ID: 1129656175

View in Genome Browser
Species Human (GRCh38)
Location 15:77527023-77527045
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129656175_1129656184 4 Left 1129656175 15:77527023-77527045 CCCAGCTCGAGCCCCTGAGACAG No data
Right 1129656184 15:77527050-77527072 CATTCGTCTCCCCTTTTCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129656175 Original CRISPR CTGTCTCAGGGGCTCGAGCT GGG (reversed) Intergenic
No off target data available for this crispr