654739 15:77516629-77516651 CCCTCAAGAGTCCCCAGGGGAGA No data
Right 1129654747 15:77516669-77516691 GGGCACTGAACTCCACCCCGAGG No data
1129654744_1129654747 4 Left 1129654744 15:77516642-77516664 CCAGGGGAGATGTCTGAGTGGTG No data
Right 1129654747 15:77516669-77516691 GGGCACTGAACTCCACCCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129654747 Original CRISPR GGGCACTGAACTCCACCCCG AGG Intergenic
No off target data available for this crispr